CN105017409A - Improved porcine VIP (vasoactive Intestinal peptide) and method for expressing porcine VIP in escherichia coli - Google Patents
Improved porcine VIP (vasoactive Intestinal peptide) and method for expressing porcine VIP in escherichia coli Download PDFInfo
- Publication number
- CN105017409A CN105017409A CN201510390108.0A CN201510390108A CN105017409A CN 105017409 A CN105017409 A CN 105017409A CN 201510390108 A CN201510390108 A CN 201510390108A CN 105017409 A CN105017409 A CN 105017409A
- Authority
- CN
- China
- Prior art keywords
- vip
- improved peptide
- pig
- pvip
- peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention discloses an improved porcine VIP (vasoactive Intestinal peptide). The improved porcine VIP has the following amino acid sequence: FTANYTRLRRQLAVRRYLAAILGRR. The present invention further discloses a method for expressing the porcine VIP in escherichia coli, so that the problems that an existing peptide is lack of antibacterial activity and is not wide enough in an antibacterial spectrum, an existing production technique process is complicated, and the production cost is high are solved.
Description
Technical field
The invention belongs to technical field of bioengineering, relate to a boar VIP improved peptide and the expression method in intestinal bacteria thereof.
Background technology
At present, in Animal husbandry production, antibiotic a large amount of use is even abused and is caused pathogenic bacteria resistance to drugs bacterial strain even superbacteria produces, microbiotic residual and follower fecaluria in animal products discharges a series of Tough questions such as contaminate environment, has had a strong impact on livestock product quality and human health.Therefore, it is extremely urgent that development safety, the environment-friendly type disease-prevention health class livestock and poultry medicine efficiently, not easily producing resistance or additive carry out substitute antibiotics.The class natural protection class biologically active peptides-antibacterial peptide existed in animal body because its tool has a broad antifungal spectrum, stability are strong, have no side effect, no drug residue, not easily produce the number of advantages such as Resistant strain, the frontier nature problem seeking microbiotic ideal substitute is become to its research and development, has been considered to new resources and the important channel of new antibiotic research.The natural radioactivity peptide VIP existed in pig body has the advantage and potential being developed as disease-prevention health class fodder additives or veterinary medicine: (1) structure is simply clear and definite: the linear peptides be made up of 28 amino-acid residues; (2) there is various biological activity, and activity is stronger: immunomodulatory, anti-inflammatory, to intestinal bacteria, streptococcus aureus etc., there is stronger inhibitory or killing effect; (3) activity is little: regulate peptide (braingut petide) because VIP belongs to endogenic hormones neuro-endocrine-immunoregulatory, therefore, just can play stronger biological activity with less activity (nmoL level).The characteristic that VIP itself has makes it have and is developed as the potentiality of efficient, safe disease-prevention health class fodder additives and medicine and wide application prospect.
But due to endogenic antibacterial peptide resource-constrained, direct separation and purification difficulty, chemical synthesising peptide class cost is high, and the approach that gene engineering method great expression antibacterial peptide makes it to become emerging fodder additives is more real, and demonstrates good prospect.Along with illustrating antibacterial peptide structure activity relationship and mechanism of action, be template with natural antibacterial peptide, design its improved peptide, and it is carried out high efficiency recombinant expressed feasible to develop Substitutes For Antibiotic.The trial utilizing gene engineering method to obtain antibacterial peptide succeeds at protokaryon and eucaryon system, but allos efficient expression antimicrobial peptides still faces multiple difficulty, one is that mRNA after the encoding gene of antibacterial peptide is transcribed is less, generally only has 100 ~ 200bp, its antibacterial peptide of expressing also easily is degraded in express cell simultaneously, is difficult to the great expression realizing antibacterial peptide; Two is that antibacterial peptide has anti-microbial effect, expressive host, and the antibacterial peptide as bacterium or yeast cell to express can suppress host cell active by feedback, affects the further expression of antibacterial peptide.As can be seen here, how to improve expression level further, while high expression level, fully keep the biologic activity of antibacterial peptide, improve the stability of gene expression product, designing and expressing stronger, that antimicrobial spectrum the is wider antibacterial peptide etc. of anti-microbial activity is all the problem being worth deeply probing into.
Summary of the invention
The object of this invention is to provide a boar VIP improved peptide and the high-efficiency expression method in intestinal bacteria thereof, to solve, existing peptide antibacterial activity is not enough and antimicrobial spectrum is wideless, and the problem that existing production technology flow process is complicated, production cost is high.
The first technical scheme of the present invention is, a boar VIP improved peptide, and described pig VIP improved peptide is following aminoacid sequence: FTANYTRLRRQLAVRRYLAAILGRR.
