CN105039320A - RNA, application thereof, composition containing same, recombinant expression vector, and host cell - Google Patents
RNA, application thereof, composition containing same, recombinant expression vector, and host cell Download PDFInfo
- Publication number
- CN105039320A CN105039320A CN201510382699.7A CN201510382699A CN105039320A CN 105039320 A CN105039320 A CN 105039320A CN 201510382699 A CN201510382699 A CN 201510382699A CN 105039320 A CN105039320 A CN 105039320A
- Authority
- CN
- China
- Prior art keywords
- cell
- trail
- mir
- rna
- cancer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention relates to the biological technical field, and specially relates to a RNA, an application thereof, a composition containing the same, a recombinant vector, and a host cell. The RNA can effectively inhibit the expression level of Has-miR-222, and strengthen the activity of TRAIL on killing tumor cells. The provided recombinant virus is bioactive, and is advantageously for being chosen as a candidate virus for tumor gene therapy.
Description
Technical field
The present invention relates to biological technical field, particularly a kind of RNA and uses thereof, the composition comprising this RNA, recombinant expression vector and host cell.
Background technology
Tumour is one of number one killer threatening human health, and current not highly effective means treat tumour.Traditional methods for the treatment of, as chemotherapy, radiotherapy, operation and targeted drug, although successfully can control tumour at first, often can produce other behavior a series of by inducing host cell conversely again, and then finally lead oncogenic recurrence, diffusion and transfer.Gene therapy, due to advantages such as it are with strong points, targeting is good, effectively and substantially have no side effect, more and more receives favor and the concern of people these years.TRAIL (tumornecrosisfactor-relatedapoptosisinducingligand) belongs to tumour necrosis factor (TNF) family member, because it optionally can kill tumour cell, but toxicity is not had and one of study hotspot becoming gene therapy for cancer to most healthy tissues.Research show vein multiple injection recombinant soluble TRAIL can inducing apoptosis of tumour cell, the growth of Tumor suppression and formation, but do not cause the toxicity that can monitor to occur while extending the survival time of laboratory animal.Although it can induced various types of tumors apoptosis, different tumour cells is different to the susceptibility of TRAIL, therefore strengthens the susceptibility of resistant cell to TRAIL and has good potential applicability in clinical practice.
Current research shows, the mechanism of TRAIL resistance is different in different cell, there are the hypothesis such as the high expression level of such as false receptor occupancy, cell interior anti-apoptotic molecule, but some hypothesis checking difficulty, and current not highly effective method improves TRAIL resistance problem.
Summary of the invention
In view of this, the invention provides a kind of RNA and uses thereof, the composition comprising this RNA, recombinant expression vector and host cell.This RNA effectively can suppress the expression level of miR-222, strengthens TRAIL to the killing activity of A549.Recombinant virus provided by the invention has biologic activity, promises to be the viral candidates of therapy of tumor.
In order to realize foregoing invention object, the invention provides following technical scheme:
The invention provides a kind of RNA, it is characterized in that, it has:
(I) nucleotide sequence, as shown in SEQIDNo.1; Or
(II) complementary sequence of the nucleotide sequence, as shown in SEQIDNo.1; Or
(III), with the nucleotide sequence coded same protein of (I) or (II), but the sequence different from the nucleotide sequence of (I) or (II) because of the degeneracy of genetic code; Or
(IV), the sequence of 70% homology is had at least with (I) or (II) or (III) described sequence.
Present invention also offers described RNA for suppressing the purposes of Hsa-miR-222.
Present invention also offers a kind of composition, comprise TRAIL
95-281with described RNA.
Present invention also offers the preparation method of described composition:
Step 1: will encode TRAIL
95-281be connected in carrier with the nucleotide sequence of described RNA, construction of expression vector;
Step 2: by described expression vector transformed host cell, expresses, and collects expression product, to obtain final product.
Present invention also offers a kind of recombinant expression vector, comprising:
(1) encode TRAIL
95-281nucleotide sequence; And/or
(2) to encode the nucleotide sequence of RNA of the present invention.
In specific embodiments more of the present invention, the construction process of described recombinant expression vector, will encode TRAIL
95-281be connected in carrier with the nucleotide sequence of described RNA, construction of expression vector.
In specific embodiments more of the present invention, the carrier in the construction process of described recombinant expression vector is plasmid or virus.
In specific embodiments more of the present invention, in the construction process of described recombinant expression vector, virus is adeno-associated virus.
Present invention also offers a kind of host cell, comprise described recombinant expression vector.
The structure of described recombinant expression vector is pAM-CAG-pL-INS-TRAIL
95-281the AAV recombinant expression vector of-polyA-U6-miR-222-TuD-WPRE-BGHpolyA, is called for short AAV-TRAIL-miR-222-TuD.
