Summary of the invention
The application that the invention provides one group of relevant to the age, male fertility associated protein and be combined in diagnosis or treatment male sterility.
First aspect present invention, provide a kind of Myokinase 6 (adenylate kinase6, AK6) gene or albumen, or the purposes of the combination of itself and other male fertility genes involved or albumen, detect reagent or the test kit of male sterility for (i) preparation; And/or (ii) is for the preparation of the pharmaceutical composition of contraception.
In another preference, other described male fertility associated protein comprise one or more albumen of listing in table 1.
In another preference, other described male fertility associated protein also comprise one or more male fertility associated protein described in CN201010195377.9.
In another preference, described Myokinase 6 (adenylate kinase6, AK6) gene or albumen, or the purposes of the combination of itself and other male fertility genes involved or albumen, also can be used for the evaluation carrying out cell quality.
In another preference, described combination comprise AK6 and 1,2,3,4,5,6,7,8,9,10,11,12,13 or 14 kind of table 1 shown in the combination of albumen.
In another preference, described reagent also comprises detecting and is one or morely selected from the detection reagent of listing in albumen or its gene in table 1.
In another preference, described detection reagent comprise AK6 and/or one or more be selected from list in albumen or its gene in table 1 antibody, sense-rna, microRNA, siRNA, shRNA and its activity inhibitor, the inhibitor of such as AK6.
In another preference, the inhibitor of described AK6 comprises the antibody of AK6, the sense-rna of AK6 nucleic acid, the activity inhibitor of microRNA, siRNA, shRNA and AK6.
In another preference, described antagonist comprises the activity inhibitor of the antibody of one or more albumen be selected from table 1, the sense-rna of encoding said proteins nucleic acid, microRNA, siRNA, shRNA and described albumen.
Second aspect present invention, provides the purposes of a kind of male fertility genes involved or albumen or its control miRNA or their combination, detects reagent or the test kit of male sterility for (i) preparation; And/or (ii) is for the preparation of the reagent at age or the test kit that judge sperm source object; And/or (iii) preparation judge people or other mammiferous ages, for sperm aging evaluate and sperm quality evaluation reagent or test kit.
In another preference, described control miRNA comprises the control miRNA of AK6 and the control miRNA of GPX5.
In another preference, the control miRNA of described AK6 is selected from lower group: miR-370, miR-544a, miR-27a, miR-27b, miR-128, miR-20a, miR-20b, miR-106b, miR-106a, miR-17, miR-200b, miR-200c, miR-93, miR-429, miR-519d.
In another preference, the control miRNA of described GPX5 is selected from lower group: miR-419-5p, miR-299-3p, miR-296-3p, miR-194, miR-134, miR-383, miR-206.
In another preference, described reagent is the capture agent of AK6 albumen or other male fertility genes involveds or albumen.
In another preference, described reagent comprises the specific antibody of AK6 or other male fertility genes involveds or albumen, specificity amplification primer, probe or chip.
In another preference, described antibody comprises monoclonal antibody, polyclonal antibody, preferably, is monoclonal antibody.
In another preference, described reagent comprises:
(a). the specific antibody of anti-AK6 albumen or other male fertility genes involveds or albumen; And/or
(b). the Auele Specific Primer of mRNA or cDNA of specific amplification AK6 or other male fertility genes involveds or albumen.
In another preference, described AK6 derives from Mammals, preferably derives from people or rodent (mouse, rat).
In another preference, the Genbank ID No of described AK6 gene is NM_016283.4.
In another preference, described AK6 protein sequence is as shown in SEQ ID NO.:2, and the nucleotide sequence of this albumen of encoding is as shown in SEQ ID NO.:1.
In another preference, described detection comprises qualitative and/or detection by quantitative.
In another preference, described detection carries out qualitative and/or detection by quantitative to sperm positioning protein in the refining of male individual or semen sample.
In another preference, the detected object of described detection is human male, preferably, is male sterility or does not educate the spouse of women in 1 year after marriage.
In another preference, described detection comprises protein chip, antibody chip method, DNA chip method, RT-PCR method, quantitative real-time PCR, ELISA method, immunoblotting, Immunohistochemical Method, immunocytochemical method, Flow cytometry, mass spectroscopy detection.
Third aspect present invention, provides the purposes of the combination of AK6 inhibitor or itself and other male fertility associated protein promotor or inhibitor, for the preparation of the pharmaceutical composition for the treatment of male sterility; And/or (b) is for the preparation of anti-apolexis composition;
Wherein, other described male fertility associated protein comprise one or more albumen of listing in table 1.
In another preference, described anti-apolexis composition comprises pharmaceutical composition, beauty product composition or Halth-care composition.
In another preference, the combination of described AK6 inhibitor or itself and other male fertility associated protein promotor or inhibitor also can be used for drug target screening, disease prevention detects, environmental pollution, health control, genetic analysis or Drug efficacy evaluation.
In another preference, other described male fertility associated protein comprise GPX5 albumen.
In another preference, described AK6 inhibitor comprises the antibody of AK6, the sense-rna of AK6 nucleic acid, the activity inhibitor of microRNA, siRNA, shRNA and AK6.
In another preference, described pharmaceutical composition comprises AK6 inhibitor as activeconstituents or itself and other male fertility genes involved or albumen, or the combination of its promotor, and pharmaceutically acceptable carrier.
In another preference, described pharmaceutical composition also comprises lists in albumen in table 1 or its gene and its promotor.
Fourth aspect present invention, provide a kind of albumen set affecting male fertility and/or affect mankind spermatozoon fertilization success ratio, described albumen set comprises:
(a) AK6 albumen, and optional be one or morely selected from the albumen of listing in table 1; Or
B () is two or more is selected from the albumen of listing in table 1.
In another preference, described albumen set comprises CTSB, HSPA5, ALDH4A1, AK6 albumen, or its combination.
Fifth aspect present invention, provides a kind of gene sets affecting male fertility and/or affect mankind spermatozoon fertilization success ratio, the albumen in the albumen set that the gene in described gene sets is encoded described in third aspect present invention respectively.
