CN105039328B - Sense colors beans Lasiosphaera fenzlii infects the molecular specificity labeled primers and method of masson pine - Google Patents
Sense colors beans Lasiosphaera fenzlii infects the molecular specificity labeled primers and method of masson pine Download PDFInfo
- Publication number
- CN105039328B CN105039328B CN201510432024.9A CN201510432024A CN105039328B CN 105039328 B CN105039328 B CN 105039328B CN 201510432024 A CN201510432024 A CN 201510432024A CN 105039328 B CN105039328 B CN 105039328B
- Authority
- CN
- China
- Prior art keywords
- labeled primers
- masson pine
- root
- molecular specificity
- specificity labeled
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of molecular specificity labeled primers of sense colors beans Lasiosphaera fenzlii, and the method that masson pine carries out Rapid identification can be infected to Pisolithus tinctorius.The primer sequence is：Sense primer：5'‑CAGGAGGATGGACTCGCAGGGTTTC‑3'；Downstream primer：5'‑CCATGACGTGGGCATTGCTTGAACT‑3'.Molecular specificity labeled primers of the present invention can carry out Pisolithus tinctorius in mycorhiza quick Early Identification compared with routine morphological detection, microexamination, have detection time short, the high advantage of accuracy；As long as 1 day the time required to the method for the present invention detection, and the morphological observation of routine, microexamination test required at least two weeks time.
Description
(1) technical field
The present invention relates to sense colors beans Lasiosphaera fenzlii early stages to infect the molecular specificity labeled primers of masson pine, and utilizing should
Primer pair Pisolithus tinctorius early stage infects the method that masson pine is differentiated and detected.
(2) background technology
Mycorhiza (Mycorrhizas) is fungi (fungal component) has specific modality structure and work(with what host plant root was formed
It is mechanical to the absorption of nutrition, the growth of promotion host plant, generation antibiotics and formation to increase host plant for the homobium of energy
Barrier enhances the premunition etc. of host plant.The exotrophic mycorrhiza that fungi based on basidiomycetes is formed with forest symbiosis
(Ectomycorrhiza) be forest-tree natural keeping system, in forest ecosystem have extremely important status and
Effect has the function of special (Hua Xiaomei, 1997) in terms of keeping Forest Productivity for a long time.Using exotrophic mycorrhiza to trees and
The beneficial effect of forest ecosystem promotes the development of forestry, and improving one that production of forestry power is forestry to the maximum extent can hold
The road of supervention exhibition.
Pisolithus tinctorius (Pisolithus tinctorius (Pers.) Coker＆Couch) also known as pisolithus tinctorius Coker et Coucs are a kind of
Applying Ectomycorrhizal Fungi can survive on the root of sapling, be a kind of promising exotrophic mycorrhiza commensal of Song Miao.With this true
The sapling of bacterium can grow under severe edaphic condition, and than having other fungi exotrophic mycorrhizas under excellent growing conditions
Sapling grows soon, therefore in afforestation often first by after seedling inoculation this bacterium, then is transplanted to mountain area, to increase the survival of sapling
Rate.Due to being only that can not sentence by visually observing root early stage Ectomycorrhizal Fungus, Pisolithus tinctorius infects Pinus massoniana root
The characteristics of disconnected generation infected and infecting degree, therefore needing sample size small and high sensitivity according to molecular dna identification, therefore
For development is easy, fast and accurately identification technology provides effective means.And comparatively Molecular Identification means are relatively stablized,
Have the characteristics that rapid, easy, inexpensive.
(3) invention content
It is an object of the present invention to provide a kind of molecular specificity labeled primers of sense colors beans Lasiosphaera fenzlii, and can be to colored-bean
Lasiosphaera fenzlii infects the method that masson pine carries out Rapid identification.
The technical solution adopted by the present invention is：
The molecular specificity labeled primers of Pisolithus tinctorius in mycorhiza, the primer sequence are：
Sense primer：5'-CAGGAGGATGGACTCGCAGGGTTTC-3'；
Downstream primer：5'-CCATGACGTGGGCATTGCTTGAACT-3'.
The primer pair is on the basis of library construction, using round pcr, by a large amount of screening tests, the colour of acquisition
The DNA fragment specific of beans Lasiosphaera fenzlii, by the segment cloning and sequencing, based on obtained DNA sequence dna, designed specificity is drawn
Object carries out PCR amplification with the primer pair Pisolithus tinctorius and masson pine, can get the specific fragment of 349 sizes.