Described recombinant expression vector comprises: pAM (theabbreviationoftheplasmidofanti-ampcilinconstruction), ITR (adeno-associatedvirus2invertedterminalrepeatsequence), CAG (cytomegalovirusimmediated-earlyenhancer/chicken β-actinhybrid), INS (humanInsulin) secretionsignalpeptide, pL (poly-linker), TRAIL
95-281(coding TRAIL the 95 to 281 amino acids), polyA (polyadenylic acid), U6, miR-222-TuD, WPRE (WoodchuckHeptitisVirusPosttranscriptionalRegulatoryEleme nt), BGH (Bostaurusgrowthhormone), polyA (polyadenylic acid) and ITR (adeno-associatedvirus2invertedterminalrepeatsequence).
Wherein, the sequence of ITRsequence (PatentWO0220748) is as shown in SEQIDNo.5; The sequence of CAGsequence is as shown in SEQIDNo.6; The sequence of INSsecretionsignalpeptidesequence (Genbankaccessionno.NM000207) is as shown in SEQIDNo.7; The sequence of WPREsepuence (Genbankaccessionno.J04514) is as shown in SEQIDNo.8; The sequence of BGH (Bostaurusgrowthhormone) pAsequence is as shown in SEQIDNo.9; TRAIL
95-281the sequence of aminoacidsequence (PatentZL03138357.2) is as shown in SEQIDNo.10.
In specific embodiments more of the present invention, described host cell is cell strain, and described cell strain is selected from HeLa cell, A549 cell, Bel-7402 cell, CNE-2Z cell, EC109 cell, MGC-803 cell, SW1990 cell, DU145 cell, U251 cell, A875 cell, HCT116 cell, MCF7 cell or SK-OV-3 cell.
Present invention also offers the application in the medicine of preparation treatment tumour of described composition, described recombinant expression vector, described host cell.
In specific embodiments more of the present invention, described tumour is primary, Secondary cases or metastatic tumour.
In specific embodiments more of the present invention, described tumour comprises lung cancer, liver cancer, nasopharyngeal carcinoma, the esophageal carcinoma, colorectal cancer, cancer of the stomach, carcinoma of the pancreas, prostate cancer, neurospongioma, melanoma, mammary cancer, cervical cancer or ovarian cancer.
Experiment of the present invention proves, the resistance of cell to TRAIL can be strengthened at HeLa cell, A549 cell, Bel-7402 cell, CNE-2Z cell, EC109 cell, MGC-803 cell, SW1990 cell, DU145 cell, U251 cell, A875 cell, HCT116 cell, MCF7 cell, SK-OV-3 transit cell after having contaminated the mimics of Has-miR-222, and the susceptibility (Fig. 1) of cell to TRAIL can be strengthened after the transfection inhibitor of Has-miR-222.The miR-222 specific inhibitor TuD (Fig. 2 A) of engineer, and on original pAM/CAG-TRAIL carrier basis, adding polyA to stop II class promotor CAG, the III class promotor U6 that then insertion one is new expresses miR-222-TuD (Fig. 2 B).Be transferred to by the co-expression plasmid built in 293T cell and verify the targeted inhibition effect of each inhibitor to miR-222, miR-222-TuD effectively can suppress the expression level (Fig. 2 C) of miR-222.Proceed in Hela by each co-expression plasmid, with the two transfect cell apoptosis detection kit flow cytometer detection apoptosis of AnnexinV-FITC/PI, can see, miR-222-TuD can strengthen the killing activity (Fig. 2 D) of TRAIL to Hela.
Adopt helper virus defective packages system to carry out the packaging of this recombinant co-expression carrier, virus is purified by Visipaque 320 density gradient ultracentrifugation, and ultrafiltration and concentration, Real-timePCR determines its final titre.The AAV recombinant virus (AAV-EGFP) of same method preparation and packager code green fluorescent protein (EGFP) is as negative control, and only the AAV-TRAIL of coding trail protein is as positive control.After AAV-EGFP virus infection 293 cell and A549 cell 72h, the luciferase expression situation of observation of cell, can see that cell is successfully infected and have expressed green fluorescent protein (Fig. 3 A).AAV-EGFP, AAV-TRAIL, AAV-TRAIL+miR-222-TuD are infected 293 cells respectively, detect after being infected by AAV-TRAIL and AAV-TRAIL+miR-222-TuD, the expression level of TRAIL obviously raises (Fig. 3 B), and after being infected by AAV-TRAIL+miR-222-TuD, the expression of miR-222 is obviously suppressed (Fig. 3 C).In A549 nude mouse in transplanted tumor experiment, after AAV-TRAIL treatment, tumor growth is suppressed, but more obvious growth-inhibiting (Fig. 4) can be seen in AAV-TRAIL+miR-222-TuD combination therapy group, and by targeted inhibition miR-222, miR-222-TuD promotes that its target gene PTEN plays a role (Fig. 5) indirectly, show that the recombinant virus obtained has biologic activity, promise to be the viral candidates of therapy of tumor.