The second technical scheme of the present invention is, the expression method of VIP improved peptide in intestinal bacteria of a boar, implements according to following steps:
The clone of the gene of step 1, pig VIP improved peptide:
According to e. coli codon Preference, the nucleotides sequence being obtained pig VIP improved peptide by the aminoacid sequence derivation of pig VIP improved peptide is classified as:
TTTACCGCAAATTATACCCGTCTGCGTCGTCAGCTGGCAGTTCGTCGTTATCTGGCAGCAATTCTGGGTCGTCGT；
For avoiding improved peptide to the toxicity of e. coli host bacteria, by TrxA and pVIP
mcarry out amalgamation and expression, the nucleotides sequence of purpose of design gene is classified as 113bp, and concrete sequence is:
5'---GCTA
GACGACGACGACAAG TAA
TCAG---3'，
Wherein, the part that square frame indicates is respectively XhoI and KpnI restriction enzyme site; The part of underscore mark is enteropeptidase recognition sequence; TAA is terminator codon; Black matrix sloping portion is pVIP
mgene order;
In order to obtain described goal gene, design and synthesis three primers P1, P2 and P3, be specially:
P1:5'---GCTA
GACGACGACGACAAGTTTACCGCAAATTATACCCGTCT---3'；
P2:5'---CTGA
TTAACGACGACCCAGAATTGCTGCCAGATAACGACGAAC---3'；
P3:5'---CCAGATAACGACGAACTGCCAGCTGACGACGCAGACGGGTATAATTTG---3'；
Wherein, square frame in described primer sequence P1 and primer sequence P2 represents XhoI and KpnI restriction enzyme site respectively, and primer amplification length is 113bp, after pcr amplification, agarose gel electrophoresis and order-checking qualification are carried out to the goal gene obtained, successful clone pig VIP improved peptide gene is described;
The structure of step 2, pig VIP improved peptide expression of recombinant e. coli carrier and qualification:
The pig VIP improved peptide gene obtain amplification and pET32a (+) carry out double digestion respectively simultaneously, then pig VIP improved peptide gene is connected with pET32a (+), to be building up on expression vector, the recombinant plasmid codified TrxA-pVIP of acquisition
mfusion rotein; Same conversion DH5a competent cell, picking list bacterium colony is identified through order-checking after cultivating, and the expression vector establishment success of pig VIP improved peptide is described;
Step 3, pig VIP improved peptide are to the conversion of competent escherichia coli cell and abduction delivering:
By described recombinant plasmid pET32-pVIP
mtransformed E .coliBL21 (DE3) competent cell, obtains pET32-pVIP
m/ BL21 (DE3) recombinant bacterium; Recombinant bacterium being inoculated in ammonia benzyl content is cultivate in the LB substratum of 100 μ g/mL, obtains bacterium liquid, carry out expression amount detection to bacterium liquid after abduction delivering;
The purifying of step 4, fusion rotein:
Use the fusion rotein in the ultrasonic supernatant of Ni-NTA affinitive layer purification, wash-out is carried out successively with the PBS damping fluid containing different concns imidazoles, collect elutriant, with Sephadex G25, gained fusion rotein purified to Ni-NTA and carry out desalination, use super filter tube to concentrate product, the fusion rotein TrxA-pVIP after purifying can be obtained
m;
The release of step 5, pig VIP improved peptide:
With manually-injected enterokinase cleavage site point cleavage of fusion proteins TrxA-pVIP
m, remove carrier protein, release target antibacterial peptide; By the fusion rotein pVIP of purified concentration in step 4
mcarry out enzyme with enteropeptidase to cut, namely successfully discharge recombinant expressed pVIP
m.
Further, the PCR reaction system of the pig VIP improved peptide gene in step 1 is: ddH
2o 20 μ L, 10 × Buffer are containing Mg
2+5 μ L, dNTP 2.5mM 4 μ L, primer P15 μM 10 μ L, primer P25 μM 0.5 μ L, primer P35 μM 10 μ L, pfu 0.5 μ L; PCR reaction conditions is as follows: 94 DEG C of denaturation 5min; 94 DEG C of 30s, 60 DEG C of 40s, 72 DEG C of 1min carry out 30 circulations; 72 DEG C extend 5min; 4 DEG C of preservations.
Further, in step 2, the construction process of pig VIP improved peptide expression of recombinant e. coli carrier is: with double digestion connection method construction recombination plasmid pET32-pVIP
mtime, the ratio being 3:1 in foreign gene and plasmid mole ratio mixes, and reaction system is 10uL, and 16 DEG C are spent the night.
Further, the method transforming DH5a competent cell in step 2 is: join in competent cell by the connection product of 10 μ L, ice bath 30min; 42 DEG C of water-bath 60s, are quickly moved in ice-water bath and place 2min, add 500uL LB, and 37 DEG C of 180rpm cultivate 1h; Get part bacterium liquid and coat LB flat board, described LB flat board is the ammonia benzyl of 100 μ g/mL containing concentration; Be inverted cultivation 12 ~ 16h, observe single bacterium colony for 37 DEG C, if having positive colony bacterium and identify through order-checking, the expression vector establishment success of pig VIP improved peptide is described.
Further, the preparation method connecting product is: will connect damping fluid 1 μ L, sterilized water 2 μ L, T4 ligase enzyme 1 μ L, tap rubber after double digestion the pET32 plasmid 2 μ L reclaimed, after the PCR primer 4 μ L mixing of recovery of tapping rubber after double digestion, 16 DEG C of reaction 16h, obtain connecting product.
Further, in step 3, the concrete grammar of abduction delivering is, recombinant bacterium being inoculated in ammonia benzyl content is in the LB substratum of 100 μ g/mL, 16 ~ 24h is cultivated in 37 DEG C of 180rpm, it is in the LB substratum of 100 μ g/mL that inoculum size by 1% is transferred in fresh ammonia benzyl content, and 37 DEG C of 180rpm shaking culture are to OD
600when about 0.6, add the IPTG of final concentration 0.4mM, induction 4h, obtains bacterium liquid.
Further, in step 3 to the concrete grammar that bacterium liquid expression amount detects be: by abduction delivering bacterium liquid 14000 ~ 15000rpm 4 DEG C of centrifugal 10min, abandon supernatant, in thalline, add the sodium phosphate buffer of 5mL pH 8.0, resuspended, ultrasonication in ice bath; 4 DEG C, the centrifugal 15min of 14000 ~ 15000r pm, collects ultrasonic supernatant liquor; Get and a certain amount ofly add corresponding sample-loading buffer and boil, 15%SDS-PAGE is used to detect protein expression situation, and measure total protein content in ultrasonic supernatant by Bradford method, use Quantity One to scan SDS-PAGE gel, calculate the content that target protein accounts for total protein.
Further, in step 4 PBS damping fluid consist of 20mM PBS, 0.5M NaCl, 10% glycerine and 0.1% tween 20, the imidazole concentration of described PBS damping fluid is respectively 20mM, 40mM, 100mM, 200mM or 500mM.
