CN105039317A - Internal reference compound for fluorescent inspection quantification of microRNA, primers and application of internal reference and primers - Google Patents
Internal reference compound for fluorescent inspection quantification of microRNA, primers and application of internal reference and primers Download PDFInfo
- Publication number
- CN105039317A CN105039317A CN201510354761.1A CN201510354761A CN105039317A CN 105039317 A CN105039317 A CN 105039317A CN 201510354761 A CN201510354761 A CN 201510354761A CN 105039317 A CN105039317 A CN 105039317A
- Authority
- CN
- China
- Prior art keywords
- mirna
- spinal cord
- chronic pain
- internal reference
- mir
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses an internal reference compound for detecting spinal cord miRNA under chronic pain and primers of the internal reference compound. The internal reference compound is mmu-miR-486-5p; the primers of mmu-miR-486-5p comprise a reverse transcription primer and amplification primers (a forward amplification primer and a reverse amplification primer); the sequence of the reverse transcription primer is as shown in SEQ ID NO 1; the sequence of the forward amplification primer is as shown in SEQ ID NO 2; the sequence of the reverse amplification primer is as shown in SEQ ID NO 3. The internal reference compound and the primers can be used for detecting mouse spinal cord miRNA, so as to confirm the miRNA line level, so as to eliminate miRNA expression level difference caused by individual biological difference and experimental operation, and ensure that the differential expression of miRNA expression level related to the chronic pain in deed is analyzed accurately.
Description
Technical field
The present invention relates to a kind of internal reference compound for spinal cord miRNA detection and detect primer and application, belonging to technical field of molecular biological detection.
Background technology
In general population, the incidence of chronic pain is about 35% ~ 45%, and in recent years in rising trend, and chronic pain has become one of most common clinical illness, and owing to lacking effective methods for the treatment of and medicine and having a strong impact on the quality of life of people.Early diagnosis and therapy can improve the result for the treatment of of chronic pain patient and improve prognosis, and therefore searching has compared with the practical diagnosis method of high specific and susceptibility is very necessary.Current chronic pain common method for the treatment of mainly contains systemic drug therapeutics, nerve transference, pocket knife therapy, physiatrics and branch river therapy etc.Wherein pharmacotherapy is main therapy, but owing to still lacking ideal treatment method and analgesic, therefore occurs the situation such as drug resistance or unsatisfactory curative effect.Nerve transference and physiatrics are also common clinical treatment of chronic pain methods, but its curative effect is effective, also fundamentally can not treat chronic pain.Because spinal cord is as the maincenter first station of nocuity signal transmission, it is the key position of pain signal transmission and regulation and control, therefore, the chronic pain mechanism of research spinal levels gene regulating likely catches the key link of chronic pain generation and maintenance, also will contribute to research chronic pain pathogeny and obtain effectively preventing measure.This is also clinical and fundamental research scientists is devoted for years to the major cause mediating chronic mechanism in research spinal neuron plasticity-.
Microrna (microRNA, miRNA) is a kind of mode of the gene expression regulation of discovered in recent years, and it participates in regulating multiple physiology and pathologic process.At present, in the majority tissue of animal, find that there is the miRNA of regulatory function.Within 2006, found in brain the miR-13 regulating synapse function first, find multiple miRNA at spinal cord and peripheral nervous system again subsequently, they, by regulating synaptic plasticity, play an important role in multiple nerve degenerative diseases is formed.Prompting, miRNA provides possibility as the new mechanism of gene expression regulation for the genesis mechanism of illustrating nervous system related disorder further and the breakthrough of seeking clinical therapeutics thereof.MiRNA regulation and control are introduced pain research field in 2010 by Zhao etc., and this is significant to the new mechanism inquiring into chronic pain generation.Subsequently, Favereaux etc. have studied the generating process that miR-103 mediates chronic pain, find that CFA pain mouse spinal cord dorsal horn miR-103 expresses and obviously reduce, when cornu dorsale medullae spinalis miR-103 process LAN, the expression of calcium channel Cav1.2-LTC then obviously declines, and the mouse threshold of pain significantly raises.MiRNA take part in chronic pain process by regulating synaptic plasticity.Therefore, detect spinal cord miRNA to can be chronic pain prediction, diagnose and monitor and open up new approach.