Accompanying drawing explanation
In order to be illustrated more clearly in the embodiment of the present invention or technical scheme of the prior art, be briefly described to the accompanying drawing used required in embodiment or description of the prior art below.
Fig. 1 shows the impact of miR-222 on TRAIL resistance; After transfection mimics and inhibitors of miR-222, then stimulate human cervical carcinoma cell Hela, human A549 cell lines, Human hepatoma cell line Bel-7402, human nasopharyngeal carcinoma cells CNE-2 Z, human esophagus cancer cell EC109, gastric carcinoma cells MGC-803, human pancreatic cancer cell SW1990, Human Prostate Cancer Cells DU145, human glioma cell U251, human melanoma cell A875, human breast cancer cell MCF7, Human colorectal cancer cells HCT116, Proliferation of Human Ovarian Cell SK-OV-3 to the lethal effect of cell with trail protein;
Fig. 2 shows structure and the functional verification of pAM/CAG-TRAIL-U6-miR-222-TuD co-expression plasmid, wherein Fig. 2 (A): the sequences Design of miR-222-TuD; Fig. 2 (B): the expression structure of pAM/CAG-TRAIL-polyA-U6-miR-222-TuD co-expression carrier; Impact on miR-222 expression level after Fig. 2 (C): co-expression plasmid transfection 293T cell; On apoptotic impact after Fig. 2 (D): flow cytometer detection co-expression plasmid transfection Hela cell;
Fig. 3 shows the biologic activity of recombinant virus; Fig. 3 (A) shows that AAV-EGFP successfully can infect 293 cells and A549 cell and make its expressing green fluorescent protein; Fig. 3 (B) AAV-TRAIL and AAV-TRAIL+miR-222-TuD can successful process LAN TRAIL after infecting 293 cells; Fig. 3 (C) AAV-TRAIL+miR-222-TuD effectively can strike the expression level of low miR-222;
Fig. 4 shows that A549 tumor-bearing mice is after restructuring AAV-TRAIL and AAV-TRAIL+miR-222-TuD process, and the growth of subcutaneous tumors is suppressed, and AAV-TRAIL+miR-222-TuD can promote the result of use of AAV-TRAIL, obvious Tumor suppression growth; The downtrod morphological observation of Fig. 4 (A) subcutaneous tumors; The dynamic observation of Fig. 4 (B) administration posterior tuberosity volume change; The difference that when place Fig. 4 (C) is dead, knurl is heavy;
Fig. 5 shows by regulating the change level of target gene PTEN result: the Fig. 5 (A) that plays a role, miR-222-TuD shows that PTEN is miR-222 target gene; Fig. 5 (B) shows that miR-222-TuD can raise PTEN expression level in vivo.
Embodiment
The invention discloses a kind of RNA and uses thereof, comprise the composition of this RNA, recombinant expression vector and host cell, those skilled in the art can use for reference present disclosure, and suitable improving technique parameter realizes.Special needs to be pointed out is, all similar replacements and change apparent to those skilled in the art, they are all deemed to be included in the present invention.Method of the present invention and application are described by preferred embodiment, related personnel obviously can not depart from content of the present invention, spirit and scope methods and applications as herein described are changed or suitably change with combination, realize and apply the technology of the present invention.
First object of the present invention is to provide Hsa-miR-222 impact on TRAIL resistance in different clone.
Described different cell is HeLa cell, A549 cell, Bel-7402 cell, CNE-2Z cell, EC109 cell, MGC-803 cell, SW1990 cell, DU145 cell, U251 cell, A875 cell, HCT116 cell, MCF7 cell, SK-OV-3 cell.
Second object of the present invention is to provide a kind of carrier, described vector expression TRAIL
95-281(coding TRAIL the 95 to 281 amino acids) albumen.
3rd object of the present invention is design Hsa-miR-222 specific inhibitor TuD, and its sequence is as shown in SEQIDNO.1.
Described specific inhibitor TuD can mediate the degraded of miRNA, and it is built into DNA sequence dna in carrier as shown in SEQIDNO.2.