Further, in step 5, enteropeptidase endonuclease reaction system is: 10 × recombination ox intestine kinase reaction buffer 5 μ L, fusion rotein TrxA-pVIP
m40 μ L, recombination ox intestine kinase (0.5U) 0.5 μ L, ddH
2o 4.5 μ L, total reaction system is 50 μ L, after 25 DEG C of reaction 16 ~ 24h.
The invention has the beneficial effects as follows, the production technique of pig VIP improved peptide is simple, and production cost is low, and the strong and has a broad antifungal spectrum of bacteriostasis, has market outlook.
Accompanying drawing explanation
Fig. 1 .1 to Fig. 1 .4 is the primary bioactivity figure of pig VIP improved peptide of the present invention; Wherein, Fig. 1 .1 is the anti-microbial activity figure to E. coli ATCC25922, Fig. 1 .2 hemolytic activity figure that to be the anti-microbial activity figure to streptococcus aureus S.aureus ATCC 25923, Fig. 1 .3 be to Rat Erythrocytes, Fig. 1 .4 are the effect diagram to 3T3-L1 PECTORAL LIMB SKELETON propagation;
Fig. 2 is pET32-pVIP of the present invention
mexpression figure in BL21 (DE3); Wherein, M. albumen marker, 1. whole bacterial protein before induction, 2. whole bacterial protein after induction 4h;
Fig. 3 is BL21-pET32-EK-pVIP of the present invention
mthe electrophorogram of the fusion rotein of Expression and purification; Wherein, M. albumen marker, the target protein 1. after purifying;
Fig. 4 is the electrophorogram that enteropeptidase enzyme of the present invention cuts fusion rotein; Wherein, the fusion rotein before M. albumen marker, 1.EK cutting, the albumen after 2.EK cutting;
Fig. 5 is Recombinant Swine VIP improved peptide of the present invention to the bacteriostatic activity of intestinal bacteria ATCC 25922 and streptococcus aureus; Wherein, 1. sterilized water, 2. enteropeptidase enzyme cutting buffering liquid, 3. ammonia benzyl, concentration is: 2 μMs, 4. chemosynthesis pig VIP improved peptide pVIPm, and concentration is 2 μMs, 5. recombinant expressed pig VIP improved peptide, and concentration is 2 μMs;
Fig. 6 is the recombinant expression plasmid collection of illustrative plates of the pig VIP improved peptide that the present invention builds.
Embodiment
Below in conjunction with the drawings and specific embodiments, the present invention is described in detail.
The invention provides a boar VIP improved peptide pVIP
m, pig VIP improved peptide is following aminoacid sequence: FTANYTRLRRQLAVRRYLAAILGRR.
" pVIP herein
m", refer to the molecular improvement carried out for template with the native peptides VIP in pig source, p is the initial of porcine, and m is the initial of modification, therefore, by pig VIP improved peptide called after pVIP
m.
Present invention also offers the expression method of VIP improved peptide in intestinal bacteria of a kind of above-mentioned pig, implement according to following steps:
The clone of the gene of step 1, pig VIP improved peptide:
According to the structure activity relationship of antibacterial peptide and in conjunction with the constructional feature of VIP, by deleting partial amino-acid and to amino acid whose replacement, the aminoacid sequence of the VIP in GeneBank is improved, obtains the aminoacid sequence of pig VIP improved peptide after improvement: FTANYTRLRRQLAVRRYLAAILGRR;
According to e. coli codon Preference, the nucleotides sequence being obtained pig VIP improved peptide by the aminoacid sequence derivation of pig VIP improved peptide is classified as:
TTTACCGCAAATTATACCCGTCTGCGTCGTCAGCTGGCAGTTCGTCGTTATCTGGCAGCAATTCTGGGTCGTCGT；
For avoiding improved peptide to the toxicity of e. coli host bacteria, TrxA and pVIPm is carried out amalgamation and expression.For by the gene clone of pig VIP improved peptide to pET32a (+) carrier, expressed fusion protein TrxA-pVIP
m, design following goal gene: add terminator codon TAA at pVIPm nucleotide sequence 3 ' end, with the addition of enteropeptidase recognition sequence DDDDK at 5 ' end; Use XhoI and KpnI restriction enzyme to build restructuring pET32a (+) plasmid, devise the sequence identical with pET32a (+) XhoI with KpnI site respectively at pVIPm nucleotide sequence two ends, be convenient to homologous recombination;
The nucleotides sequence of above-mentioned purpose gene is classified as 113bp, and concrete sequence is:
5'---GCTA
GACGACGACGACAAG TAA
TCAG---3'，
Wherein, the part that square frame indicates is respectively XhoI and KpnI restriction enzyme site; The part of underscore mark is enteropeptidase recognition sequence; TAA is terminator codon; Black matrix sloping portion is pVIP
mgene order;
In order to obtain above-mentioned purpose gene, design and synthesis three primers P1, P2 and P3, square frame in primer sequence P1 and primer sequence P2 represents XhoI and KpnI restriction enzyme site respectively, primer amplification length is 113bp, after pcr amplification, agarose gel electrophoresis and order-checking qualification are carried out to the goal gene obtained, successful clone pig VIP improved peptide gene is described;
Wherein, primer is specially:
P1:5'---GCTA
GACGACGACGACAAGTTTACCGCAAATTATACCCGTCT---3'；
P2:5'---CTGA
TTAACGACGACCCAGAATTGCTGCCAGATAACGACGAAC---3'；
P3:5'---CCAGATAACGACGAACTGCCAGCTGACGACGCAGACGGGTATAATTTG---3'；
Wherein, the PCR reaction system of pig VIP improved peptide gene is: ddH
2o 20 μ L, 10 × Buffer are containing Mg
2+5 μ L, dNTP 2.5mM 4 μ L, primer P1 5 μM of 10 μ L, primer P2 5 μM of 0.5 μ L, primer P35 μM of 10 μ L, pfu 0.5 μ L; PCR reaction conditions is as follows: 94 DEG C of denaturation 5min; 94 DEG C of 30s, 60 DEG C of 40s, 72 DEG C of 1min carry out 30 circulations; 72 DEG C extend 5min; 4 DEG C of preservations, use 1.5% agarose gel electrophoresis qualification PCR primer.