At present, miRNA detection technique mainly comprises high throughput sequencing technologies, biochip technology, in situ hybridization and real-time fluorescence quantitative PCR (qRT-PCR) technology.The above two belong to high throughput method, are mainly used in miRNA screening, need adopt qRT-PCR method for the accurate quantitative analysis obtaining miRNA; In situ hybridization detection method be to tissue in single miRNA in body qualitative detection, because of its analyze time-consuming cost high be usually used in miRNA experience card.QRT-PCR is accurate, simple to operate, low cost can carry out qualitative and quantitative analysis and checking to simple target miRNA because of it, is the most conventional detection technique in miRNA analytical procedure.Carrying out in spinal cord qRT-PCR operating process, for obtaining accurate miRNA result, the following 3 kinds of working method of normal employing.One gets equivalent spinal cord when being and extracting RNA, and two is add equivalent synthetic miRNA (as nematode miRNA-39) extracting the forward direction equivalent spinal cord of RNA, and three is adopt endogenous molecule to express internal reference compound as detection spinal cord miRNA.But first two method can hardly be avoided due to operate miss, determine them for the uncertainty effectively obtaining miRNA content in organism.With the above two unlike, endogenous miRNA molecule is adopted to express internal reference compound as detection spinal cord miRNA, not only can error in Control release operation, the biological differences of sample own can also be controlled, there is unique advantage, thus become the confessed optimality criterion method of industry.
At present, in chronic pain spinal cord miRNA studies, still lack and generally acknowledge comparatively stable internal reference compound molecule, investigator mainly selected internal reference compound molecule according to experience or reference in the past, choose internal reference compound in different experiments and have very big-difference, thus constrain achievement in research transform and between different investigator obtain the comparison of detected result.Therefore, be used for chronic pain spinal cord miRNA if can find analyze internal reference compound and develop corresponding reagent box, make it to be applied to scientific research field, by greatly promoting the conversion of chronic pain spinal cord miRNA research and scientific payoffs, huge pushing effect will be played for chronic pain clinic diagnosis and drug development.
Summary of the invention
Goal of the invention: for above-mentioned prior art, for solving the technical problem that there is no stable detection chronic pain spinal cord miRNA internal reference compound molecule in prior art, the present invention is screened by great many of experiments, a kind of internal reference compound detected for chronic pain spinal cord miRNA is provided, and the primer, dedicated kit, the detection method that detect this internal reference compound are provided, and in diagnosis, the application detected in chronic pain, the experimental data studied for chronic pain spinal cord miRNA provides practical stdn foundation reliably.
Technical scheme, the present invention is achieved by the following technical solutions:
For the internal reference compound that chronic pain spinal cord miRNA detects, this internal reference compound is independent mmu-miR-486-5p; Its sequence is: uccuguacugagcugccccgag, and sequence is as shown in SEQIDNO1.
The primer detecting mmu-miR-486-5p comprises reverse transcription primer, forward amplimer and reverse amplimer; The sequence of reverse transcription primer is as shown in SEQIDNO2; The sequence of forward amplimer is as SEQIDNO3; The sequence of reverse amplimer is as shown in SEQIDNO4;
Mmu-miR-486-5p reverse transcription primer is:
5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCGGGGC-3’；
The forward amplimer of mmu-miR-486-5p: 5 '-GCCCTGTCCTGTACTGAGCTGCC-3 '
The reverse amplimer of mmu-miR-486-5p: 5 '-GTGCAGGGTCCGAGGT-3 '.
Internal reference compound mmu-miR-486-5p for spinal cord miRNA detection under chronic pain of the present invention is preparing the application in chronic pain spinal cord miRNA detection kit.