In another preference, described gene comprises full length sequence or its fragment, cDNA or mRNA of this gene.
In another preference, described gene sets contains AK6 gene and GPX5 gene.
In another preference, expression amount in normal young mankind spermatozoon of described AK6 albumen or its gene and/or activity are lower than the expression amount in Elderly people mankind spermatozoon and/or activity.
In another preference, described one or more being selected from lists in expression amount in normal young mankind spermatozoon of albumen in table 1 or its gene and/or activity higher than the expression amount in Elderly people mankind spermatozoon and/or activity.
Sixth aspect present invention, provide a kind of test kit for detecting male sterility, described test kit contains a container, containing the detection reagent detecting gene sets described in albumen set described in fourth aspect present invention or fifth aspect present invention in described container, and label or specification sheets, described label or specification sheets indicate described test kit for detecting male sterility.
In another preference, described detection reagent comprises CTSB, HSPA5, ALDH4A1, AK6 albumen, or the monoclonal antibody of its combination.
In another preference, described male sterility comprises azoospermia, few azoospermia.
In another preference, described label or specification sheets are also described below content:
When the expression amount E1 of AK6 gene or albumen in the sample deriving from detected object and/or the expression amount of activity with normal population and/or ratio E1/E2 >=2 of active E2; And/or
When in the sample deriving from detected object, one or more to be selected from table 1 gene of sequence number 1-14 or the expression amount of albumen and/or the expression amount of active Ea with normal population and/or ratio Ea/Eb≤0.5 of active Eb;
Just show that described detected object suffers from the probability of infertility higher than general population.
In another preference, described sample comprises blood sample, urine sample, refining/liquid sample or tissue sample.
In another preference, when described E1/E2 >=2, and/or Ea/Eb≤0.5, also show that the living environment of described detected object is poor.
Seventh aspect present invention, provide a kind of chip of the sperm binding protein for detecting testis or epididymal expression, described chip comprises:
Solid phase carrier and the check point for detecting albumen set described in fourth aspect present invention be positioned on described solid phase carrier.
In another preference, described check point is fixed with the capture agent (as antibody) of described male fertility associated protein respectively.
In another preference, described capture agent is the monoclonal antibody of specific binding albumen in albumen set described in third aspect present invention.
In another preference, described albumen set at least comprises 1,2,3,4,5,6,7,8,9,10,11,12,13 or the albumen shown in 14 kind of table 1.
In another preference, described solid phase carrier is selected from lower group: the carriers such as sheet glass, plastic sheet, nitrocellulose membrane, polyvinylidene fluoride film, microballoon.
Eighth aspect present invention, provide a kind of male sex of raising and to be fertilized the pharmaceutical composition of success ratio, described pharmaceutical composition comprises (a) AK6 inhibitor; Optional (b) one or more to be selected from and to list in albumen in table 1 or gene or its promotor; (c) pharmaceutically acceptable carrier.
In another preference, described inhibitor comprises the monoclonal antibody of AK6 albumen.
Ninth aspect present invention, provides a kind of contraceptive compositions, and described pharmaceutical composition comprises (a1) AK6 gene or albumen; Optional (b1) one or more is selected from the antagonist of listing in albumen in table 1 or gene; (c1) pharmaceutically acceptable carrier.
Tenth aspect present invention, provide a kind of method detecting or diagnose male infertility, described method comprises step:
I () detects expression amount and/or the activity of albumen set or the gene sets described in fifth aspect present invention derived from subject sample described in fourth aspect present invention;
(ii) whether male infertility is suffered from according to the measurement result detection in (i) or the object described in diagnosis;
Wherein when the expression amount E1 of AK6 gene or albumen in the sample deriving from detected object and/or the expression amount of activity with normal population and/or ratio E1/E2 >=2 of active E2; And/or
When in the sample deriving from detected object, one or more to be selected from table 1 gene of sequence number 1-14 or the expression amount of albumen and/or the expression amount of active Ea with normal population and/or ratio Ea/Eb≤0.5 of active Eb;
Just show that described detected object suffers from the probability of infertility higher than general population.
In another preference, described detection method also comprises detection AK6 control miRNA.
In another preference, described AK6 control microRNA comprises: miR-370, miR-544a, miR-27a, miR-27b, miR-128, miR-20a, miR-20b, miR-106b, miR-106a, miR-17, miR-200b, miR-200c, miR-93, miR-429, miR-519d.
In another preference, compared to normal population sperm, miR-370, miR-544a, miR-27a, miR-27b, miR-128, miR-20a, miR-20b, miR-106b, miR-106a, miR-17, miR-200b, miR-200c express reduction in teen bra patient.
In another preference, compared to normal population sperm, miR-93, miR-429 express reduction in Asthenospermia.
In another preference, compared to normal population sperm, miR-519d all has obvious reduction in old age, azoospermia and teen bra patient.
In another preference, when described AK6 control miRNA low expression in described detected object, then show that described detected object suffers from the probability of infertility higher than general population.
In another preference, described detection method also comprises detection GPX5 control miRNA.
In another preference, described GPX5 control miRNA comprises: miR-419-5p, miR-299-3p, miR-296-3p, miR-194, miR-134, miR-383, miR-206.
In another preference, described GPX5 control miRNA high expression level in described detected object, then show that described detected object suffers from the probability of infertility higher than general population.
The present invention the 11 aspect, provide a kind of male sex of raising and to be fertilized the method for success ratio and/or treatment infertility, described method comprises the pharmaceutical composition described in ninth aspect present invention, or is selected from one or more materials following and contacts with the capacitation liquid of being fertilized:
(a1) AK6 inhibitor;
(b1) one or more being selected from lists in albumen in table 1 or its gene or its promotor;
And the combination of (b1) (a1);
Success ratio and/or treatment infertility thus the raising male sex is fertilized.