The structure of step 2, pig VIP improved peptide expression of recombinant e. coli carrier and qualification:
The pig VIP improved peptide gene obtain amplification and pET32a (+) carry out double digestion respectively simultaneously, then pig VIP improved peptide gene is connected with pET32a (+), to be building up on expression vector, the recombinant plasmid codified TrxA-pVIP of acquisition
mfusion rotein; Use double digestion connection method construction recombination plasmid pET32-pVIP
mtime, the ratio being 3:1 in foreign gene and plasmid mole ratio mixes, and reaction system is 10uL, and 16 DEG C are spent the night; Same conversion DH5a competent cell, picking list bacterium colony is identified through order-checking after cultivating, and the expression vector establishment success of the VIP improved peptide of pig is described.
Wherein, the method transforming DH5a competent cell is as follows: join in competent cell by the connection product of 10 μ L, ice bath 30min; 42 DEG C of water-bath 60s, are quickly moved in ice-water bath and place 2min, add 500uLLB, and 37 DEG C of 180rpm cultivate 1h; Get part bacterium liquid and coat LB flat board, described LB flat board is the ammonia benzyl of 100 μ g/mL containing concentration; Be inverted cultivation 12 ~ 16h, observe single bacterium colony for 37 DEG C, if having positive colony bacterium and identify through order-checking, the expression vector establishment success of pig VIP improved peptide is described.
Wherein, the preparation method of above-mentioned connection product is: will connect damping fluid 1 μ L, sterilized water 2 μ L, T4 ligase enzyme 1 μ L, tap rubber after double digestion the pET32 plasmid 2 μ L reclaimed, after the PCR primer 4 μ L mixing of recovery of tapping rubber after double digestion, 16 DEG C of reaction 16h, obtain connecting product.
Step 3, pig VIP improved peptide are to the conversion of competent escherichia coli cell and abduction delivering: transformation of E. coli competent cell: by described recombinant plasmid pET32-pVIP
mtransformed E .coliBL21 (DE3) competent cell, obtains pET32-pVIP
m/ BL21 (DE3) recombinant bacterium;
Recombinant bacterium clone is inoculated in (containing 100 μ g/mL ammonia benzyls) 37 DEG C of 180rpm incubated overnight in 15mL LB substratum, and the inoculum size by 1% is inoculated in (containing 100 μ g/mL ammonia benzyls) in 50mL fresh LB respectively, works as OD
600when reaching about 0.6, add IPTG (final concentration 0.4mM) abduction delivering, induction 4h, obtains bacterium liquid;
Then the centrifugal 1min of 1mL sample 8000rpm is got to bacterium liquid and collect thalline.In got thalline, add the resuspended thalline of sodium phosphate buffer 40 μ L of pH8.0, and add 10 μ L 5 × sample-loading buffers mixings and boil 10min, 14000rpm 4 DEG C of centrifugal 10min, obtain whole bacterial protein sample.Meanwhile, collect the thalline in 50mL bacterium liquid, add the sodium phosphate buffer of 5mL pH 8.0, ultrasonication in ice bath.Ultrasound condition: working hour 5s, intermittent time 5s, power 400W, working hour 20min, 4 DEG C of centrifugal 15min of 14000r pm, collect supernatant liquor, add corresponding sample-loading buffer and boil and be soluble proteins sample.5mL same buffer is added in precipitation, thoroughly resuspended, add corresponding sample-loading buffer and boil for inclusion body sample.Use 15%SDS-PAGE to detect protein expression situation, and measure total protein content in ultrasonic supernatant by Bradford method, use Quantity One to scan SDS-PAGE gel, calculate the content that target protein accounts for total protein.
The purifying of step 4, fusion rotein:
Inoculation BL21-pET32-EK-pVIP
mto 10mL LB incubated overnight, transfer next day 1% to 500mLLB.When OD600 is 0.6, the IPTG that final concentration is 0.4mM is used to induce 4h.Collected by centrifugation thalline, adds 25mL A liquid and carries out ultrasonication, 15000rpm 4 DEG C of centrifugal 30min, collects supernatant.Use the fusion rotein in the ultrasonic supernatant of Ni-NTA affinitive layer purification, elution buffer is respectively the A liquid containing different concns imidazoles, then with Sephadex G25, gained fusion rotein purified to Ni-NTA and carry out desalination, use super filter tube (MWCO 10kDa, Merck) product is concentrated, the fusion rotein TrxA-pVIP after purifying can be obtained
m, with 15%SDS-PAGE, purified product is detected.
Wherein, PBS damping fluid consist of 20mM PBS, 0.5M NaCl, 10% glycerine and 0.1% tween 20; The imidazole concentration of described PBS damping fluid is respectively 20mM, 40mM, 100mM, 200mM or 500mM; Ultrasound condition is: ultrasonic 5s, interval 5s, ultrasonic 100 times.
The release of step 5, pig VIP improved peptide:
For obtaining pig VIP improved peptide pVIP
m, need with manually-injected enterokinase cleavage site point cleavage of fusion proteins TrxA-pVIP
m, remove carrier protein, release target antibacterial peptide; By the fusion rotein pVIP of purified concentration in step 4
mcarry out enzyme with enteropeptidase to cut, can successfully discharge recombinant expressed pVIP
m;
Wherein, enteropeptidase endonuclease reaction system is: 10 × recombination ox intestine kinase reaction buffer 5 μ L, fusion rotein TrxA-pVIP
m40 μ L, recombination ox intestine kinase (0.5U) 0.5 μ L, ddH
2o 4.5 μ L, total reaction system is 50 μ L, and after 25 DEG C of reaction 16 ~ 24h, Tricine-SDS-PAGE observes enzyme and cuts effect, and by Bactericidal test to recombinant expressed pig VIP improved peptide pVIP
mactivity identify.