The primer of internal reference compound mmu-miR-486-5p detected for spinal cord miRNA under chronic pain of the present invention is preparing the application in chronic pain spinal cord miRNA detection kit.
Preferably, above-described chronic pain spinal cord miRNA detection kit, comprise for RNA parting liquid, reagent and the enzyme needed for miRNA extraction and qRT-PCR reaction, and standard substance is or/and reference substance.
Preferably, the above RNA parting liquid is made up of polysorbas20, Tutofusin tris, ethylenediamine tetraacetic acid (EDTA), bovine serum albumin and water, the concentration of each component is as follows: the percent by volume of polysorbas20 is 2.0%, Tutofusin tris: 45mmol/L, ethylenediamine tetraacetic acid (EDTA): 1.2mmol/L, the percent by volume of bovine serum albumin is 1.5%, and surplus is water.
Described PCR reaction solution is made up of 1 × SyberGreen I fluorescence dye, archaeal dna polymerase, dNTPs, Tri(Hydroxymethyl) Amino Methane Hydrochloride, Repone K, magnesium chloride and water, and wherein, the concentration of each material is as follows: archaeal dna polymerase: 100U/mL; DNTPs:0.2mM; Magnesium chloride: 6mM; Tri(Hydroxymethyl) Amino Methane Hydrochloride: 16.5mM; Repone K: 89.3mM.
Utilize above-mentioned chronic pain spinal cord miRNA internal reference compound test test kit to carry out detection method, comprise the following steps:
(1) separation obtains spinal cord sample on ice, extracts RNA (comprising miRNA);
(2) qRT-PCR reaction: above-mentioned separation spinal cord miRNA is carried out reverse transcription and becomes cDNA, getting cDNA is template, adds primer and PCR reaction solution, carries out qRT-PCR reaction, detects sample threshold Ct;
(3) interpretation of result: correct spinal cord object miRNA sample threshold Ct, to judge whether object miRNA expression level has statistical significance according to spinal cord miRNA internal reference compound mmu-miR-486-5p sample threshold Ct internal reference compound.
The present invention can be used for detecting spinal cord miRNA internal reference compound mmu-miR-486-5p under chronic pain, and can detect spinal cord object miRNA molecule, and it is reliable and stable that it detects usefulness, has wide application prospect.
The internal reference compound detected for chronic pain spinal cord miRNA of the present invention, advantage is as follows:
(1) chronic pain spinal cord internal reference mmu-miR-486-5p compound miRNA detection kit can be used for detecting mouse spinal cord miRNA, and then determine different animals spinal cord internal reference compound miRNA line level, to eliminate the miRNA expression level difference because idiobiology difference and experimental implementation cause, real miRNA expression level difference relevant to chronic pain is made to obtain accurate differential expression analysis.
(2) the present invention adopts tight design and appraisement system, first spinal cord miRNA express spectra under chronic pain is obtained by Solexa order-checking, filter out through comparative analysis and express stable miRNA, more comparatively stablized candidate's internal reference compound through qRT-PCR detection and computed in software.By applying above-mentioned research method, the preciseness that chronic pain spinal cord miRNA internal reference compound test test kit is researched and developed and reliability can be ensured.
The present invention, by the miRNA of stably express in screening spinal cord, finds and demonstrates the internal reference mmu-miR-486-5p compound that can be used as chronic pain spinal cord miRNA and study.By the application of chronic pain spinal cord miRNA internal reference compound mmu-miR-486-5p detection kit, chronic pain spinal cord miRNA achievement in research can be promoted to transform and academic exchange between different scientific research person, also can be the analgesic research and development obtaining target miRNA and new approaches and new way are provided.
Accompanying drawing explanation
Fig. 1 is that different miRNA molecule is expressed in normal group and pain group spinal cord.
Fig. 2 is the expression of miR-486-5p in the control group and pain group sample of different batches.
Embodiment
Below in conjunction with embodiment, the invention will be further elaborated.