The present invention the 12 aspect, provides a kind of age judging sperm source object; And/or judge that spermoblast is old and feeble; And/or evaluate sperm and cell quality method, comprise step: (i) detects expression amount and/or the activity of albumen set in source objects sample described in fourth aspect present invention or the gene sets described in fifth aspect present invention;
(ii) judge according to the measurement result in (i) described in the range of age of object or the old and feeble situation of spermoblast or sperm and cell quality.
In another preference, when AK6 albumen in the sperm (spermoblast) high expression level, one or more are selected from albumen low expression in sperm (spermoblast) of table 1, then show that sperm source subject age is comparatively large, the aging degree of spermoblast is higher, or sperm is second-rate.
In another preference, when the low expression in sperm (spermoblast) of AK6 albumen, one or more albumen being selected from table 1 are at the middle high expression level of sperm (spermoblast), then show that sperm source object is younger, the aging degree of spermoblast is lower, or the quality of sperm is better.
Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.
Embodiment
The present inventor is through research extensively and profoundly, Late Cambrian Myokinase 6 (AK6) also exists close dependency between albumen and human male sterility, namely in male sterility patient, expression amount and/or the activity of AK6 increase, and the expression amount of AK6 and/or activity also increase along with the rising at age in normal population.The present inventor found through experiments, and the expression amount of reduction AK6 and/or activity can increase the success ratio of male sex's fertilization.In addition, the present inventor also finds, by kind of the protein combination application of 14 in AK6 and table 1, more contribute to the diagnosis of male infertility, and when reducing expression amount and/or the activity of AK6, or increase one or more expression amount being selected from 14 kinds of albumen in table 1 and/or activity simultaneously, and can to male infertility, especially azoospermia, few azoospermia have therapeutic action.On this basis, the present invention is completed.
Sperm positioning protein
As used herein, term " albumen of the present invention ", " male fertility associated protein ", " sperm positioning protein of the present invention ", " sperm positioning protein " are used interchangeably with " the sperm positioning protein relevant to the age ", refer to that express in the testis and/or epididymis of boar (especially people), relevant to the age, have location on sperm albumen.Its relevant molecular biology material includes, but is not limited to: any fragment of mutain, albumen, gene and any DNA fragment, mutator gene, mRNA, RNA interfering, antibody etc.Representational sperm positioning protein comprises kind of the down-regulation protein of 14 shown in table 1 and a kind of upregulated protein (AK6).
As used herein, " Mammals " refers to viviparous and nationality feeds the animal species of offspring by mammary gland, representational Mammals comprises (but being not limited to) one belonged to vertebrate, such as: people, monkey, sheep, ox, rabbit, horse, mouse, rat etc., and preferred people especially.
In 14 kinds of albumen shown in table 1, there are 14 kinds on the elderly's sperm, content is few on azoospermia patient sperm, ranges the sperm positioning protein (sequence number 1-14) of down-regulated expression in the elderly or weak essence; Another kind of albumen of the present invention (AK6) content on the elderly's sperm, azoospermia patient sperm is high, ranges the sperm positioning protein of up-regulated in the elderly or weak essence.
15 kinds of human spermatogoa positioning proteins that table 1 is relevant to the age
Shown in coding SEQ ID NO.:4,6,8,10,12,14,16,18,20,22,24,26,28,30, the nucleotide sequence of albumen is respectively as shown in SEQ ID NO.:3,5,7,9,11,13,15,17,19,21,23,25,27,29.
Albumen set
The invention provides a kind of albumen set that can be used for diagnosing or treating male sterility, described albumen set is at least containing AK6, and the albumen that other male sterilities are relevant, especially sperm positioning protein.Usually, " other male sterilities relevant albumen " as herein described refer to find in prior art there is the albumen of correlation with male sterility.Preferably, albumen set of the present invention to include in AK6 and table 1 one or more sperm positioning protein.Wherein, AK6 albumen is that the present invention is newfound closely related with male sterility, and the albumen of variant expression in young and old people.
Should be understood that albumen set of the present invention comprises (a) AK6 albumen, and optional be one or morely selected from the albumen of listing in table 1; Or
B () 2,3,4,5,6,7,8,9,10,11,12,13 or 14 is selected from arbitrarily the albumen of listing in table 1.
The present inventor found through experiments, the albumen arbitrarily in AK6, table 1 or it is combined in expression amount in youngster and the elderly's sperm and/or activity has significant difference, therefore can as the target protein judging sperm aging, deterioration.By deep research, the present inventor has also found that Partial Protein wherein also presents the differential expression with normal population (youngster) in the patient being diagnosed as azoospermia, few azoospermia.
According to above experimental result, the present inventor obtains the albumen set that can be used in diagnosing or treat male sterility.Carry out the albumen set of combining by the albumen in AK6 and prior art (table 1 especially of the present invention), measure expression amount and/or the activity of these albumen set, contribute to judging or predict that the object detected suffers from the probability of infertility.And research and development are for the antibody of these albumen set, can contribute to treating the medicine that male infertility or exploitation become contraception.Such as, the monoclonal antibody of AK6 albumen is prepared.
Should be understood that albumen set of the present invention can be the set that AK6 and any male sterility associated protein are formed.By carrying out the regulation and control of expression amount and/or activity to AK6 or other male sterility associated protein, the pharmaceutical composition improving rate of fertilization (promoting fertility) or reduce rate of fertilization (contraception) can be prepared respectively.
In addition, present invention also offers the gene sets of code book invention albumen set, described gene sets comprises the cDNA of proteins encoded, complete gene order, or has 70%, 80% with original coding nucleic acid, more preferably the nucleotide sequence of 85%, 90%, more than 95% homology.Utilize the set of these genes (or coding nucleic acid), its antisense nucleic acid can be prepared by conventional means, or measure its mRNA, or undertaken the qualitative of these genes or detection by quantitative by measuring corresponding miRNA.
miRNA
The invention provides a kind of diagnosis or prediction/detect the target gene set of infertility, miRNA that in gene sets of the present invention, each gene is known can be adopted to measure the expression amount of described gene sets.