Embodiment 1
The anti-microbial activity of pig VIP improved peptide detects and method for evaluating safety:
Natural animal antibiotic peptide is a kind of neu-roimmunomodulation peptide, and structure is simply clear and definite, have various biological activity, and activity is little, has potentiality to be exploited; But its anti-microbial activity is relatively low, for this, by molecular improvement, while being intended to improve its anti-microbial activity, guarantee that it has no side effect and stronger stability.
First tested by minimal inhibitory concentration, have detected pig VIP and improved peptide pVIP thereof
mto the anti-microbial activity of intestinal bacteria ATCC25922, streptococcus aureus ATCC25923 and E.coli K88, have detected VIP and pVIP of different concns on this basis
mmolten its on the hemolytic activity of SD Rat Erythrocytes and on the impact of 3T3-L1 PECTORAL LIMB SKELETON propagation to evaluate its security, and then have studied pH value (pH4 ~ 10), the ionic strength (MgCl of NaCl and 50mM of 180mM
2) to VIP and pVIP
mthe impact of anti-microbial activity, result, as shown in accompanying drawing 1.1 to 1.4, shows pVIP
ma kind ofly there is stronger anti-microbial activity, no cytotoxicity and hemolytic activity and there is the desirable antibacterial peptide of stronger anti-pH value and ionic strength stability.
Embodiment 2
The preparation method of pig VIP improved peptide:
(1) synthesis of pig VIP improved peptide gene:
The pig VIP improved peptide of screening is prepared by engineered method, to improve its applicability.
According to the aminoacid sequence of pig source VIP in GeneBank, constitutional features and physico-chemical property, and antibacterial peptide plays the architecture basics of anti-microbial activity, improves it.Aminoacid sequence before and after improvement is as follows:
Before improvement: HSDAVFTDNYTRLRKQMAVKKYLNSILN,
After improvement: FTANYTRLRRQLAVRRYLAAILGRR,
For avoiding pig VIP improved peptide of the present invention to the toxicity of e. coli host bacteria, TrxA and improvement antibacterial peptide VIP are carried out amalgamation and expression, hold at the nucleotide sequence 3 ' of the similar peptide of antibacterial peptide VIP and add terminator codon TAA, 5 ' end with the addition of enteropeptidase recognition sequence DDDDK, so that fusion rotein is cut by EK, discharge and there is the VIP improved peptide of N end without additional amino acid; Use XhoI and KpnI restriction enzyme construction recombination plasmid, devise the sequence identical with pET32a (+) XhoI with KpnI site respectively at gene two ends, be convenient to double digestion; New nucleotides sequence is classified as 113bp:
GCTA
GACGACGACGACAAG TAA
TCAG
In above-mentioned sequence: square frame display is respectively XhoI and KpnI restriction enzyme site; Underscore is designated EK recognition sequence; Blueness is shown as terminator codon; Black matrix sloping portion is the gene order of pig VIP improved peptide.
In order to obtain above-mentioned purpose gene, thus, design and synthesis 3 primers P1, P2 and P3,
P1:5'---GCTA
GACGACGACGACAAGTTTACCGCAAATTATACCCGTCT---3'；
P2:5'---CTGA
TTAACGACGACCCAGAATTGCTGCCAGATAACGACGAAC---3'；
P3:5'---CCAGATAACGACGAACTGCCAGCTGACGACGCAGACGGGTATAATTTG---3'；
Wherein, square frame in described primer sequence P1 and primer sequence P2 represents XhoI and KpnI restriction enzyme site respectively, and primer amplification length is 113bp, after pcr amplification, agarose gel electrophoresis and order-checking qualification are carried out to the goal gene obtained, successful clone pig VIP improved peptide gene is described.
The PCR reaction system of this pig VIP improved peptide gene is: ddH
2o 20 μ L, 10 × Buffer are containing Mg
2+5 μ L, dNTP 2.5mM 4 μ L, primer P15 μM 10 μ L, primer P25 μM 0.5 μ L, primer P35 μM 10 μ L, pfu 0.5 μ L.PCR reaction conditions is as follows: 94 DEG C of denaturation 5min; 94 DEG C of 30s, 60 DEG C of 40s, 72 DEG C of 1min carry out 30 circulations; 72 DEG C extend 5min; 4 DEG C of preservations.Use 1.5% agarose gel electrophoresis qualification PCR primer.
(2) structure of the expression of recombinant e. coli carrier of pig VIP improved peptide and qualification: the pig VIP improved peptide gene obtain amplification and pET32a (+) carry out double digestion respectively simultaneously, then pig VIP improved peptide gene is connected with pET32a (+), to be building up on expression vector, the recombinant plasmid codified TrxA-pVIP of acquisition
mfusion rotein.When using double digestion connection method construction recombination plasmid, the ratio being 3:1 in foreign gene and plasmid mole ratio mixes, reaction system is 10uL, 16 DEG C are spent the night, same conversion DH5a competent cell, method for transformation is as follows: join in competent cell by above-mentioned 10uL linked system, ice bath 30min; 42 DEG C of water-bath 60s, are quickly moved in ice-water bath and place 2min, add 500uL LB, 37 DEG C of 180rpm shaking culture 1h; Get part bacterium liquid and coat LB flat board (containing 100ug/mL ammonia benzyl); Be inverted cultivation 12 ~ 16h for 37 DEG C, single bacterium colony is had to grow, identify further by order-checking, result shows that the gene order of measurement result and design is completely the same, illustrate that VIP improved peptide recombinant expression vector successfully constructs, Fig. 6 is the recombinant expressed strategy of the pig VIP improved peptide that the present invention builds, and adopts the TrxA amalgamation and expression strategy of band His label, to avoid the toxicity to Host Strains, and be convenient to purifying.