4th object of the present invention is the soluble human TRAIL providing a kind of secretor type
95-281with the preparation method of the inhibitor TuD co-expression carrier of miR-222, the structure of this expression vector is pAM-CAG-pL-INS-TRAIL
95-281the AAV recombinant expression vector of-polyA-U6-miR-222-TuD-WPRE-BGHpolyA, is called for short AAV-TRAIL-miR-222-TuD.
Described carrier comprises: pAM (theabbreviationoftheplasmidofanti-ampcilinconstruction), ITR (adeno-associatedvirus2invertedterminalrepeatsequence), CAG (cytomegalovirusimmediated-earlyenhancer/chicken β-actinhybrid), INS (humanInsulin) secretionsignalpeptide, pL (poly-linker), TRAIL
95-281(coding TRAIL the 95 to 281 amino acids), polyA (polyadenylic acid), U6, miR-222-TuD, WPRE (WoodchuckHeptitisVirusPosttranscriptionalRegulatoryEleme nt), BGH (Bostaurusgrowthhormone), polyA (polyadenylic acid) and ITR (adeno-associatedvirus2invertedterminalrepeatsequence).
Wherein, the sequence of ITRsequence (PatentWO0220748) is as shown in SEQIDNo.5; The sequence of CAGsequence is as shown in SEQIDNo.6; The sequence of INSsecretionsignalpeptidesequence (Genbankaccessionno.NM000207) is as shown in SEQIDNo.7; The sequence of WPREsepuence (Genbankaccessionno.J04514) is as shown in SEQIDNo.8; The sequence of BGH (Bostaurusgrowthhormone) pAsequence is as shown in SEQIDNo.9; TRAIL
95-281the sequence of aminoacidsequence (PatentZL03138357.2) is as shown in SEQIDNo.10.
Described carrier is plasmid or virus, and described virus is adeno-associated virus.
5th object of the present invention is to provide a kind of composition, comprises TRAIL
95-281with the RNA suppressing Hsa-miR-222.
In described composition, the RNA of described suppression Hsa-miR-222 is TuD, and its sequence is as shown in SEQIDNO.1.
6th object of the present invention is to provide the carrier of above-mentioned any one, composition or the purposes of cell strain in Therapeutic cancer or tumour.
Described cancer or tumour are primary, Secondary cases or metastatic tumour.
In described purposes, described tumour comprises cervical cancer, lung cancer, liver cancer, nasopharyngeal carcinoma, the esophageal carcinoma, colorectal cancer, cancer of the stomach, carcinoma of the pancreas, prostate cancer, neurospongioma, melanoma, mammary cancer, ovarian cancer.
In the present invention, adopt the modern biology techniques and methods such as genetically engineered, provide encoding human TRAIL
95-281with miR-222-TuD restructuring AAV co-expression carrier and viral preparation, packaging and application thereof.
The invention provides RNA and uses thereof, comprise the composition of this RNA, recombinant expression vector and host cell.Wherein, if no special instructions, the various reaction reagents related in embodiment all can be bought by commercial channel and obtain; If no special instructions, the concrete operations related in embodiment are see " the Molecular Cloning: A Laboratory guide third edition ".
Below in conjunction with embodiment, set forth the present invention further:
Embodiment 1miR-222 adopts CCK-8 method to detect on the impact of TRAIL inducing apoptosis of tumour cell activity
Get 2 × 10 respectively
5heLa cell, A549 cell, Bel-7402 cell, CNE-2Z cell, EC109 cell, MGC-803 cell, SW1990 cell, DU145 cell, U251 cell, A875 cell, HCT116 cell, MCF7 cell, SK-OV-3 cell (volume is 2ml) is inoculated in 6 orifice plates, transfection is contrasted by the stand-in of Invitrogen company synthetic respectively, miR-222 stand-in, inhibitor contrasts, after miR-222 inhibitors 4 8h, cell dissociation is got off to be inoculated in 96 orifice plates, 8000, every hole cell, add trail protein to final concentration 100ng/ml, stimulate 24h, remove substratum, every hole adds the substratum (100 μ l substratum add 10 μ lCCK-8s) of 110 μ l containing CCK-8, 37 DEG C of incubations, on MD/SPECTRAMAX340 spectrophotometer, 450nm place absorbance value is read every one hour, calculate cell survival rate (cell survival rate=experimental group absorbance value/control group absorbance value × 100%).Each group setting five sample wells, often group experiment in triplicate.
MiR-222 process LAN can cause cell to the resistance of TRAIL, specifically sees Fig. 1 (A) ~ Fig. 1 (C).