A kind of preferred gene regulating miRNA that is correlated with is as follows:
Be correlated with in miRNA at the gene regulating of AK6, miR-370, miR-544a, miR-27a, miR-27b, miR-128, miR-20a, miR-20b, miR-106b, miR-106a, miR-17, miR-200b, miR-200c expresses reduction in teen bra group, miR-93, miR-429 express reduction in azoospermia group, and miR-519d all has obvious reduction in old age, azoospermia and teen bra patient.The be correlated with sequence of miRNA of AK6 gene regulating is as follows:
miRNA |
SEQ ID NO.: |
Sequence |
hsa-miR-128 |
31 |
TCACAGTGAACCGGTCTCTTT |
hsa-miR-27a |
32 |
TTCACAGTGGCTAAGTTCCGC |
hsa-miR-27b |
33 |
TTCACAGTGGCTAAGTTCTGC |
hsa-miR-200b |
34 |
TAATACTGCCTGGTAATGATGA |
hsa-miR-200c |
35 |
TAATACTGCCGGGTAATGATGGA |
hsa-miR-429 |
36 |
TAATACTGTCTGGTAAAACCGT |
hsa-miR-370 |
37 |
GCCTGCTGGGGTGGAACCTGGT |
hsa-miR-544a |
38 |
ATTCTGCATTTTTAGCAAGTTC |
hsa-miR-106b |
39 |
TAAAGTGCTGACAGTGCAGAT |
hsa-miR-519d |
40 |
CAAAGTGCCTCCCTTTAGAGTG |
hsa-miR-106a |
41 |
AAAAGTGCTTACAGTGCAGGTAG |
hsa-miR-17 |
42 |
CAAAGTGCTTACAGTGCAGGTAG |
hsa-miR-20a |
43 |
TAAAGTGCTTATAGTGCAGGTAG |
hsa-miR-20b |
44 |
CAAAGTGCTCATAGTGCAGGTAG |
hsa-miR-93 |
45 |
CAAAGTGCTGTTCGTGCAGGTAG |
And being correlated with in miRNA at GPX5 gene regulating, miR-419-5p, miR-299-3p, miR-296-3p, miR-194, miR-134, miR-383, miR-206 all significantly raise in teen bra and azoospermia patient.The be correlated with sequence of miRNA of GPX5 gene regulating is as follows:
miRNA |
SEQ ID NO.: |
Sequence |
hsa-miR-194 |
46 |
TGTAACAGCAACTCCATGTGGA |
hsa-miR-134 |
47 |
TGTGACTGGTTGACCAGAGGGG |
hsa-miR-206 |
48 |
TGGAATGTAAGGAAGTGTGTGG |
hsa-miR-383 |
49 |
AGATCAGAAGGTGATTGTGGCT |
hsa-miR-296-3p |
50 |
GAGGGTTGGGTGGAGGCTCTCC |
hsa-miR-299-3p |
51 |
TATGTGGGATGGTAAACCGCTT |
hsa-miR-491-5p |
52 |
AGTGGGGAACCCTTCCATGAGG |
Therefore, those skilled in the art can according to the screening method of miRNA in enlightenment of the present invention and prior art, measure the miRNA that in the assortment of genes of the present invention, each gene regulating is relevant, thus develop the relevant detection reagent of more male sterility or test kit, and the pharmaceutical composition for the treatment of male sterility.
Detection method
In the present invention, additionally provide qualitative or detection by quantitative the present invention 15 kinds of sperm positioning proteins and associated molecule biologic material thereof method, comprising (but being not limited to): human spermatogoa positioning protein detects, the detection of transgenation, the detection of the mRNA of genetic transcription, the detection of the relevant miRNA of regulation and control, the detection of mutain, the detection of protein-active.Comprise (but being not limited to) for the biological specimen detected: sperm, seminal fluid, urine, blood, prostatic fluid.
Representational detection method comprises (but being not limited to): protein chip, antibody chip, DNA chip, liquid chip, ELISA method, immunoblotting, RT-PCR, quantitative real-time PCR, Immunohistochemical Method, immunofluorescence technique, Flow cytometry, mass spectroscopy, capillary electrophoresis, immuno-precipitation, Enzyme activity assay method etc.
Azoospermia
According to the regulation of WHO human seminal fluid laboratory inspection handbook the 5th edition, the ratio shared by propulsion (PR) sperm be less than 32% for azoospermia.Azoospermia of the present invention refers to the young azoospermia that Semen routione other every (as abnormal rate, sperm concentration, leukocyte count, semen volumes etc.) is normal.
Few azoospermia
Few azoospermia of the present invention refers to progressive sperm proportion <32%, sperm concentration <15*10 in seminal fluid
6/ ml or the <39*10 that once ejaculates
6people.
Qualitative or the detection by quantitative of human spermatogoa positioning protein
Can be used for the present inventor's sperm positioning protein method that is qualitative or detection by quantitative to be not particularly limited, can be that this area is any can the instrument of fluorescence intensity or fluorescent value, software or method.
Normally, after specific antibody and detection sample (sperm) are hatched jointly, resist by fluorescently-labeled two the location determining sperm positioning protein, and then calculate location rate and the content of albumen by the scanning result of laser confocal microscope.The method utilizing the quantitative sperm protein of confocal scanning microscope to express is as follows: observe immunofluorescence sheet with 400 times of magnification ratios.Order observation comprise sperm the visual field (this visual field require do not have Nonsperm cell, sperm tail does not have overlap, and in the visual field, sperm tail should be complete) until in the visual field sperm sum reach 200.Background fluorescence is chosen does not have the white space of sperm to measure.Fluorescent value lower than or higher than the sperm of blank value (about average is 10) for adding up staining sperm cells ratio.LSM510META carries the fluorescent value that all staining sperm cells measured automatically by software (LSM5version3.2), and deduction fluorescence background threshold value, then provides the mean immunofluorescence intensity level of staining sperm cells.The result that the method detects is consistent with the result by flow cytomery.The detection method of flow cytometer to protein localization rate and content is as follows: Sperm washing and preparation are with the former, the fluorescent value of sperm sample is measured by BD flow cytometer, count 10000 sperms, use Cellquest software to carry out analysis staining cell ratio and staining cell fluorescence intensity.