Experimental study of the present invention comprises the following steps:
(1) preparation of murine chronic pain model;
(2) gather spinal cord sample with Standard operation procedure SOP, extract RNA;
(3) spinal cord miRNA expression pattern analysis: choose chronic pain mouse and physiological saline mouse in contrast, both high-flux sequence post analysis express spectra, filter out candidate's internal reference compound miRNA of stably express in order to further checking, the undesirable molecule of exclusive segment, adopts software analysis to residue molecule;
(4) qualitative analysis checking is carried out, to determine the stability of each candidate miRNA to candidate's internal reference compound miRNA quantitative PCR;
(5) research and development of chronic pain spinal cord miRNA internal reference compound test test kit: according to selected miRNA, research and development internal reference compound test test kit;
(6) spinal cord miRNA internal reference compound test test kit practical assessment: choose the mmu-miRNA-219-5p of chronic inflam-matory pain mouse spinal cord high expression level as molecules of interest, detect its expression level, and using mmu-miR-486-5p as internal reference compound, to evaluate the practicality of spinal cord miRNA internal reference compound test test kit.
Prepared by embodiment 1 murine chronic pain model
The present invention is using CFA inducing chronic inflammatory pain mouse as chronic pain model, and sample group and each 8 of control group, as the test sample that Solexa order-checking and follow-up RT-qPCR are screened and verified.Model is prepared as follows: choose SPF level male 6 weeks Kunming male mices under isoflurane anesthesia, and select 2 intradermal injection aseptic complete Freund's adjuvant 40 μ l around left back whole sole of the foot joint portion, this injection concentration can induce generation sacroiliitis.Within after injection 24 hours, namely occur that the reduction of heat and mechanical hyperalgesia threshold value also can maintain more than 3 weeks, as the qualified mouse of modeling, injecting normal saline mouse is control group, each 8 of two groups of mouse.
Embodiment 2 spinal cord miRNA is separated and high-flux sequence
(1) miRNA extracts: to sample and control group 16 mouse spinal cords altogether, respectively get 100mg, after adding 1mlTrizol reagent homogenate, room temperature leaves standstill 15min, add 0.2ml chloroform, concuss 5s, room temperature leaves standstill 15min, 12,000rpm, then 4 DEG C of centrifugal 5min; Aqueous phase is transferred to new centrifuge tube, adds 0.5ml Virahol, leave standstill 20min on ice, spiral concussion 10s, 12,000rpm, 4 DEG C, centrifugal 5min; Remove supernatant, then use the resuspended precipitation of 80% ethanol, spiral concussion 10s, 12,000rpm, 4 DEG C, centrifugal 5min; Get supernatant, residual ethanol on room temperature volatilization wall, adds DEPC water 30 μ l and dissolves, and measure RNA concentration with NanoDrop2000; 17-27ntRNA molecule is reclaimed, i.e. miRNA molecule again with PAGE electrophoresis.
(2) miRNA high-flux sequence: order-checking ligase enzyme is connected to miRNA molecule two ends, checks order after reverse transcription reaction.
(3) target miRNA screening and analysis: utilize bioinformatics method, gained spinal cord miRNA express spectra is analyzed.
The qRT-PCR screening of embodiment 3 serum miRNA and checking
According to Solexa sequencing result, select to meet following standard miRNA molecule and utilize qRT-PCR technology to verify further: a) in chronic pain and check sample, express copy number and be all greater than 100; B) equal stably express in two groups, and no significant difference (p >=0.05) between two groups.According to above standard, select 5 satisfactory miRNA molecule (comprising mmu-miR-136-3p, mmu-miR-1839-5p, mmu-miR-3107-5p, mmu-miR-486-5p and mmu-miR-98-5p) altogether.Because U6 is often used as internal reference compound molecule that mammalian tissues miRNA detects (but its comparatively miRNA is long, cannot adopt with the consistent step of miRNA reverse transcription, therefore easily produce biological error), U6 also alternatively molecule be included into checking.By to above-mentioned 5 miRNA stem ring 3 reverse transcription methods, U6 adopts in conventional reverse transcription method (comprising 6 chronic pain samples (Pain) and 6 check samples (Normal)) and carries out verifying (as shown in Figure 1, Ct represents quantitative PCR cycling numerical value), there are 3 candidate molecules to be excluded because of unstable expression (mmu-miR-136-3p, mmu-miR-1839-5p and mmu-miR-98-5p).To residue 3 molecules (mmu-miR-3107-5p, mmu-miR-486-5p and U6), Normfinder, geNorm software is adopted to carry out expression stability analysis.Whole research process each sample continuous detecting three times and all detections all adopt blind.
