CN105002213A - Unconformable deletable novel non-viral vector, and construction method and use thereof - Google Patents
Unconformable deletable novel non-viral vector, and construction method and use thereof Download PDFInfo
- Publication number
- CN105002213A CN105002213A CN201410166521.4A CN201410166521A CN105002213A CN 105002213 A CN105002213 A CN 105002213A CN 201410166521 A CN201410166521 A CN 201410166521A CN 105002213 A CN105002213 A CN 105002213A
- Authority
- CN
- China
- Prior art keywords
- sequence
- mar
- loxp
- cre
- pecg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention relates to an unconformable deletable novel non-viral vector, and a construction method and a use thereof. The non-viral vector includes an S/MAR sequence, an SV40 replication origin and a Cre-ERT2 expression sequence, the upstream and the downstream of the S/MAR sequence respectively have a loxP sequence, and one of the loxP sequences is positioned between the S/MAR sequence and the SV40 replication origin. The non-viral vector is free from genome, stably inherits with the cell cycle, does not express viral proteins, can be deleted from cells through induction of Tamoxifen at a proper time, is highly safe, and is in favor of promoting early application of an induced pluripotent stem cell technology and a transdifferentiation technology in clinic treatment.
Description
[technical field]
The present invention relates to a kind of non-virus carrier of biological field, specifically, relate to a kind of unconformability and can delete non-virus carrier and construction process thereof and purposes.
[background technology]
Nowadays, transgenic technology, not merely for scientific research, has also been widely used in social production life.After induction versatile stem cell technology and transdifferentiation technological invention, it has been inexorable trend that transgenic technology is widely used in clinical.It is exactly security that present transgenic technology is used for one of them clinical obstacle: first, and foreign gene radom insertion, on genome, exists and causes the potential risk such as transgenation, gene silencing; Secondly, external source goal gene cannot be removed in time, and particularly when goal gene has into knurl effect, this is breakneck; Finally, some carriers need to express viral protein, and some viral proteins itself have carcinogenesis, and have higher immunogenicity, are very limited in clinical application.
After transgenic technology occurs, investigator does unremitting effort to the raising of the security of transgene carrier always.First be the appearance of the carrier of a class based on SV40, BPV, EBV virus.This kind of carrier achieves and carries out copying heredity with episomal form in eukaryotic cell, thus solves a difficult problem for vector gene radom insertion in host cell gene group.But the copying of this kind of carrier all needs the trans-acting factor of expressing viral source, and this proteinoid meeting transfaunation cell, such as: the carrier based on SV40 virus copies, need to express large T antigen (other albumen are provided by host cell), and large T antigen energy immortalization primary cell, when being applied to animal, oncogenic generation will be led.
1999, H.J.Lipps laboratory finds the S/MAR element of human origin to instead of SV40 large T antigen gene, and retain the replication origin (origin) of SV40, the carrier pEPI-1 built still can copy heredity with episomal form in Chinese hamster ovary celI, and when there is no resistance screening, 100 generations more than can be retained in Chinese hamster ovary celI.S/MAR sequence derives from mankind's interferon-β gene 5 ' end support adhesion district, and this kind of region is typical A/T enriched sequence, plays an important role in maintenance chromosome structure.PEPI-1 have passed through and repeatedly improves, and all concentrates on and simplifies sequence and reduce on CpG original paper, thus improves transfection efficiency and the expression efficiency of carrier, as pEPito.H.J.Lipps laboratory and Anthony Atala induced in versatile stem cell in experimentation on animals and the mankind respectively afterwards, demonstrated the feasibility based on S/MAR-SV40-Origin serial carrier.
As unconformable non-virus carrier, S/MAR-SV40-Origin carrier has improve very large security, but still there is hidden danger.In order to improve expression efficiency and transformation efficiency in inducing somatic reprogrammed process, usually can use strong promoter, and be applied to the clinical reprogrammed cell that needs and again break up, it is that we do not want to see that early stage foreign gene is broken up in the expression at this moment continued.