After the stand-in of transfection miR-222 and inhibitor, then stimulate human cervical carcinoma cell Hela, human A549 cell lines, Human hepatoma cell line Bel-7402, human nasopharyngeal carcinoma cells CNE-2 Z, human esophagus cancer cell EC109, gastric carcinoma cells MGC-803, human pancreatic cancer cell SW1990, Human Prostate Cancer Cells DU145, human glioma cell U251, human melanoma cell A875, human breast cancer cell MCF7, Human colorectal cancer cells HCT116, Proliferation of Human Ovarian Cell SK-OV-3 to the lethal effect of cell with trail protein.
The structure of embodiment 2pAM/CAG-TRAIL-polyA-U6-miR-222-TuD co-expression plasmid
U6 promotor (as shown in SEQIDNo.3) is expanded later Taq enzyme with PCR and adds a, cut glue and reclaim, be connected in carrier T.Synthetic polyA tailer sequence GGCCGCAATAAAATATCTTTATTTTCATTACATCTGTGTGTTGGTTTTTT (as shown in SEQIDNo.4) simultaneously, annealing, the carrier T (EcoRV restriction enzyme site is in the upstream of U6 promotor) of U6 promotor has been connected into EcoRV single endonuclease digestion, polyA sequence is connected in carrier T in flush end mode, obtains the sequence of polyA and U6 promotor series connection.Synthetic miR-222-TuD sequence, and add that in upstream SpeI restriction enzyme site sticks end, add that in downstream HindIII restriction enzyme site and SacI restriction enzyme site stick end, be connected with the carrier T (SpeI and SacI is in the downstream of U6) of polyA and U6 with SpeI and SacI double digestion simultaneously, miR-222-TuD sequence is connected into wherein, obtains the sequence of polyA-U6-miR-222-TuD series connection.Like this, the carrier T of polyA upstream has a HindIII restriction enzyme site originally existed, and in the downstream of miR-222-TuD, there is the HindIII restriction enzyme site of our oneself introducing, by this restructuring carrier T of HindIII single endonuclease digestion, cut the aim sequence that glue purification obtains us, the simultaneously rAAV2 package carrier (HindIII restriction enzyme site is in the downstream of TRAIL) of pAM/CAG-TRAIL that has been pre-existing in of HindIII single endonuclease digestion, two portions T4 ligase enzyme is linked together, order-checking qualification is forward and reverse, obtains object recombinant plasmid.Empirical tests function, the treatment works well for TRAIL and miR-222-TuD combined utilization, thus helper virus defective packages system is adopted to carry out the packaging of this restructuring AAV-TRAIL-miR-222-TuD carrier, virus adopts Visipaque 320 density gradient ultracentrifugation purifying respectively, ultrafiltration and concentration, Real-timePCR determines its final titre.
The structure of pAM/CAG-TRAIL-U6-miR-222-TuD co-expression plasmid and functional verification result:
Fig. 2 (A) shows the sequences Design of miR-222-TuD;
Fig. 2 (B) shows the expression structure of pAM/CAG-TRAIL-polyA-U6-miR-222-TuD co-expression carrier;
Fig. 2 (C) shows the impact on miR-222 expression level after co-expression plasmid transfection 293T cell;
Fig. 2 (D) shows after flow cytometer detection co-expression plasmid transfection Hela cell apoptotic impact.
Embodiment 3 is recombinated AAV-TRAIL+miR-222-TuD and Determination of biological activity thereof
HEKC HEK293T adds 2 × 10 cultivate more than 6h, 1 × PBS washing in DMEM perfect medium (DMEM substratum adds the foetal calf serum of 10%, 100U/ml penicillin and 100 μ g/ml Streptomycin sulphates) after
9(substratum is that DMEM does not add foetal calf serum to the recombinant virus of Gps embodiment 2 preparation, and dosage is 1 × 10
4gps/ cell), add DMEM perfect medium after 2-4 hour and continue to cultivate.After transduce respectively recombinant virus AAV-EGFP, AAV-TRAIL, AAV-TRAIL+miR-222-TuD, cracking HEKC HEK293T, extracts RNA with TRIzol, carries out qPCR detection.
The biologic activity detected result of restructuring AAV virus:
Wherein AAV-EGFP successfully can infect 293 cells and A549 cell and make its expressing green fluorescent protein, sees Fig. 3 (A);
AAV-TRAIL and AAV-TRAIL+miR-222-TuD can successful process LAN TRAIL after infecting 293 cells, sees Fig. 3 (B);
AAV-TRAIL+miR-222-TuD effectively can strike the expression level of low miR-222, sees Fig. 3 (C).