(1) by obtaining cDNA to the direct reverse transcription of spinal cord miRNA.Reverse transcription system comprises 5 μ l2 × miRNAReactionBuffer, 1 μ lPrimeScriptRTEnzyme (Takara), 1 μ lRNA parting liquid.Reaction conditions is 16 DEG C of 30min, 37 DEG C of 30min, 85 DEG C of 5s.(2) qRT-PCR reaction.CDNA is pressed 1:5 dilution, get 1 μ l, add 12.5 μ lSYBRPremixExTaq II (Takara) respectively, 1 μ lUni-miRqPCRPrimer, 2 μ l forward primers, 2 μ lddH2O carry out qRT-PCR reaction.Institute's use instrument is LC480 quantitative real time PCR Instrument, and reaction conditions is: 95 DEG C 5s1 circulation; (95 DEG C of 5s, 60 DEG C of 30s) 45 circulate.(3) data process&analysis.The each miRNA molecule of each sample spinal cord three detected results (Ct value) is averaged, get rid of expression level lower (Ct value median is greater than 35) miRNA molecule, adopt each miRNA of One-wayANOVA methods analyst whether to have differential expression between different sample group to residue molecule, use Normfinder and geNorm to calculate miRNA stability (see table 1).As shown in Table 1, adopt mmu-miR-486-5p as spinal cord internal reference compound, its expression comparatively stability in two groups.
Embodiment 4mmu-miR-486-5p expression stability is verified
According to qRT-PCR the selection result, mmu-miR-486-5p stablizes candidate's internal reference compound molecule for expressing.Adopt qRT-PCR method to verify (as shown in Figure 2) the stability of mmu-miR-486-5p in one group of new tested sample (comprising 12 chronic pain samples (Pain) and 12 check samples (Normal)), result shows it and has better stability.(1) by obtaining cDNA to the direct reverse transcription of spinal cord miRNA.Reverse transcription system comprises 5 μ l2 × miRNAReactionBuffer, 1 μ lPrimeScriptRTEnzyme (Takara), 1 μ lRNA parting liquid.Reaction conditions is 16 DEG C of 30min, 37 DEG C of 30min, 85 DEG C of 5s.(2) qRT-PCR reaction.CDNA is pressed 1:5 dilution, get 1 μ l, add 12.5 μ lSYBRPremixExTaq II (Takara) respectively, 1 μ lUni-miRqPCRPrimer, 2 μ l forward primers, 2 μ lddH2O carry out qRT-PCR reaction.Institute's use instrument is LC480 quantitative real time PCR Instrument, and reaction conditions is: 95 DEG C 5s1 circulation; (95 DEG C of 5s, 60 DEG C of 30s) 45 circulate.
Embodiment 5 is for the making of chronic pain spinal cord miRNA internal reference compound test test kit
Mmu-miR-486-5p internal reference compound test test kit makes and operating process is carried out based on qRT-PCR technology.Test kit comprises chronic pain spinal cord internal reference compound mmu-miR-486-5p reverse transcription primer: 5 '-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCGGGGC-3 ' (SEQIDNo1.); Increase forward primer: 5 '-GCCCTGTCCTGTACTGAGCTGCC-3 ' (SEQIDNo.2) and qRT-PCR of qRT-PCR increases reverse primer: 5 '-GTGCAGGGTCCGAGGT-3 ' (SEQIDNo.3), can also comprise and react relevant reaction reagent and enzyme etc. to qRT-PCR.The meaning of this test kit there are provided a kind of reagent and the inspection method that detect chronic pain mouse spinal cord miRNA internal reference compound, the accuracy analyzing miRNA result for researcher lays the foundation, promote the clinical conversion of chronic pain spinal cord miRNA achievement in research, and the development of association area research can have been promoted.Test kit provided by the invention will contribute to for chronic pain research provides target and the New Research Method of new analgesic.