Specific fluorescent-labeled antibody can be dissolved in the solution, is combined with sperm surface, qualitative or measure the Semen sarameters content of flowing quantitatively by detection meanss such as flow cytometers; Also antibody can be fixed on upholder (such as polyethylene board, immune microsphere, sheet glass, nitrocellulose membrane, pvdf membrane etc.), qualitative or measure positive sperm percentage composition quantitatively with scanner; Can also by antibody coupling on magnetic bead or plastic bead, the sperm positioning protein by the double antibodies sandwich of liquid chip in legal or detection by quantitative refining or sperm lysate equal samples.
Protein chip and the application in human seminal plasma's equal samples detects thereof
Present invention also offers the protein chip that can be used for detecting sperm positioning protein.This chip can sperm positioning protein content qualitatively or in quantitative detection sample.These detected results can secondarily for judging the reason that the functional level of such as sperm quality, sperm and/or sperm quality decline.
Term " protein array " or " protein chip " are used interchangeably, and all refer to the array of capture agent energy conjugated protein mark, comprise liquid chip.Typically, capture agent is polyclone or monoclonal antibody, can with special protein bound.After mark is captured, then detect by the detection molecules of mark, reach the object that qualitative or quantitative (use standard substance) detect.
The feature of present protein chip is, described chip is provided with the check point of sperm positioning protein, as used herein, term " check point " refers to be positioned on protein chip, for detecting the point of sample corresponding to a certain protein, such as detecting the check point of AK6 albumen, normally by the monoclonal antibody point sample of anti-AK6 albumen in chip substrate or be coupled to magnetic bead, plastic bead is formed.
Be applicable to protein chip of the present invention be not particularly limited, the blank protein chip of various known structure in this area can be adopted.Usually, these protein chip carriers comprise: magnetic bead, plastic bead, immune microsphere, sheet glass, plastic sheet, nitrocellulose membrane, pvdf membrane etc., particularly wherein preferably be magnetic bead, plastic bead, immune microsphere and various substrate.Fabricated in situ, mechanical deposition or covalently bound method is adopted polypeptide, albumen or antibody to be fixedly coupled in an orderly manner the chip various carrier becoming and detects, the antibody of mark fluorescent or other compositions are interacted with the chip combining measuring samples, wash away failing the composition that complementary action of protein on chip is combined through rinsing, recycling Fluorescence Scanner or laser confocal scanning technology, measure the fluorescence intensity of each point on chip or other carrier, analyze the content of often kind of protein, reach the object measuring various protein thus.
Protein chip of the present invention can contain the sperm positioning protein shown in one or more tables 1, and such as 1,2,3,4,5,6,7,8,9,10,11,12,13,14 or the check point of sperm positioning protein that discloses first of 15 kind of the present invention.These 15 check points can be used alone, also can arbitrary combination use, or with published sperm Testing index conbined usage, for sperm quality evaluation, male sterility diagnosis etc.
Industry is applied
Spermatogenesis, ripe be mainly manifested in Testes And Epididymides with aging and secrete and the amount being combined in the protein molecular on sperm, increase, reduce or incompleteness all can cause spermioteleosis obstacle or dysfunction, and then cause male sterility.Based on the present invention, detection method and the testing tool of sperm positioning protein can be used for the content detecting the 15 kind sperm positioning proteins relevant to the age, and then judge sperm quality, diagnosis male sterility.
Such as, by measuring the content of the sperm positioning protein of 14 kinds of down-regulated expressions, obtaining some and detecting or diagnostic results, as sperm quality, sperm health state, whether sterile etc.In a word, the content of these 14 kinds of sperm positioning proteins is high, just prompting sperm health state is good, quality is good or sperm from normal young people; Content is low, then point out the not good enough or sperm of sperm health state from the elderly.
In addition, supplement these 14 kinds of down-regulated expressions sperm positioning protein in one or more, contribute to the state of health improving sperm, strengthen motility of sperm.
For normal people, closed or the method such as siRNA interference by antibody, reduce expression or the activity of the sperm positioning protein of these 14 kinds of down-regulated expressions, contribute to practising contraception.
With regard to different field, representational application comprises (but being not limited to):
The evaluation of (a) sperm quality and state of health: by measuring on sperm or the content of albumen of the present invention in refining, evaluate sperm health state and quality.Low or the disappearance of 14 kinds of down-regulated expression protein contents, a kind of up-regulated albumen (as AK6 albumen) content is high, then show sperm health state difference, sperm quality level is low, and sperm has incomplete phenomenon; Otherwise illustrate that state of health is good, sperm quality is high.
The diagnosis of (b) male infertility: by measuring on sperm or the content of albumen of the present invention in refining, diagnose male infertility.Low or the disappearance of 14 kinds of down-regulated expression protein contents, a kind of up-regulated protein content is high, then prompting may occur sterile.
(c) pollution assessment: by checking the content of albumen of the present invention on sperm, carry out prevention detection or the pollution assessment of healthy reproduction.Live in different local people, if protein content is low, illustrate that lived environment is bad.By a large amount of crowd of statistical analysis, contribute to judging environmental problem.
D () human health manages: measure the content of albumen of the present invention in human sample's (as blood, urine, refining, tissue etc.), if exceed normal range, then prompting illustrates that health may go wrong, and needs to check further or diagnosis.
E () Age Determination: such as, at medical law fields, by the mensuration of protein content of the present invention, can identify or the auxiliary measuring age.
F () health care, treatment use: by supplementary copy invention albumen, can treat the disease relevant with this protein function, contribute to strengthening motility of sperm, treatment male infertility.Such as, make suppository, external for female genital tract; Or make injection, for the male sex (local injection, subcutaneous injection etc.).
G () is practised contraception: the antibody using anti-albumen of the present invention, can be made into preparation (as suppository), for contraception.