Embodiment 4WesternBlot
Inject AAV-EGFP respectively, AAV-TRAIL, the tumor tissues of AAV-TRAIL+miR-222-TuD or cell through lysate (containing 1%NonidetP-40, 0.35mg/mlPMSF, 9.5 the 1 × PBS of μ g/mlleupeptin and 13.7 μ g/mlpepstatinA) after cracking, 12000rpm is centrifugal goes precipitation, supernatant liquor measures after protein concentration through BCA protein assay kit (PierceChemicalCompany) and carries out SDS-PAGE gel electrophoresis, after being transferred to pvdf membrane 4 DEG C close spend the night, through primary antibodie (anti-PTEN polyclonal antibody, 1:1000 is diluted in confining liquid, room temperature 2h), two anti-(the goat anti-rabbit antibody 1:10000 of HRP mark is diluted in confining liquid, room temperature 1h) hatch after, thorough washing, then ECL system (AmershamPharmaciaBiotechCo.) is utilized to carry out albumen colour developing.Detect PTEN expression in tumour, can see in AAV-TRAIL+miR-222-TuD group PTEN expression obviously rise.
MiR-222-TuD to play a role result by regulating the change level of target gene PTEN:
(1) PTEN is the prediction target gene of miR-222, sees Fig. 5 (A);
(2), in the tumor tissues of injection of AAV-TRAIL+miR-222-TuD, PTEN expression level obviously raises, and sees Fig. 5 (B).
The two dye method stream measuring apoptosis of embodiment 5AnnexinV-FITC/PI
Carry out according to apoptosis kit (BD-FITCAnnexinVApoptosisDetectionKitI) specification sheets.Cell is after 0.25%EDTA digestion process, centrifugal, washes twice with the PBS of ice, and resuspended with 1 × BindingBuffer is 1 × 10
6cells/ml, gets 100 μ l cell suspensions (1 × 10
5cells), add 5 μ lFITCAnnexinV and 5 μ lPI, softly mix, room temperature lucifuge hatches 15 minutes.Add 400 μ l1 × BindingBuffer, in 1 hour, use flow cytomery.
Two dye method stream measuring apoptosis result:
The plasmid of transfection single expression TRAIL can cause Hela apoptosis, and after the transfection co-expression plasmid of TRAIL and miR-222-TuD, obviously facilitates the apoptotic effect to Hela, see Fig. 2 (D).
The foundation of embodiment 6 mouse model
Get 5 to 6 week ages, body weight be about the Balb/c nude mice of 20g, subcutaneous vaccination 2 × 10
6human lung cancer cell A549, measures the line of apsides of a tumour for every three or four days, calculates knurl volume (volume=1/2 × major diameter × minor axis
2).At the end of experiment, disconnected neck puts to death nude mice, and tumour or each tissue sample are stored in-70 DEG C or fix at 4%paraformaldehyde after liquid nitrogen freezing after weighing.
The experimental therapy of embodiment 7 tumor-bearing mice and observation
Get 5 to 6 week ages, body weight be about the Balb/c nude mice of 20g, subcutaneous vaccination 2 × 10
6human lung cancer cell A549, (1 × PBS suspension 100 μ l), the i.e. mouse model of embodiment 6 preparation.Tumour grows to 100mm
3time, laboratory animal is divided into three groups: a) AAV-EGFP negative control group; B) AAV-TRAIL positive controls; C) AAV-TRAIL+miR-222-TuD recombinant virus (virus titer 10
11) treatment group.Often organize 5, by multi-point injection in knurl.Observe weekly growing state and the survival time of different treated animal tumour.Do 3 batch weight to test again.
A549 tumor-bearing mice is after restructuring AAV-TRAIL and AAV-TRAIL+miR-222-TuD process, and the growth of subcutaneous tumors is suppressed, and AAV-TRAIL+miR-222-TuD can promote the result of use of AAV-TRAIL, obvious Tumor suppression growth:
(1) the downtrod morphological observation of subcutaneous tumors, is shown in Fig. 4 (A);
(2) the dynamic observation of administration posterior tuberosity volume change, is shown in Fig. 4 (B);
(3) difference that when putting to death, knurl is heavy, is shown in Fig. 4 (C).
Research display in the past few decades, TRAIL all plays very important function in tumour and immunity system, is the factor having very much treatment potentiality.With TNF family other part member comparatively, TRAIL has following three advantages: 1) have powerful in ability that is specificity inducing apoptosis of tumour cell, but to normal cell without this effect; 2) wider anticancer spectrum is had than TNF-α and Fas-L; 3) only there is very faint activation to NF-κ B, even systemic administration, also can not produce serious inflammatory reaction as TNF-α and Fas-L.Therefore many biotechnologys and drugmaker all design medicine with this for the death program activating tumour cell, at present, different TRAIL receptor stimulants, comprise TRAIL itself, and the monoclonal antibody of various emulative anti-DR4, DR5 all as novel cancer target in the middle of clinical trial.But still there is its predicament faced, such as resistance problem at present.