SEQUENCELISTING
<110> Xuzhou Medical College
The internal reference compound that <120>microRNA fluoroscopy is quantitative and primer and application thereof
<130>001
<160>4
<170>PatentInversion3.5
<210>1
<211>51
<212>RNA
<213> artificial sequence
<400>1
uccuguacugagcugccccgag22
<210>2
<211>51
<212>RNA
<213> artificial sequence
<400>2
gtcgtatccagtgcagggtccgaggtattcgcactggatacgacctcggggc51
<210>3
<211>23
<212>RNA
<213> artificial sequence
<400>3
gccctgtcctgtactgagctgcc23
<210>4
<211>16
<212>RNA
<213> artificial sequence
<400>4
gtgcagggtccgaggt16
Claims (6)
1., for the internal reference compound that spinal cord miRNA under chronic pain detects, it is characterized in that: internal reference compound is mmu-miR-486-5p, and its sequence is as shown in SEQIDNO1; ; The primer of described mmu-miR-486-5p comprises reverse transcription primer and amplimer, and the sequence of reverse transcription primer is as shown in SEQIDNO2; The sequence of forward amplimer is as SEQIDNO3; The sequence of reverse amplimer is as shown in SEQIDNO4;
Mmu-miR-486-5p reverse transcription primer is:
5’-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTCGGGGC-3’；
The forward amplimer of mmu-miR-486-5p: 5 '-GCCCTGTCCTGTACTGAGCTGCC-3 ';
The reverse amplimer of mmu-miR-486-5p: 5 '-GTGCAGGGTCCGAGGT-3 '.
2. the internal reference compound for spinal cord miRNA detection under chronic pain according to claim 1 is preparing the application in chronic pain spinal cord miRNA detection kit.
3. the primer of internal reference compound detected for spinal cord miRNA under chronic pain according to claim 1 is preparing the application in chronic pain spinal cord miRNA detection kit.
4. a chronic pain spinal cord miRNA detection kit, is characterized in that: this test kit contains the mmu-miR-486-5p primer for detecting, and sequence is as shown in SEQIDNO:2 ~ 4.
5. chronic pain spinal cord miRNA detection kit according to claim 4, it is characterized in that: described chronic pain spinal cord miRNA detection kit comprises for RNA parting liquid, reagent and the enzyme needed for miRNA extraction and qRT-PCR reaction, and standard substance are or/and reference substance.