H () drug target and screening: albumen of the present invention can be used as drug target, for the screening of contraceptive or male infertility medicine.
I () index of assessment of curative effect: the content of albumen of the present invention, can be used as the auxiliary characteristics evaluated the curative effect of male infertility treatment means.
(j) toxicity test: by measuring the content of this albumen in animal sperm or refining, evaluate the impact on reproduction such as medicine, chemical, makeup.
That more than applies completes, except realizing by measuring the content of these 15 kinds of albumen in human sample, can also be realized by the sudden change of detection gene, transcriptional level, amino acid change, Nucleotide or amino acid whose increase disappearance, regulation and control relevant miRNA level, antibody etc.
Major advantage of the present invention is:
A () can obtain the detected result of the sperm positioning protein content relevant to the age fast and effectively.
B the associated molecule biologic material of () albumen of the present invention and detection method thereof, contribute to advancing the exploitation to the relevant medical skill of the diagnosis of male infertility, treatment, prevention and diagnostic reagent, curative, prophylactic agent or contraceptive bian.
C () albumen of the present invention also can be used for judging people or other mammiferous ages, or for cell aging evaluation and sperm and cell quality evalution, or for the exploitation of anti-aging product.
Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.
Universal method
The clone of gene, prokaryotic expression and protein purification
The protein product of above-mentioned 15 kinds of genes obtains by following method.According to gene order, the special primer of the ripe coding region of synthesis pair for amplification.With the people's epididymis cDNA library prepared by ordinary method for template, by the direct amplifying target genes of PCR, be then cloned into commercially available carrier pGM-T vector (winning biotech firm purchased from upper sea cowry) and carry out order-checking qualification correctly.Gene after order-checking qualification is cloned in expression vector pET32b (+) (winning biotech firm purchased from upper sea cowry) by restriction enzyme site, makes it consistent with the reading frame of fusion tag.By recombinant expression vector transformation of E. coli BL21 (DE3), IPTG abduction delivering, ultrasonication thalline, according to the His-Tag label in carrier, uses " two step nickel affinity chromatography methods " to carry out separation and purification to recombinant protein.
15 kinds of sperm positioning protein quantitative analyses on different ages human spermatogoa in embodiment 1 table 1
Collect different ages Human semen sample (30,40,50,60,65,70 ± 2 years old) each 30 example, equal non-reproductive system disease record.Treat that 1ml seminal fluid adds in the aseptic conical bottom test tube of 15ml by seminal fluid complete post liquefaction respectively, then add PBS to 8ml respectively, gently the centrifugal 15min of 500g after piping and druming mixing.Abandon supernatant, and then wash 2 times (500g, 10min) with PBS, abandon supernatant, it is 1 × 10 that collected Sperm pellets adjusts sperm concentration with the PBS containing 3% (w/v) BSA
6individual/ml, be then coated on the slice, thin piece of 0.1% gelatin bag quilt respectively, natural drying at room temperature ,-20 DEG C of methyl alcohol fix 10min, wash 3 times, each 5min after drying with PBS; Then primary antibodie (with the PBS containing 3%BSA by 1:50 dilution) the incubated at room 1h for target protein is dripped.PBS washs 3 times, each 5min.Add two anti-(with the PBS containing 3%BSA by 1:100 dilution) of FITC mark, incubated at room 1h.PBS washes 3 times, each 5min.PI redyes, distillation washing 2 times, each 10min.Buffering glycerine mounting, carries out location and the quantitative analysis of albumen under putting Meta510 laser confocal microscope (Zeiss, Germany) respectively.
Result as depicted in figs. 1 and 2, location rate on sperm of 14 kinds of sperm positioning proteins (in table 1, sequence number is 14 kinds of albumen of 1-14) and content increase with the age and present progressively downward trend, in some old sperm, also found positioning protein deficient phenomena.
And in table 1, sequence number is the sperm positioning protein AK6 of 15 is up-regulateds, its location rate on the elderly's sperm and content are apparently higher than normal young people (see Fig. 4, Fig. 5).This prompting, the high expression level of AK6 albumen in the elderly's sperm is perhaps a kind of mode that compensatory alleviates sperm low-energy state.
The qualification of embodiment 2 recombinant protein
Carry out Quantitative measurement to recombinant protein Bradford (Bradford1976) method of 15 after purifying, then lyophilize is preserved.Fig. 3 shows the one in 15 kinds of sperm positioning proteins, i.e. the HSPA5 gene pairs expression and purification SDS-PAGE electrophoresis result of albumen (also referred to as GRP78 albumen) of answering.
Through qualification, the recombinant protein that purifying obtains is albumen of the present invention.
Embodiment 3 azoospermia sperm associated protein is analyzed
Collect young weak smart sample 102 example, quantitative analysis is carried out to the location rate of these 4 kinds of albumen of CTSB, HSPA5, ALDH4A1, AK6 on weak sperm and content.Concrete grammar, with embodiment 1, the results are shown in Figure 4.
Result shows, CTSB in azoospermia sperm, HSPA5, the ratio that its location of these 3 kinds of albumen of ALDH4A1 presents significantly disappearance is respectively 45.1%, 45.1% and 57.8%, total fraction of coverage reaches 85.5%, i.e. the expression defect of the azoospermia sperm of more than 85% at least containing a kind of above-mentioned albumen, and AK6 then shows and increases trend.Visible, by the detection by quantitative of these 4 kinds of albumen on sperm, contribute to the diagnosis of azoospermia, male sterility.