In sum, also need badly and build a kind of safer transfection carrier, to promote that induction versatile stem cell technology and transdifferentiation technology are applied to clinical treatment early.
[summary of the invention]
The object of the invention is for deficiency of the prior art, provide a kind of unconformability can delete novel non-virus carrier.
Of the present invention again one object be that a kind of construction process of non-virus carrier as above is provided.
Another object of the present invention provides the purposes of non-virus carrier as above.
For achieving the above object, the technical scheme that the present invention takes is:
A kind of unconformability non-virus carrier, described non-virus carrier comprises S/MAR sequence, SV40 replication origin and Cre-ERT2 expressed sequence, the upstream and downstream of described S/MAR sequence has a loxP sequence respectively, two loxP directions are identical, and one of them loxP sequence is between S/MAR sequence and SV40 replication origin.
Described non-virus carrier also comprises external source goal gene, preferably EGFP.
Described S/MAR sequence, Cre-ERT2 expressed sequence and external source goal gene share promotor and terminator, and described promotor is preferably the promotor of eukaryotic expression.
Described Cre-ERT2 expressed sequence is connected with external source goal gene IRES sequence.
A LoxP sequence connects in described promotor upstream, and another loxP sequence connects in the downstream of S/MAR sequence.
Described S/MAR sequence is as shown in SEQ ID NO.6, the sequence of described SV40 replication origin is as shown in SEQ ID NO.4, described Cre-ERT2 expressed sequence is as shown in SEQ ID NO.2, described loxP sequence and SEQ ID NO.8 have 85%-100% similarity, and preferred LoxP sequence is as shown in SEQ ID NO.8.
Described non-virus carrier builds by the following method:
A) from the pEP4-Cre-EGFP plasmid of sequence as shown in SEQ ID NO.1, Cre-ERT2-IRES-EGFP fragment is cloned,
B) Cre-ERT2-IRES-EGFP fragment is inserted the CMV Promoter downstream of pcDNA3.1 (-) plasmid, obtains pcDNA-Cre-EGFP plasmid,
C) pECG plasmid is obtained with the CMV Promoter that EF1 α Promoter replaces in pcDNA-Cre-EGFP,
D) S/MAR fragment is inserted in pECG carrier, obtains pECG-S/MAR plasmid,
E) primer shown in SEQ ID NO.18 and SEQ ID NO.19 is utilized with pECG-S/MAR plasmid for template clones Afl II-LoxP fragment,
F) by pECG-S/MAR plasmid and Afl II-LoxP fragment Afl II and Xma I double digestion, pECG-S/MAR carrier and Afl II-LoxP-XmaI fragment is obtained respectively,
G) Afl II-LoxP-Xma I fragment is inserted in pECG-S/MAR carrier, obtains pECG-S/MAR-Afl IILoxP plasmid,
H) hold with the EF1 α promoter 5 ' that another loxP to be inserted into pECG-S/MAR-Afl IILoxP plasmid by the method same with step g), obtain pECG-S/MAR-LoxP.
Described non-virus carrier also has drug selectable marker gene and/or real-time riddled basins.
For realizing above-mentioned second object, the technical scheme that the present invention takes is:
A kind of construction process of non-virus carrier as above, comprise the following steps: S/MAR sequence, SV40 replication origin, Cre-ERT2 expressed sequence are implemented in skeleton carrier, and respectively insert a loxP sequence in the upstream and downstream of described S/MAR sequence, ensure that one of them loxP sequence is between S/MAR sequence and SV40 replication origin simultaneously.
For realizing above-mentioned 3rd object, the technical scheme that the present invention takes is:
As above the purposes of arbitrary described non-virus carrier, enters host cell for mediating external source goal gene and expresses in host cell.