In this patent, Hsa-miR-222 shows the impact on TRAIL resistance in various kinds of cell system, and after the stand-in of process LAN miR-222, cell strengthens TRAIL resistance, and after curbing miR-222, the apoptosis rate of cell increases, and namely weakens TRAIL resistance.Therefore we devise the specific inhibitor miR-222-TuD of miR-222 and TRAIL combined utilization.Can see, Hela cell is as the cell strain to TRAIL sensitivity, and only express the plasmid of TRAIL in transfection after, cell there occurs obvious apoptosis, and on this basis, TRAIL+miR-222-TuD co-expression plasmid still significantly can strengthen the lethal effect of TRAIL.A549 same as to TRAIL than more sensitive cell strain, becoming in the experimentation on animals after knurl with it, inject the AAV virus of packaging respectively, compare with control group, the tumor growth having injected AAV-TRAIL group is subject to part to be suppressed, and viral group of injection of AAV-TRAIL+miR-222-TuD combination therapy, tumor growth has again further apoptosis on the basis that AAV-TRAIL is used alone.That is, for the cell of TRAIL sensitivity, the combined utilization of TRAIL+miR-222-TuD, still can strengthen the susceptibility of cell to TRAIL further, can as the new selection reducing TRAIL using dosage clinically.
We predict the target gene of Hsa-miR-222, have selected some candidate targets, protein extraction in tumor tissues is out carried out westernblot checking, finally finds, its target gene PTEN is obviously raise in AAV-TRAIL+miR-222-TuD combination therapy group.MiRNA is played a role by its target gene of targeted inhibition, and miR-222-TuD is the specific inhibitor of miR-222, thus the rise of its target gene PTEN is detected in vivo, be consistent with practical situation, illustrate that miR-222-TuD has played the effect suppressing miR-222 in vivo really on the one hand, illustrate that the mechanism that it strengthens TRAIL resistance function may be pass through PTEN on the other hand.
The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications also should be considered as protection scope of the present invention.
Claims (12)
1. a RNA, is characterized in that, it has:
(I) nucleotide sequence, as shown in SEQIDNo.1; Or
(II) complementary sequence of the nucleotide sequence, as shown in SEQIDNo.1; Or
(III), with the nucleotide sequence coded same protein of (I) or (II), but the sequence different from the nucleotide sequence of (I) or (II) because of the degeneracy of genetic code; Or
(IV), the sequence of 70% homology is had at least with (I) or (II) or (III) described sequence.
2. RNA according to claim 1 is for suppressing the purposes of Hsa-miR-222.
3. a composition, is characterized in that, comprises TRAIL
95-281with RNA as claimed in claim 1.
4. a recombinant expression vector, is characterized in that, comprising:
(1) encode TRAIL
95-281nucleotide sequence; And/or
(2) encode the DNA of RNA as claimed in claim 1.
5. the construction process of recombinant expression vector according to claim 4, is characterized in that, will encode TRAIL
95-281nucleotide sequence be connected in carrier with the DNA of the RNA as claimed in claim 1 of encoding, construction of expression vector.
6. construction process according to claim 5, is characterized in that, described carrier is plasmid or virus.
7. construction process according to claim 6, is characterized in that, described virus is adeno-associated virus.
8. a host cell, is characterized in that, comprises recombinant expression vector as claimed in claim 4.
9. host cell according to claim 8, it is characterized in that, described host cell is cell strain, and described cell strain is selected from HeLa cell, A549 cell, Bel-7402 cell, CNE-2Z cell, EC109 cell, MGC-803 cell, SW1990 cell, DU145 cell, U251 cell, A875 cell, HCT116 cell, MCF7 cell or SK-OV-3 cell.
10. composition according to claim 3, recombinant expression vector according to claim 5, host cell described in claim 8 or 9 application in the medicine of preparation treatment tumour.
11. application according to claim 10, is characterized in that, described tumour is primary, Secondary cases or metastatic tumour.