The Synthesis and applications of embodiment 4 monoclonal antibody
The preparation of 4.1 monoclonal antibodies
The monoclonal antibody of albumen of the present invention obtains by the preparation of routine protein method for preparing monoclonal antibody, preferably, the present embodiment obtained by the following method: the recombinant protein of the present invention immune balb/c mice respectively adopting each purifying, and every mouse injected the Split completely (CFA) of 50 μ g recombinant proteins and equivalent in the 1st day; Then incomplete freund adjuvant (IFA) booster immunization of 25 μ g recombinant proteins and equivalent was injected respectively at the 15th, 30 and 45 day.After final immunization 3 ~ 4 days, separating Morr. cell adds PEG after mixing with Sp2 myeloma cell strain makes cell fusion together, cell after merging suitably is diluted, split to cultivate in plate hole and cultivate, generally be diluted to 0.8 cells/well, cell cultures, to when covering at the bottom of 20% hole, is drawn culture supernatant ELISA and is detected anti-body contg.The positive cell strain mouse peritoneal inoculation filtered out, collect ascites, prepare affinity column enrichment antibody wherein with staphylococcal protein A,SPA, then wash-out reclaims monoclonal antibody.
4.2 adopt the monoclonal antibody in 4.1 to carry out protein immunization fluorescence localization
Coat on the slide glass of 1% gelatin bag quilt after collecting sperm PBS washing, naturally dry, then fix 10 minutes with methyl alcohol.Slide glass containing sperm 3%BSA at room temperature closes 1 hour, and then add often kind of albumen monoclonal antibody (1:200) of preparing gained in 4.1,4 DEG C are spent the night.Wash three times with PBST (PBS containing0.1%Tween-20), add corresponding FITC-and mark sheep anti-mouse igg two anti-(1:200).Slide glass PBST washs three times, then uses 80% glycerine mounting.With Olympus BX-52 microscopy results.The results are shown in table 1.Each albumen is positioned the positions such as mature sperm afterbody, neck and acrosome respectively.
The preparation of embodiment 5 protein chip
In order to below legal system for protein chip No.1-3:
A slide glass chip No.1
(1) use high speed point sample instrument by each protein example (antibody of anti-albumen of the present invention) in porous plate, direct high-density place is printed on to be had on the slide glass of active aldehyde radical through chemical-treated, surface, every array 15 sampling points (being 15 kinds of albumen of 1-15 respectively for sequence number in table 1), each spot diameter 0.4mm;
(2) in ambient temperature overnight or in 37 DEG C of incubations 1 hour, the aldehyde radical generation condensation reaction on the amino of protein and slide glass is made, with fixed sample;
(3) reduce not by the active aldehyde radical that protein occupies on slide glass, then fully washing drying at room temperature;
(4) finally pack with lucifuge material seal and be stored in 4 DEG C of environment.
B pvdf membrane chip No.2
(1) high speed point sample instrument is used by each protein example (antibody of the anti-albumen of the present invention) point in porous plate on PDVF film, every array 15 sampling points (the same), each spot diameter 0.4mm;
(2) damping fluid rinsing film 2-3 time is used, each 3-6 minute,
(3) with 5% calf serum or de-ester milk powder room temperature under close 1-2 hour,
(4) damping fluid rinsing film 2-3 time is used again, each 3-6 minute;
(5), after drying, pack with lucifuge material seal and be stored in 4 DEG C of environment.
C liquid chip No.3
(1) antibody pair that Reichl's test is corresponding is treated in preparation, a kind of as capture antibody, a kind of as detecting antibody.
(2) capture antibody is coupled on magnetic bead, the magnetic bead of the corresponding a kind of sequence number of a kind of capture antibody.
(3) fluorescent mark is carried out to detection antibody.
(4) carry out preferably to capture antibody and detection antibody, prevent from, between different testing protein, cross reaction occurs.
Embodiment 6 suppository prescription and preparation technology
5.1 formula
Amounts of components
HSPA5 albumen 5mg
β-CD 10mg
Tween 80 2mg
The semi-synthetic fatty acid enzyme 40mg of 36 type
5.2 preparation technologies:
1. β-CD is added ethanol in proper amount and be stirred for pasty state, add HSPA5 albumen grinding inclusion 45 minutes for subsequent use.
2. be incubated 38 DEG C by after the semi-synthetic fatty acid enzyme heating for dissolving of 36 type, add the inclusion compound of main ingredient, tween 80, fully mix insulation.
3. the insulation thing mixed is filled with film cooling forming.
Embodiment 8 is for the preparation of the medicine improving success ratio in vitro fertilization
By detecting the content of 15 kinds of above-mentioned albumen on sperm in vitro fertilization, determine the albumen that content is on the low side, the composition of this sperm positioning protein obtained in embodiment 2 or multiple protein is replaced in capacitation liquid in vitro fertilization, then allows sperm and ovum complete fertilization process in protein-contg capacitation liquid.For male sterility obstacle, azoospermia patient, after adding albumen, 30min just can improve motility of sperm, increases progressive sperm quantity, and then improves success ratio in vitro fertilization.
The detection by quantitative of the mRNA that embodiment 9 sperm positioning protein is corresponding
Collect 30 ± 5 years old normal young people, azoospermia patient, few azoospermia patient, 70 ± 2 years old each 10 example of old man's semen sample, carry out PBS and wash 3 times, microscopy counts, and the sperm of centrifugal acquisition adopts Trizol method to extract Spermatozoal total RNAs.Spermatozoal total RNAs sample CD52, after CDH1 genescreen, carries out Real-time PCR.
Often organize sample and carry out 3 parallel laboratory tests.According to Invitrogen company
the description of product of GreenqPCR SuperMix-UDG reaction kit reacts, and use the Rotor-Gene Q of QIAGEN company to carry out fluorescence quantitative PCR detection, reaction conditions is: 50 DEG C of 10min, 95 DEG C of 10min, 95 DEG C of 15s, 60 DEG C of 45s, 40 circulations.2-△ △ CT method is adopted to calculate target gene relative expression levels (Kenneth J, et al).△ △ CT=(Ct (experimental group target gene)-Ct (experimental group reference gene))-(Ct (control group target gene)-Ct (control group reference gene)).Select GAPDH as reference gene.