In the present invention, described " sequence ", " expressed sequence ", " element ", " gene ", " fragment " can exchange use; Described Cre-ERT2 and Cre recombinase-estrogen receptor T2, described Cre-ERT2 expressed sequence, gene, element or sequence are all the polynucleotide sequence of expressing Cre-ERT2; Described S/MAR sequence or element, be all the polynucleotide sequence of expressing S/MAR, it is human origin, share with SV40 replication origin, can ensure that carrier does not insert in genome and realize expressing and copying heredity.Every S/MAR sequence, SV40 replication origin realizing above-mentioned purpose includes within the scope of the invention.Described " loxP " (locus of X-over P1) sequence, derive from P1 phage, be jointly made up of two 13bp inverted repeats and midfeather 8bp sequence, the intervening sequence of 8bp also determines the direction of loxP simultaneously.LoxP sequence comprises sequence as shown in: ATAACTTCGTATA (13bp)-NNNTANNN (8bp)-TATACGAAGTTAT (13bp), and " N " represents any Nucleotide; Described loxP sequence also can comprise the sequence of the inverted repeats of an above-mentioned 13bp or the intervening sequence sudden change of 8bp, such as, in following table listed sequence:
Described Cre-ERT2 expressed sequence can express Cre-ERT2 albumen, after Tamoxifen process, Cre-ERT2 albumen can enter the restructuring of loxP sequence in the same way of core specificity induction S/MAR sequence both sides, S/MAR sequence is separated with SV40 replication origin, thus non-virus carrier of the present invention is lost copy Genetic Function.Described " upstream and downstream of S/MAR sequence has a loxP sequence respectively " refers to that two loxP sequences lay respectively at the upstream and downstream of S/MAR sequence, two loxP directions are identical, and two loxP sequences are not closely must be connected with the upstream and downstream sequence of S/MAR gene fragment, also other fragment can be comprised, as long as S/MAR sequence is separated with SV40 replication origin after ensureing two loxP sequence restructuring between itself and S/MAR sequence.The concrete nucleotide sequence of described S/MAR sequence, SV40 replication origin, Cre-ERT2 expressed sequence, loxP sequence is all not limited to embodiments of the invention, and preferably itself and the sequence shown in the embodiment of the present invention have the similarity of 85%-100% usually.For ensureing the transfection efficiency of the non-virus carrier built and taking into account the convenience of carrier construction, described S/MAR sequence, Cre-ERT2 expressed sequence and external source goal gene can share promotor and terminator, as shared EF1 α Promoter and BGH pA in the present invention, but obvious, three can have respective promotor and terminator respectively.Promotor used is preferably the promotor of eukaryotic expression, as EF1 α Promoter, ensures that it can start transcribing of coding region in most eukaryotes.Preferably, described Cre-ERT2 expressed sequence is positioned at external source goal gene upstream, and is provided with IRES sequence therebetween, IRES is ribosome binding sequence, so transcribing out is a RNA, what guarantee was expressed is Cre-ERT2 albumen and external source target protein, instead of fusion rotein.Described drug selectable marker gene can be Amp gene, kanamycin gene etc., and described real-time riddled basins is EGFP gene, GFP gene etc.Described " skeleton carrier " refers to primary expression carrier, and in expression vector establishment process, we select a carrier as skeleton carrier usually, plays the effect of basic framework, other object fragment is connected into successively in this skeleton carrier.Non-virus carrier of the present invention can be used for mediation external source goal gene and enters host cell and express in host cell, this purposes is preferably non-treatment object, carry external source object goal gene as utilized non-virus carrier of the present invention and enter host cell expression, but this way is not be directly used in medical diagnosis on disease or treatment, and for example non-virus carrier of the present invention is entered host cell and the product of expressing in host cell for the preparation of mediation external source goal gene.Described " external source goal gene " refers to the gene that can be used for expressing target protein, the albumen etc. such as can express real-time selection markers albumen, having an impact to target cell Physiology and biochemistry or genetic expression.