Whether the tip of a root that masson pine is formed is invaded using the molecular specificity labeled primers the invention further relates to a kind of
The method that dye Pisolithus tinctorius is identified and detected, the method are：Masson pine tip of a root DNA to be measured is extracted as template, with
The molecular specificity labeled primers carry out PCR amplification as amplimer, electrophoresis detection are carried out to amplified production, if electrophoresis
As a result there are the DNA bands of 349bp, then infected Pisolithus tinctorius in the masson pine tip of a root to be measured；The molecular specificity
Labeled primer sequence is：
Sense primer：5'-CAGGAGGATGGACTCGCAGGGTTTC-3'；
Sense primer：5'-CCATGACGTGGGCATTGCTTGAACT-3'.
The method of the present invention key is that the selection of amplimer, DNA extractions, PCR reaction systems and reaction condition determine, with
And electrophoresis detection, it can be carried out according to this field conventional method.
Preferably, PCR reaction systems composition of the present invention is as follows：
Specifically, PCR reaction conditions are as follows：
94 DEG C of pre-degeneration 6min；92 DEG C of denaturation 40s, 54.5 DEG C of annealing 40s, 72 DEG C of extension 2min, totally 30 recycle；Finally
In 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
PCR Buffer final concentration of 1 ×, refer in PCR Buffer the concentration of each component in the reaction system with 1 ×
PCR Buffer are identical, and it is 10 × PCR Buffer of reaction system volume 1/10 usually to select volume.10×PCR Buffer
Ingredient is：100mM Tris-HCl (pH8.5), 500mM KCl, 25mM MgCl2 and 1.0%Triton-X-100, solvent are
ddH2O。
Specifically, the method for the invention is as follows：
(1) the masson pine tip of a root to be measured is taken, masson pine tip of a root genomic DNA to be measured is extracted with SDS-CTAB methods；
(2) using the genomic DNA of step (1) extraction as template, draw using the molecular specificity labeled primers as amplification
Object carries out PCR amplification：
The every 20 μ L compositions of PCR reaction systems are as follows：
PCR reaction conditions are as follows：
94 DEG C of pre-degeneration 6min；92 DEG C of denaturation 40s, 54.5 DEG C of annealing 40s, 72 DEG C of extension 2min, totally 30 recycle；Finally
In 72 DEG C of filling-in 7min, final temperature is 4 DEG C；
(3) 5 μ L of step (2) amplified production are taken, with 1 μ L, 0.25% bromjophenol blue buffer solution mixings, point sample is in 1.5% fine jade
On sepharose, in 1 × TAE buffer solutions, electrophoresis under 5V/cm voltages, EB is dyed after electrophoresis, EB dyeing usually containing
It is dyed 30 minutes in the aqueous solution of 0.5 μ g/m1EB.It takes a picture on automatic gel image analysis instrument, if 349bp occurs in electrophoresis result
DNA bands, then Pisolithus tinctorius has been infected in the tip of a root to be measured, it is on the contrary then no.
Advantageous effect of the present invention is mainly reflected in：Molecular specificity labeled primers of the present invention can be to Pisolithus tinctorius in mycorhiza
Quick Early Identification is carried out, with routine morphological detection, compared with microexamination, has detection time short, high excellent of accuracy
Point；As long as 1 day the time required to the method for the present invention detection, and the morphological observation of routine, microexamination test the required time
At least two weeks.
(4) it illustrates
Fig. 1 is the result that PCR amplification is carried out to the masson pine tip of a root；M is DNA molecular amount standard；Arrow meaning is from number
The special DNA bands that the molecular weight that the masson pine tip of a root to have infected Pisolithus tinctorius amplifies is 349bp；Remaining number
For do not infect Pisolithus tinctorius the masson pine tip of a root amplification.
(5) specific implementation mode
With reference to specific embodiment, the present invention is described further, but protection scope of the present invention is not limited in
This：
Embodiment 1：
(1) extraction of genomic DNA：The extraction of genomic DNA is used to be extracted with SDS-CTAB methods.The gene of purifying
Group DNA first with 1.5% agarose gel electrophoresis qualitative detection, then quantitatively detected with DNA/RNA ultraviolet specrophotometers.DNA
Extract is spare in -20 DEG C of refrigerator storages.
(2) specific PCR amplification primer is designed, the sequence of primer pair is sense primer 5'-
CAGGAGGATGGACTCGCAGGGTTTC-3' and downstream primer 5'-CCATGACGTGGGCATTGCTTGAACT-3', by Shanghai
Sheng Gong biotechnologies Co., Ltd synthesizes.