12. application according to claim 10 or 11, it is characterized in that, described tumour comprises lung cancer, liver cancer, nasopharyngeal carcinoma, the esophageal carcinoma, colorectal cancer, cancer of the stomach, carcinoma of the pancreas, prostate cancer, neurospongioma, melanoma, mammary cancer, cervical cancer or ovarian cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510382699.7A CN105039320B (en) | 2015-07-02 | 2015-07-02 | A kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510382699.7A CN105039320B (en) | 2015-07-02 | 2015-07-02 | A kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105039320A true CN105039320A (en) | 2015-11-11 |
| CN105039320B CN105039320B (en) | 2017-12-22 |
Family
ID=54446293
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510382699.7A Active CN105039320B (en) | 2015-07-02 | 2015-07-02 | A kind of RNA and application thereof, the composition comprising the RNA, recombinant expression carrier and host cell |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039320B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010056737A3 (en) * | 2008-11-11 | 2010-09-16 | Mirna Therapeutics, Inc. | Methods and compositions involving mirnas in cancer stem cells |
| CN102803511A (en) * | 2009-11-23 | 2012-11-28 | 俄亥俄州立大学 | Materials and methods useful for affecting tumor cell growth, migration and invasion |
-
2015
- 2015-07-02 CN CN201510382699.7A patent/CN105039320B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010056737A3 (en) * | 2008-11-11 | 2010-09-16 | Mirna Therapeutics, Inc. | Methods and compositions involving mirnas in cancer stem cells |
| CN102803511A (en) * | 2009-11-23 | 2012-11-28 | 俄亥俄州立大学 | Materials and methods useful for affecting tumor cell growth, migration and invasion |
Non-Patent Citations (1)
| Title |
|---|
| SEOK-HYUN KIM等: "Death Induction by Recombinant Native TRAIL and Its Prevention by a Caspase 9 Inhibitor in Primary Human Esophageal Epithelial Cells", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105039320B (en) | 2017-12-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7262134B2 (en) | Oncolytic HSV vectors | |
| JP7038065B2 (en) | Oncolytic virus strain | |
| TWI763673B (en) | Novel genetically recombinant vaccinia virus | |
| GuhaSarkar et al. | Intracranial AAV‐IFN‐β gene therapy eliminates invasive xenograft glioblastoma and improves survival in orthotopic syngeneic murine model | |
| CN104043102B (en) | Use of polypeptide in preparation of drug for treating nuclear factor-kB abnormal activation diseases | |
| Deng et al. | Oncolytic and immunologic cancer therapy with GM-CSF-armed vaccinia virus of Tian Tan strain Guang9 | |
| CN111606999B (en) | Replicative oncolytic adenovirus with functions of activating immune co-stimulatory signaling pathway and blocking immune checkpoint and application thereof | |
| CN104774929B (en) | The application of diagnosis, treatment and prognosis of the 3p of miR 455 in esophageal squamous cell carcinoma | |
| CN110157686B (en) | Replication type oncolytic adenovirus activated by immune checkpoint and immune co-stimulation and construction method and application thereof | |
| CN109288855B (en) | Application of reagent in preparation of medicine, interference fragment, method for inhibiting self-renewal of liver cancer tumor stem cells and medicine for treating liver cancer | |
| CN103740722A (en) | shRNA (short hairpin ribonucleic acid) inhibiting retinal pigment epithelium apoptosis and application thereof | |
| CN105367661A (en) | Chimeric antigen receptor, gene and recombinant expression vector of chimeric antigen receptor, engineering HER1 targeted NKT cells and application of engineering HER1 targeted NKT cells | |
| CN105176998A (en) | RNA and use thereof, composition containing the same, recombinant expression vector and host cell | |
| Chi et al. | Stomatin-like protein 2 of turbot Scopthalmus maximus: Gene cloning, expression profiling and immunoregulatory properties | |
| CN111041001B (en) | Safe coxsackie virus for treating KRAS mutant tumor and pharmaceutical composition thereof | |
| CN105039320A (en) | RNA, application thereof, composition containing same, recombinant expression vector, and host cell | |
| CN102399777B (en) | Recombinant plasmid and recombinant oncolytic virus prepared by using the same | |
| CN103882057B (en) | Carry structure and the application thereof of p21ras single-chain antibody gene tomour specific adenoviral vectors | |
| CN107184984B (en) | Application of the inhibitor of RPL10 in the drug of preparation treatment oophoroma | |
| CN111803646A (en) | Solid tumor combined treatment composition | |
| CN110272918A (en) | The building and its application of miR-34a induction cryptiogene expression carrier | |
| CN104740634A (en) | Application of miR-93 and inhibitor thereof in preparation of anti-virus infection medicines | |
| US8129356B2 (en) | Bmx mediated signal transduction in irradiated vascular endothelium | |
| CN105420260A (en) | Target recombination Wnt fusion protein and application thereof in preparing anticarcinogen | |
| Zhang et al. | Extracellular domain of kinase domain region mediated by adeno-associated virus inhibits growth and angiogenesis of bladder cancer in Balb-c mice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CB03 | Change of inventor or designer information |
Inventor after: Shi Juan Inventor after: Ma Sisi Inventor before: Ma Sisi Inventor before: Shi Juan |
|
| CB03 | Change of inventor or designer information |