(3) pig VIP improved peptide is to the conversion of competent escherichia coli cell and abduction delivering:
Recombinant bacterium is inoculated in a certain amount of containing in the LB substratum of ammonia benzyl (100 μ g/mL), 37 DEG C of 180rpm cultivate 16 ~ 24h, inoculum size by 1% is transferred in a certain amount of fresh in ammonia benzyl (100 μ g/mL) LB substratum, and 37 DEG C of 180rpm are cultured to OD
600when about 0.6, add the IPTG of final concentration 0.4mM, induction 4h.Get appropriate biomass and carry out SDS-PAGE, result as shown in Figure 2, illustrates this pig VIP improved peptide pVIP
min intestinal bacteria, obtained high expression fusion rotein TrxA-pVIP
mexpression amount be about 45.67mg/L, target peptide pVIP
mexpression amount be about 6.85mg/L, illustrate that it obtains high expression in intestinal bacteria.
(4) purifying of fusion rotein:
Use the fusion rotein in the ultrasonic supernatant of Ni-NTA affinitive layer purification, successively with containing different concns imidazoles (20mM, 40mM, 100mM, 200mM and 500mM) PBS damping fluid (consist of 20mMPBS, 0.5M NaCl, 10% glycerine, the tween 20 of 0.1%) carry out wash-out, collect elutriant, be the fusion rotein TrxA-pVIP after purifying
m, result as shown in Figure 3, illustrates by this purification process, comparatively effectively can remove foreigh protein removing.
(5) release of recombinant expressed pig VIP improved peptide:
For obtaining pig VIP improved peptide pVIP
m, need with manually-injected enterokinase cleavage site point cleavage of fusion proteins TrxA-pVIP
m, remove carrier protein, release target antibacterial peptide; By the fusion rotein pVIP of purified concentration in step 4
mcarry out enzyme with enteropeptidase to cut, enteropeptidase endonuclease reaction system is: 10 × recombination ox intestine kinase reaction buffer 5 μ L, fusion rotein TrxA-pVIP
m40 μ L, recombination ox intestine kinase (0.5U) 0.5 μ L, ddH
2o 4.5 μ L, total reaction system is 50 μ L, after 25 DEG C of reaction 16 ~ 24h, Tricine-SDS-PAGE observes enzyme and cuts effect, Tricine-SDS-PAGE observes enzyme and cuts effect, and result as shown in Figure 4, illustrates that the release strategy of the pig VIP improved peptide that this invention adopts is effective, enzyme cuts entirely, and successfully discharges amalgamation and expression label TrxA and recombinant expressed pig VIP improved peptide.
Embodiment 3
The detection of the anti-microbial activity of recombinant expressed pig VIP improved peptide:
Use Odontothrips loti to detect the anti-microbial activity of recombinant expressed pig VIP improved peptide, cultivate intestinal bacteria ATCC 25922 and streptococcus aureus ATCC25923 to OD
600be about 0.5, the MHB substratum 100mL of preparation containing 1.5% agar, is cooled to about 50 DEG C to add above-mentioned bacterium liquid 1mL by the MH substratum of sterilizing, a kind of rhyme scheme in Chinese operas serving as the prelude to a complete score for voices after mixing.After culture medium solidifying, vertically put Oxford cup in media surface, and add testing sample in the cup of Oxford, cultivate 24h for 37 DEG C.Observe the size of inhibition zone, sample anti-microbial activity is higher, concentration is higher, then inhibition zone is larger.Detected result as shown in Figure 5, illustrates that pig VIP improved peptide prepared by the method recombinant expressed in intestinal bacteria that the present invention adopts all has stronger anti-microbial activity to Gram-negative bacteria intestinal bacteria and gram-positive microorganism streptococcus aureus.
According to the sterilization feature of common antibacterial peptide, antibacterial mechanisms and structure activity relationship thereof, with the natural VIP in pig source for masterplate, according to its physicochemical property, a kind of novel VIP improved peptide aminoacid sequence of designed, designed, and its anti-microbial activity, safety and stability are evaluated.On this basis, select intestinal bacteria preference codon, use gene SOEing (SOE-PCR) amplification gene, be cloned in expression in escherichia coli, obtain the expression of recombinant e. coli bacterial strain of the novel similar peptide of antibacterial peptide VIP, and fermentation-scale is amplified to fermentation tank level, realize pVIP
mthe high density fermentation of product and high expression.The antibiotic preparation such as pulvis, liquid is made after fermented liquid is further purified.Genetically engineered recombinant antibacterial peptide preparation can be used as additive for farm animal feed or the veterinary drug prevention and therapy for livestock and poultry.Solve that existing peptide antibacterial activity is not enough and antimicrobial spectrum is wide, and existing production technology flow process complexity, problem that production cost is high.
Claims (10)
1. a boar VIP improved peptide, is characterized in that, described pig VIP improved peptide is following aminoacid sequence: FTANYTRLRRQLAVRRYLAAILGRR.