(3) PCR amplification of mycorhiza identification：
PCR reaction systems form：
10 × PCR Buffer, 2 μ l, 10mmol/L dNTPs, 2 μ l, 25mmol/L MgCl22 μ l, 5U/ μ l Taq DNA
0.5 μ l, 25mM special primers of enzyme are to each 1 μ l, 20ng/ μ l template DNAs 3 μ l, ddH2O complements to 20 μ l.
Amplified reaction carries out on TC-XP type amplification instruments.
PCR reaction conditions are as follows：
94 DEG C of pre-degeneration 6min；
92 DEG C of denaturation 40s, 68 DEG C of annealing 40s, 72 DEG C of extension 2min, totally 30 recycle；
Finally in 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
(4) electrophoresis detection：Step (3) pcr amplification product 5ul is taken, with 0.25% bromjophenol blue buffer solution mixings of 1ul, point sample
In on 1.5% Ago-Gel, in 1 × TAE buffer solutions, electrophoresis under 5V/cm voltages, after electrophoresis, containing 0.5 μ g/
It dyes in the aqueous solution of m1EB 30 minutes, then takes a picture on training the clear automatic gel image analysis instrument of JS-380A.
According to the method described above, coloured silk is not infected to multiple masson pine tips of a root (number 1~3) for infecting Pisolithus tinctorius and respectively
The masson pine tip of a root (number 4~6) of color beans Lasiosphaera fenzlii is detected electrophoresis result and sees Fig. 1.Wherein number 1-3 samples, all amplify
Molecular weight is the special DNA bands of 349bp or so, and the special DNA bands that remaining number there are no 349bp or so generate, also not
There are other non-purpose bands to generate, it is seen that molecular specificity marker of the present invention is used for the identification of Pisolithus tinctorius in mycorhiza, steady
Qualitative good, specific height.
Claims (3)
1. the molecular specificity labeled primers of Pisolithus tinctorius in mycorhiza, the primer sequence are as follows：
Sense primer：5 '-CAGGAGGATGGACTCGCAGGGTTTC-3 ',
Downstream primer：5′-CCATGACGTGGGCATTGCTTGAACT-3′.
2. a kind of identifying in the masson pine tip of a root whether infect colored-bean using molecular specificity labeled primers described in claim 1
The method of Lasiosphaera fenzlii, the method are：Masson pine tip of a root DNA to be measured is extracted as template, with the molecular specificity labeled primers
As amplimer, PCR amplification is carried out, electrophoresis detection is carried out to amplified production, if there are the DNA bands of 349bp in electrophoresis result,
Pisolithus tinctorius then has been infected in the masson pine tip of a root to be measured, it is on the contrary then no；The molecular specificity labeled primers sequence is：
Sense primer：5 '-CAGGAGGATGGACTCGCAGGGTTTC-3 ',
Downstream primer：5′-CCATGACGTGGGCATTGCTTGAACT-3′；
The PCR amplification condition is as follows：94 DEG C of pre-degeneration 6min；92 DEG C of denaturation 40s, 54.5 DEG C of annealing 40s, 72 DEG C of extensions
2min, totally 30 recycle；Finally in 72 DEG C of filling-in 7min, final temperature is 4 DEG C.