The invention has the advantages that:
Chromosome scaffold/the matrix in people source is glued district S/MAR sequence by the present invention, and Cre-ERT2 expressed sequence, LoxP sequence etc. are incorporated on carrier, this carrier can be free on outside genome, and along with cell cycle genetic stability, do not express viral protein, and the induction in due course by Tamoxifen is deleted from cell, and security is higher.Gene therapy is in the past mostly for genetic flaw, and it is more how to allow foreign gene express lastingly that investigator pays close attention to, and usually do not consider how to delete, the present invention compensate for the deficiency of this aspect.
As one embodiment of the present of invention, take pcDNA-3.1 as skeleton, overcome loxP sequence and easily form the difficulties such as hairpin structure when being inserted into carrier, the distance simultaneously between two loxP sequences arranges rationally, successfully constructs pECG-S/MAR-LoxP carrier.Under normal culture condition, due to the effect of S/MAR-SV40-origin, carrier can not insert in genome and realize expressing and copying heredity.And with after Tamoxifen process, Cre-ERT2 albumen can enter the restructuring of loxP sequence in the same way of core specificity induction S/MAR sequence both sides, S/MAR sequence is separated with SV40-origin, thus realizes whole carrier and delete in cell.Carrier has been transfected in HEK293 cell also successfully to obtain and has surely turned clone by we.Surely turn clone not have under resistance screening pressure condition can stably express GFP100 generation above and can freezing and thawing.Surely turn clone after Tamoxifen process, carrier has higher deletion efficiency, the 5th day GFP negative rate more than 50%.
Promotion induction versatile stem cell technology and transdifferentiation technology are applied to clinical treatment by safer transfection carrier that the present invention builds early.
[accompanying drawing explanation]
Fig. 1, pEP4 EO2S EN2K plasmid map.
Fig. 2, pEP4-Cre-EGFP plasmid map.
Fig. 3, pcDNA3.1 (-) plasmid map.
Fig. 4, pcDNA-Cre-EGFP plasmid map.
The pEP4-Cre-EGFP plasmid map of Fig. 5, display restriction enzyme site.
Fig. 6, pECG plasmid map.
Fig. 7, pECG, pECG-S/MAR, pECG-S/MAR-LOXP plasmid enzyme restriction is identified, 1,2,3 are respectively pECG-S/MAR-LOXP, pECG, pECG-S/MAR result after Hind III digestion.
Fig. 8, pECG-S/MAR plasmid map.
Fig. 9, pECG-S/MAR-LoxP plasmid map.
The transfection efficiency of Figure 10, pECG, pECG-S/MAR, pECG-S/MAR-LoxP transfection HEK293 and screening be after 2 weeks, the GFP positive rate of cell.Upper row is the transfection result of 48 hours, and lower row is screening 2 weeks rear results.
The change of the HEK293 cell of Figure 11, pECG-S/MAR-LoxP transfection GFP positive rate before frozen and after recovery.
After Figure 12, Tamoxifen process, the change to the 5th day GFP positive cell in second day.
[embodiment]
Below in conjunction with accompanying drawing, embodiment provided by the invention is elaborated.
embodiment 1
1, pEP4-Cre-EGFP plasmid is built
1) primer I RES-EGFP-S and IRES-EGFP-AS in subordinate list 1 is utilized, with LV-EF1 α-IRES-EGFP for template clones IRES-EGFP fragment.
The IRES-EGFP fragment that test kit reclaims PCR is reclaimed with PCR.
2) the IRES-EGFP fragment BamH I and the Asc I double digestion that will reclaim.
37 DEG C of insulations, enzyme cuts 6 hours.Reclaim test kit with PCR and reclaim endonuclease bamhi.
3) primer Cre-ERT2-S and Cre-ERT2-AS in subordinate list 1 is utilized, with Cre-ERT2 mouse mouse tail DNA for template clones Cre-ERT2 fragment.