2. the expression method of VIP improved peptide in intestinal bacteria of a boar as claimed in claim 1, is characterized in that, implement according to following steps:
The clone of the gene of step 1, pig VIP improved peptide:
According to e. coli codon Preference, the nucleotides sequence being obtained pig VIP improved peptide by the aminoacid sequence derivation of pig VIP improved peptide is classified as:
TTTACCGCAAATTATACCCGTCTGCGTCGTCAGCTGGCAGTTCGTCGTTATCTGGCAGCAATTCTGGGTCGTCGT；
For avoiding improved peptide to the toxicity of e. coli host bacteria, by TrxA and pVIP
mcarry out amalgamation and expression, the nucleotides sequence of purpose of design gene is classified as 113bp, and concrete sequence is:
5'---GCTA
GACGACGACGACAAGTTTACCGCAAATTATACCCGTCTGCGTCGTCAGCTGGCAGTTCGTCGTTATCTGGCAGCAATTCTGGGTCGTCGTTAA
TCAG---3'，
Wherein, the part that square frame indicates is respectively XhoI and KpnI restriction enzyme site; The part of underscore mark is enteropeptidase recognition sequence; TAA is terminator codon; Black matrix sloping portion is pVIP
mgene order;
In order to obtain described goal gene, design and synthesis three primers P1, P2 and P3, be specially:
P1:5'---GCTA
GACGACGACGACAAGTTTACCGCAAATTATACCCGTCT---3'；
P2:5'---CTGA
TTAACGACGACCCAGAATTGCTGCCAGATAACGACGAAC---3'；
P3:5'---CCAGATAACGACGAACTGCCAGCTGACGACGCAGACGGGTATAATTTG---3'；
Wherein, square frame in described primer sequence P1 and primer sequence P2 represents XhoI and KpnI restriction enzyme site respectively, and primer amplification length is 113bp, after pcr amplification, agarose gel electrophoresis and order-checking qualification are carried out to the goal gene obtained, successful clone pig VIP improved peptide gene is described;
The structure of step 2, pig VIP improved peptide expression of recombinant e. coli carrier and qualification:
The pig VIP improved peptide gene obtain amplification and pET32a (+) carry out double digestion respectively simultaneously, then pig VIP improved peptide gene is connected with pET32a (+), to be building up on expression vector, the recombinant plasmid codified TrxA-pVIP of acquisition
mfusion rotein; Same conversion DH5a competent cell, picking list bacterium colony is identified through order-checking after cultivating, and the expression vector establishment success of pig VIP improved peptide is described;
Step 3, pig VIP improved peptide are to the conversion of competent escherichia coli cell and abduction delivering:
By described recombinant plasmid pET32-pVIP
mtransformed E .coliBL21 (DE3) competent cell, obtains pET32-pVIP
m/ BL21 (DE3) recombinant bacterium; Recombinant bacterium being inoculated in ammonia benzyl content is cultivate in the LB substratum of 100 μ g/mL, obtains bacterium liquid, carry out restructuring pVIP to bacterium liquid after abduction delivering
mexpression amount detects;
The purifying of step 4, fusion rotein:
Use the fusion rotein in the ultrasonic supernatant of Ni-NTA affinitive layer purification, wash-out is carried out successively with the PBS damping fluid containing different concns imidazoles, collect elutriant, with Sephadex G25, gained fusion rotein purified to Ni-NTA and carry out desalination, use super filter tube to concentrate product, the fusion rotein TrxA-pVIP after purifying can be obtained
m;
The release of step 5, pig VIP improved peptide:
With manually-injected enterokinase cleavage site point cleavage of fusion proteins TrxA-pVIP
m, remove carrier protein, release target antibacterial peptide; By the fusion rotein pVIP of purified concentration in step 4
mcarry out enzyme with enteropeptidase to cut, namely successfully discharge recombinant expressed pVIP
m.
3. the preparation method of a boar VIP improved peptide as claimed in claim 2, is characterized in that, the PCR reaction system of the pig VIP improved peptide gene in described step 1 is: ddH
2o 20 μ L, 10 × Buffer are containing Mg
2+5 μ L, dNTP 2.5mM 4 μ L, primer P1 5 μM of 10 μ L, primer P2 5 μM of 0.5 μ L, primer P3 5 μM of 10 μ L, pfu 0.5 μ L; PCR reaction conditions is as follows: 94 DEG C of denaturation 5min; 94 DEG C of 30s, 60 DEG C of 40s, 72 DEG C of 1min carry out 30 circulations; 72 DEG C extend 5min; 4 DEG C of preservations.
4. the preparation method of a boar VIP improved peptide as claimed in claim 2, is characterized in that, in described step 2, the construction process of pig VIP improved peptide expression of recombinant e. coli carrier is: with double digestion connection method construction recombination plasmid pET32-pVIP
mtime, the ratio being 3:1 in foreign gene and plasmid mole ratio mixes, and reaction system is 10uL, and 16 DEG C are spent the night.
5. the preparation method of the boar VIP improved peptide as described in claim 2 or 4, it is characterized in that, the method transforming DH5a competent cell in described step 2 is: join in competent cell by the connection product of 10 μ L, ice bath 30min; 42 DEG C of water-bath 60s, are quickly moved in ice-water bath and place 2min, add 500uLLB, and 37 DEG C of 180rpm cultivate 1h; Get part bacterium liquid and coat LB flat board, described LB flat board is the ammonia benzyl of 100 μ g/mL containing concentration; Be inverted cultivation 12 ~ 16h, observe single bacterium colony for 37 DEG C, if having positive colony bacterium and identify through order-checking, the expression vector establishment success of pig VIP improved peptide is described.
6. the preparation method of a boar VIP improved peptide as claimed in claim 5, it is characterized in that, the preparation method of described connection product is: will connect damping fluid 1 μ L, sterilized water 2 μ L, T4 ligase enzyme 1 μ L, tap rubber after double digestion the pET32 plasmid 2 μ L reclaimed, after the PCR primer 4 μ L mixing of recovery of tapping rubber after double digestion, 16 DEG C of reaction 16h, obtain connecting product.
7. the preparation method of a boar VIP improved peptide as claimed in claim 2, it is characterized in that, in described step 3, the concrete grammar of abduction delivering is, recombinant bacterium being inoculated in ammonia benzyl content is in the LB substratum of 100 μ g/mL, 16 ~ 24h is cultivated in 37 DEG C of 180rpm, it is in the LB substratum of 100 μ g/mL that inoculum size by 1% is transferred in fresh ammonia benzyl content, and 37 DEG C of 180rpm shaking culture are to OD
600when about 0.6, add the IPTG of final concentration 0.4mM, induction 4h, obtains bacterium liquid.