Use aforesaid method to detect the mRNA transcriptional level of 15 kinds of genes in normal young human spermatogoa in table 1,7 genes can detect as a result.Further analysis its elderly, azoospermia, transcriptional level in few azoospermia sperm, find that the content of the mRNA of wherein AK6 in the elderly's sperm is 2 times of normal young people, content in few azoospermia patient sperm is 8 times of young adult, the content of mRNA in the elderly's sperm of GPX5 is 0.12 times of normal young people, and the content in few azoospermia patient sperm is 0.07 times of normal young people.The content of UAP1, CTSB, HSPA1L, HSPA5, CALR mRNA in normal young human spermatogoa and the elderly's sperm, azoospermia sperm, few azoospermia sperm is without significant difference.Statistics is shown in Fig. 6.
Embodiment 10AK6 gene regulating is correlated with the detection by quantitative of miRNA in sperm
The miRNA molecule that regulation and control AK6 transcribes predicted by conbined usage TargetScan (http://www.targetscan.org/) and miRanda (http://www.microrna.org/microrna/home.do) two softwares simultaneously.TargetScan predicts 53 miRNA, miRanda and predicts 17 miRNA, wherein has 15 miRNA to be two database overlaps.Detection by quantitative is carried out to the content of these 15 miRNA in sperm.Method is as follows: choose the sperm that normal people contributes, sperm, the sperm (70 ± 2 years old) of the elderly's donation, each 10 parts of extraction total serum IgE of sperm of teen bra patient donation that azoospermia patient contributes.For each miRNA reverse transcription reaction, by miRNA specificity stem ring primer, 1ng-1 μ g total serum IgE and ReverTra Ace ThermoScript II (Toyobo).Use miRNA specific forward primer and general reverse primer (URP) during PCR, instrument is QIAGEN ' s Roter-Gene Q.In 20 μ L reaction systems, contain 1 μ L cDNA template, PCR reaction conditions be 95 DEG C 5 minutes, 95 DEG C 10 seconds, 60 DEG C 45 seconds, totally 40 circulations.PCR enzyme used is Platinum SYBR Green qPCR SuperMix-UDG, purchased from Life Technologies company (article No.: 11733-038).U6snRNA is as reference gene.Use 2
-△ △ Ctmethod calculates the difference of miRNA content in sample.All experiments in triplicate.The results are shown in Figure 7.
Result shows, relative to Sperm of Normal group, and miR-370, miR-544a, miR-27a, miR-27b, miR-128, miR-20a, miR-20b, miR-106b, miR-106a, miR-17, miR-200b, miR-200c express reduction in teen bra group, miR-93, miR-429 expresses reduction in azoospermia group, and miR-519d all has obvious reduction in old age, azoospermia and teen bra patient.By the detection by quantitative of these 15 miRNA, be expected to realize the auxiliary diagnosis to azoospermia, male sterility etc.
Embodiment 11GPX5 gene regulating is correlated with the detection by quantitative of miRNA in sperm
GPX5 transcriptional control is correlated with the prediction of miRNA and the quantitative detecting method in sperm thereof with embodiment 11.Predict 9 GPX5 transcriptional controls to be altogether correlated with miRNA, its detection by quantitative in normal young people, the elderly (70 ± 2 years old), azoospermia patient, few azoospermia patient sperm the results are shown in Figure 8.
Result shows, and relative to Sperm of Normal group, these 9 miRNA express and increase at least 2.5 times in old age and teen bra patient.Wherein miR-419-5p, miR-299-3p, miR-296-3p, miR-194, miR-134, miR-383, miR-206 express in teen bra group and increase at least 66 times, express and increase at least 2.4 times in weak smart group.
Discuss
At present, existing minority γ-seminoprotcin is used for auxiliary diagnosis and the treatment of infertility clinically, and the positive rate of diagnosis can be screened and improve to multinomial markers in detecting.Conventional immunological detection method comprise radioimmunoassay (RIA), enzyme-linked immunoassay (ELISA), chemiluminescent immunoassay (CLIA) though etc. each tool advantage, but these technology all exist a common limitation, namely only can detect a kind of infertility protein marker at every turn.This obviously can not meet the needs of the multiple infertility mark of needs joint-detection clinically, gene chip and protein chip can be analyzed the multiple different goal gene in same sample or albumen simultaneously, originally can detect many increments again simultaneously, substantially increase working efficiency; Sensitivity and accuracy high, signal to noise ratio is good, only needs trace sample, easy and simple to handle, reproducible.
The present invention screens first and obtains the 15 kind human spermatogoa positioning proteins relevant to the age, these albumen and molecular biology material thereof, as gene, antibody, mRNA, and regulate and control the miRNA equimolecular biologic material of these genetic transcriptions, comprise RNA interfering, any fragment of albumen or gene, vaccine etc., and the transcriptional level established more than a kind or a kind gene in 15 kinds of male fertility genes involveds, expression level, transgenation, amino acid changes, increase disappearance, the relevant miRNA level of regulation and control, antibody etc. carry out the method detected, prepare the pharmaceutical composition containing albumen in more than a kind or a kind table 1 and AK6.In addition, the present inventor is based on normal young Human Testis and the ripe microenvironment proteomics of epididymal sperm, the analysis and research such as protein immunization fluorescence localization on mankind's age groups testis, epididymis 2D-DIGE Different Proteomics and sperm is quantitative are carried out, find that 15 kinds of albumen positioning and quantitative on the elderly's sperm and young adult exist significant difference (wherein 14 kinds are significantly reduced, a kind of remarkable increase) altogether.In addition, along with the age increases, this difference degree is more remarkable.This prompting, the elderly's sperm function weakens or to lose function relevant to these sperm positioning proteins, especially with the minimizing of 14 kinds of down-regulated expression albumen about or the minimizing of described 14 kinds of down-regulated expression albumen can reproductive function be caused to a certain extent to weaken or lose function.The present invention contributes to advancing the exploitation to the relevant medical skill of the diagnosis of male infertility, treatment, prevention, and the exploitation of diagnostic reagent, curative, prophylactic agent or contraceptive bian.The present invention also contributes to the exploitation advanced anti-aging product and medical and beauty treatment technology.
The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.