3. method as claimed in claim 2, it is characterised in that the method is as follows：
(1) it takes the masson pine tip of a root to be measured, liquid feeding nitrogen to grind, the genomic DNA of the masson pine tip of a root to be measured is extracted with SDS-CTAB methods；
(2) using the genomic DNA of step (1) extraction as template, using the molecular specificity labeled primers as amplimer, into
Row PCR amplification：
The every 20 μ L compositions of PCR amplification system are as follows：
ddH2O complements to 20 μ L；；
PCR amplification condition is as follows：
94 DEG C of pre-degeneration 6min；92 DEG C of denaturation 40s, 54.5 DEG C of annealing 40s, 72 DEG C of extension 2min, totally 30 recycle；Finally in 72
DEG C filling-in 7min, final temperature are 4 DEG C；
(3) 5 μ L of step (2) amplified production are taken, with 1 μ L, 0.25% bromjophenol blue buffer solution mixings, point sample is in 1.5% agarose
On gel, in 1 × TAE buffer solutions, electrophoresis under 5V/cm voltages, EB is dyed after electrophoresis, in automatic gel image analysis instrument
Upper photograph has infected Pisolithus tinctorius if the DNA bands of 349bp occurs in electrophoresis result in the tip of a root to be measured；It is on the contrary then
It is no.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510432024.9A CN105039328B (en) | 2015-07-21 | 2015-07-21 | Sense colors beans Lasiosphaera fenzlii infects the molecular specificity labeled primers and method of masson pine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510432024.9A CN105039328B (en) | 2015-07-21 | 2015-07-21 | Sense colors beans Lasiosphaera fenzlii infects the molecular specificity labeled primers and method of masson pine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105039328A CN105039328A (en) | 2015-11-11 |
| CN105039328B true CN105039328B (en) | 2018-07-17 |
Family
ID=54446301
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510432024.9A Expired - Fee Related CN105039328B (en) | 2015-07-21 | 2015-07-21 | Sense colors beans Lasiosphaera fenzlii infects the molecular specificity labeled primers and method of masson pine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039328B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102181544B (en) * | 2011-04-11 | 2012-11-14 | 南京林业大学 | Molecular detection method for pisolithus tinctorius of forest ectomycorrhizal fungi |
-
2015
- 2015-07-21 CN CN201510432024.9A patent/CN105039328B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102181544B (en) * | 2011-04-11 | 2012-11-14 | 南京林业大学 | Molecular detection method for pisolithus tinctorius of forest ectomycorrhizal fungi |
Non-Patent Citations (3)
| Title |
|---|
| Identification of ectomycorrhizal fungi of the genus Tuber by species-specific ITS primers;A. AMICUCCI 等;《Molecular Ecology》;19980731;第7卷(第7期);第273-277页 * |
| 林木外生菌根真菌彩色豆马勃巢式PCR检测;周爱东 等;《应用与环境生物学报》;20120229;第18卷(第2期);第298-302页 * |
| 真菌rDNA的特点及在外生菌根菌鉴定中的应用;林晓民 等;《西北农业学报》;20050228;第14卷(第2期);第120-125页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105039328A (en) | 2015-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104946640B (en) | The specificity labeled primers and detection method of the long woods of oil tea breeding No. 18 | |
| CN103361425B (en) | Primer and method for identifying purity of cucumber 'Yuexiu No.3' hybrid seed | |
| CN106916897A (en) | One kind is used to identify the molecular labeling and its application of giant pumpkin ' silver-colored brightness three ' hybrid seed purity | |
| CN104673790B (en) | The molecular specificity labeled primers and authentication method of the long woods of oil tea breeding No. 18 | |
| CN102304587A (en) | Method for rapidly identifying erect panicle of rice | |
| CN110373488A (en) | It is a kind of detect transgene component DNA standard sample and its application | |
| CN108796119A (en) | Specific molecular marker PCMI-M001 for Cathay poplar male seedling Rapid identification | |
| KR102382106B1 (en) | A set of specific molecular markers for differentiating between lychee and red lye species, and their methods and applications | |
| CN101475991B (en) | Method for identifying black fungus bacterial strain 185 and gene sequence for identifying black fungus bacterial strain 185 | |
| CN112695124A (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN105039328B (en) | Sense colors beans Lasiosphaera fenzlii infects the molecular specificity labeled primers and method of masson pine | |
| CN103993070A (en) | SSR primer and method for purity identification of Linglong zucchini hybrid seed | |
| CN106636369A (en) | Molecular specific labeling primer of physalis minima and detection method | |
| CN108754015A (en) | Specific molecular marker PCMI-F001 for Cathay poplar female seedling Rapid identification | |
| CN105631245B (en) | A kind of primer special and its identification method for identifying eastern cottonwood choiceness | |
| CN108517373A (en) | It one InDel labeled primer pair for distinguishing five pepper cultivation kinds and its applies | |
| CN104975010B (en) | The molecular specificity labeled primers and detection method of the long woods of oil tea breeding No. 21 | |
| CN106636327B (en) | A kind of bluish dogbean micro satellite DNA label finger-print and its application | |
| CN104120168B (en) | Fusarium sambucinum detection kit and detection method | |
| CN104561270A (en) | Molecular biology distinguishing method for two types of Cnaphalocrocis medinalis Guenee larvae | |
| CN105567842B (en) | Identify Hericium erinaceus monkey outstanding No. 2 primer pairs and method | |
| CN104946642B (en) | The molecular specificity labeled primers and detection method of the long woods of oil tea breeding No. 18 | |
| CN109628625A (en) | Identify specific primer, the kit, method and its application of six younger sister hickory chicks | |
| CN109628626A (en) | Identify specific primer, the kit, method and its application of terraced rib hickory chick | |
| CN105132420B (en) | A kind of primer set for identifying corn variety purity and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180717 Termination date: 20190721 |