8. the preparation method of a boar VIP improved peptide as claimed in claim 2, it is characterized in that, in described step 3 to the concrete grammar that bacterium liquid expression amount detects be: by abduction delivering bacterium liquid 14000 ~ 15000rpm 4 DEG C of centrifugal 10min, abandon supernatant, the sodium phosphate buffer of 5mL pH 8.0 is added in thalline, resuspended, ultrasonication in ice bath; 4 DEG C, the centrifugal 15min of 14000 ~ 15000r pm, collects ultrasonic supernatant liquor; Get and a certain amount ofly add corresponding sample-loading buffer and boil, 15%SDS-PAGE is used to detect protein expression situation, and measure total protein content in ultrasonic supernatant by Bradford method, use Quantity One to scan SDS-PAGE gel, calculate the content that target protein accounts for total protein.
9. the preparation method of a boar VIP improved peptide as claimed in claim 2, it is characterized in that, in described step 4, PBS damping fluid consists of 20mM PBS, 0.5M NaCl, 10% glycerine and 0.1% tween 20, the imidazole concentration of described PBS damping fluid is respectively 20mM, 40mM, 100mM, 200mM or 500mM.
10. the preparation method of a boar VIP improved peptide as claimed in claim 2, it is characterized in that, in described step 5, enteropeptidase endonuclease reaction system is: 10 × recombination ox intestine kinase reaction buffer 5 μ L, fusion rotein TrxA-pVIP
m40 μ L, recombination ox intestine kinase (0.5U) 0.5 μ L, ddH
2o 4.5 μ L, total reaction system is 50 μ L, after 25 DEG C of reaction 16 ~ 24h.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510390108.0A CN105017409A (en) | 2015-07-06 | 2015-07-06 | Improved porcine VIP (vasoactive Intestinal peptide) and method for expressing porcine VIP in escherichia coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510390108.0A CN105017409A (en) | 2015-07-06 | 2015-07-06 | Improved porcine VIP (vasoactive Intestinal peptide) and method for expressing porcine VIP in escherichia coli |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN105017409A true CN105017409A (en) | 2015-11-04 |
Family
ID=54407753
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510390108.0A Pending CN105017409A (en) | 2015-07-06 | 2015-07-06 | Improved porcine VIP (vasoactive Intestinal peptide) and method for expressing porcine VIP in escherichia coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105017409A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110016456A (en) * | 2018-05-28 | 2019-07-16 | 西北工业大学 | Multi-functional compound micro-ecological preparation nanometer selenium-recombinant expression vasoactive intestinal peptide-Lactococcus lactis and preparation method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1487085A (en) * | 2003-08-08 | 2004-04-07 | 浙江大学 | Conotoxin MVII A and Trx fusion protein and its expression and application |
-
2015
- 2015-07-06 CN CN201510390108.0A patent/CN105017409A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1487085A (en) * | 2003-08-08 | 2004-04-07 | 浙江大学 | Conotoxin MVII A and Trx fusion protein and its expression and application |
Non-Patent Citations (1)
| Title |
|---|
| JENNY CS等: "Therapeutic efficacy of stable analogues of vasoactive intestinal peptide against pathogens", 《J BIOL CHEM》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110016456A (en) * | 2018-05-28 | 2019-07-16 | 西北工业大学 | Multi-functional compound micro-ecological preparation nanometer selenium-recombinant expression vasoactive intestinal peptide-Lactococcus lactis and preparation method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103436514B (en) | Heat-resistant lyase TSPpgh and polynucleotide coding same | |
| CN104611317B (en) | A kind of method for improving L-ASP secreting, expressing | |
| CN109593693B (en) | Escherichia coli Nissle 1917 anti-tumor targeting engineering bacterium and construction method and application thereof | |
| CN101705212A (en) | N-acylhomoserine lactonas, production method thereof and special recombinant bacterium | |
| CN104530215A (en) | Antibacterial peptide VIP (vasoactive intestinal peptide)-like peptide and preparation method thereof | |
| CN106967659A (en) | A kind of structure and fermentation process of the antibiotic-free resistance recombined bacillus subtilis for expressing glutamate decarboxylase | |
| CN103555756A (en) | Method for secretory expression of antibacterial peptide LfcinB by use of saccharomyces cerevisiae | |
| CN104962566A (en) | Recombinant bacteriocin and preparation method and application thereof | |
| CN106939315A (en) | A kind of preparation method and application of oxalate decarboxylase | |
| CN105861522A (en) | Antibacterial peptide Enterocin P and preparation method and application thereof | |
| CN107266585B (en) | A kind of MLH fusion antibacterial peptide and its preparation method and application | |
| CN105017409A (en) | Improved porcine VIP (vasoactive Intestinal peptide) and method for expressing porcine VIP in escherichia coli | |
| CN107266539A (en) | A kind of bacillus licheniformis W10 antibacterial proteins and application | |
| CN102604993B (en) | Immunologic adjuvant-Helicobacter pylori antigen fused protein oral vaccine and preparation method thereof | |
| CN102757973B (en) | cDNA sequence and amino acid sequence of lugworm fibrinolytic enzyme with thrombolysis activity | |
| CN103387992A (en) | Gene for coding recombinant porcine beta-defensin-1 and preparation method of porcine beta-defensin-1 | |
| CN102061303B (en) | Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product | |
| CN104195152A (en) | Calcineurin catalytic subunit gene and application thereof | |
| CN1366042A (en) | Process for preparing recombinant deoxyribonuclease I | |
| CN103103205A (en) | Gene for encoding recombinant porcine circovirus type 2 (PCV2) Cap protein and application of gene | |
| CN106011118A (en) | Fe<3+>-dependent food-grade acidic urease and application of same to yellow rice wine | |
| CN113832117B (en) | Enzyme for degrading oxytetracycline, and coding gene and application thereof | |
| CN110478480A (en) | Sore mouth virus F1L vaccine based on ferritin nano particle and preparation method thereof | |
| CN102093998A (en) | Preparation method of antibacterial peptide cecropin feed additive | |
| CN106011153A (en) | Probiotic antimicrobial peptide Enterocin P, and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20151104 |