6. chronic pain spinal cord miRNA detection kit according to claim 5, it is characterized in that: described RNA parting liquid is made up of polysorbas20, Tutofusin tris, ethylenediamine tetraacetic acid (EDTA), bovine serum albumin and water, the concentration of each component is as follows: the volumn concentration of polysorbas20 is 2.0%, Tutofusin tris: 45mmol/L, ethylenediamine tetraacetic acid (EDTA): 1.2mmol/L, the volumn concentration of bovine serum albumin is 1.5%, and surplus is water.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354761.1A CN105039317A (en) | 2015-06-24 | 2015-06-24 | Internal reference compound for fluorescent inspection quantification of microRNA, primers and application of internal reference and primers |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510354761.1A CN105039317A (en) | 2015-06-24 | 2015-06-24 | Internal reference compound for fluorescent inspection quantification of microRNA, primers and application of internal reference and primers |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105039317A true CN105039317A (en) | 2015-11-11 |
Family
ID=54446290
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510354761.1A Pending CN105039317A (en) | 2015-06-24 | 2015-06-24 | Internal reference compound for fluorescent inspection quantification of microRNA, primers and application of internal reference and primers |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105039317A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103205483A (en) * | 2012-01-13 | 2013-07-17 | 北京命码生科科技有限公司 | MicroRNA standardization reference gene and application thereof |
| CN103602747A (en) * | 2013-11-28 | 2014-02-26 | 山东大学齐鲁医院 | Internal reference substance for detecting bladder cancer serum miRNA and its detection primers and use |
-
2015
- 2015-06-24 CN CN201510354761.1A patent/CN105039317A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103205483A (en) * | 2012-01-13 | 2013-07-17 | 北京命码生科科技有限公司 | MicroRNA standardization reference gene and application thereof |
| CN103602747A (en) * | 2013-11-28 | 2014-02-26 | 山东大学齐鲁医院 | Internal reference substance for detecting bladder cancer serum miRNA and its detection primers and use |
Non-Patent Citations (1)
| Title |
|---|
| 李敏娜等: "慢性神经病理性疼痛对大鼠脊髓背角miRNA表达的影响", 《基础医学与临床》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104531854B (en) | Kit for detecting drug resistance of cetuximab used for metastatic colorectal cancer treatment by | |
| CN101988120A (en) | Novel technology for diagnosing liver cancer by utilizing microRNAs in serum | |
| CN108064272A (en) | Biomarker for rheumatoid arthritis and application thereof | |
| Tsuru et al. | miR‐424 levels in hair shaft are increased in psoriatic patients | |
| CN105223357A (en) | The composition of predicting liver cancer prognosis or kit | |
| CN105176983A (en) | Kit for detecting esophageal squamous carcinoma associated serum miRNAs genes | |
| Zeng et al. | WGCNA-based identification of hub genes and key pathways involved in nonalcoholic fatty liver disease | |
| CN106250717B (en) | The miRNA of acute myeloid leukaemia and the system of transcription factor and its construction method and application | |
| CN103820556B (en) | A kind of pituitary tumor Disease-causing gene CCNB1 and application thereof | |
| CN103602747B (en) | Internal reference substance for detecting bladder cancer serum miRNA and its detection primers and use | |
| CN105400882B (en) | A kind of serum miRNA marker and application suitable for posterior longitudinal ligament ossification diagnosis | |
| CN107937532B (en) | Glioma diagnosis marker hsa _ circ _0021827 and application | |
| CN104630379A (en) | Non-small-cell lung cancer marker FAM107A and application thereof | |
| CN105039317A (en) | Internal reference compound for fluorescent inspection quantification of microRNA, primers and application of internal reference and primers | |
| Liu et al. | Multi-omics of extracellular vesicles: an integrative representation of functional mediators and perspectives on lung disease study | |
| Huang et al. | Identification of drug resistance associated ncRNAs based on comprehensive heterogeneous network | |
| ES2481819B1 (en) | ASSESSMENT METHOD TO EVALUATE A POSSIBILITY OF BREAST CANCER | |
| CN104059987A (en) | Osteosarcoma diagnostic kit and application of CPE (carboxypeptidase E) gene to preparing osteosarcoma diagnostic kit | |
| CN110438226A (en) | A kind of kit, sample treatment and the determination method of the mutation of detection cis-trans | |
| Vlassov et al. | Circulating microRNAs in lung cancer: Prospects for diagnosis, prognosis, and prediction of antitumor treatment efficacy | |
| CN104673918B (en) | The primer of detection CSF3R point mutation and method | |
| CN109295059A (en) | A kind of single stranded RNA of covalent annular closed and its application | |
| Han et al. | MiRNA-4665-3p Regulates Expression of PLD5 in Thyroid Cancer Patients and Predicts Death | |
| Dive et al. | Cancer moonshot connecting international liquid biopsy efforts through academic partnership | |
| Rossi et al. | Notes for developing a molecular test for the full characterization of circulating tumor cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151111 |