The Cre-ERT2 fragment that test kit reclaims PCR is reclaimed with PCR.
4) by the Cre-ERT2 fragment HindIII of recovery and Asc I double digestion.
37 DEG C of insulations, enzyme cuts 6 hours.Reclaim test kit with PCR and reclaim endonuclease bamhi.
5) by pEP4 EO2S EN2K plasmid (plasmid map is shown in Fig. 1) Hind III and BamH I double digestion.
37 DEG C of insulations, enzyme cuts 6 hours.Reclaim digestion products pEP4 fragment (8510bp).
6) by above 2), 4), 5) endonuclease bamhi that obtains of step connects with T4 ligase enzyme.
After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion TBE180 competent cell, cultivate 14h for 37 DEG C, picking mono-clonal, extract plasmid pEP4-Cre-EGFP, and by digestion verification (pEP4-Cre-EGFP plasmid map is shown in Fig. 2, and plasmid sequence is as shown in SEQ ID NO.1).
, build pECG, pECG-S/MAR, pECG-S/MAR-loxP plasmid
1) primer Cre-EGFP-S and Cre-EGFP-AS in subordinate list 1 is utilized, with the pEP4-Cre-EGFP plasmid of above-mentioned structure for template clones Cre-ERT2-IRES-EGFP fragment (be finally connected into Cre-ERT2 fragment sequence as shown in SEQ ID NO.2) in carrier.
2) PCR is utilized to reclaim the Cre-ERT2-IRES-EGFP fragment of test kit recovery PCR.
3) by the 2nd) the Cre-ERT2-IRES-EGFP fragment that obtains of step is connected in pEASY-Blunt carrier (being purchased from Quan Shi King Company), obtains pEASY-Cre-EGFP plasmid.
After room temperature reaction 25mins, get 3 μ l and connect product conversion E.coli DH5 ɑ competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, sequence verification.
4) by pEASY-Cre-EGFP and pcDNA3.1 (-) plasmid, (plasmid map is shown in Fig. 3, plasmid sequence is as shown in SEQ ID NO.3, this plasmid carries SV40 origin, and SV40 origin sequence is as shown in SEQ ID NO.4) use Not I and Nhe I double digestion.
37 DEG C of insulations, enzyme cuts 6 hours.
37 DEG C of insulations, enzyme cuts 6 hours.
Reclaim digestion products Cre-ERT2-IRES-EGFP fragment and pcDNA3.1 (-) carrier.
5) Cre-ERT2-IRES-EGFP fragment is inserted in pcDNA3.1 (-) obtains pcDNA-Cre-EGFP plasmid (plasmid map is shown in Fig. 4).
After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion E.coli DH5 ɑ competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, and pass through digestion verification.
6) by pcDNA-Cre-EGFP Xba I and Mfe I double digestion, plasmid map pEP4-Cre-EGFP(being shown restriction enzyme site is shown in Fig. 5) obtain EF1 α Promoter fragment with Xba I and Mfe I double digestion.
37 DEG C of insulations, enzyme cuts 6 hours.
37 DEG C of insulations, enzyme cuts 6 hours.
Reclaim digestion products EF1 α Promoter fragment and pcDNA-Cre-EGFP carrier.
7) sequence of the EF1 α Promoter of carrier is finally connected into EF1 α Promoter(as shown in SEQ ID NO.5) the CMV Promoter replaced in pcDNA-Cre-EGFP obtains pECG(plasmid map and sees Fig. 6).
After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion TBE180 competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, and by digestion verification, enzyme is cut and be the results are shown in Figure 7.
8) primer S/MAR-AS1 and S/MAR-Ps in subordinate list 1 is utilized, with 293T cell genomic dna for template clones S/MAR fragment.
PCR is utilized to reclaim the S/MAR fragment of test kit recovery PCR.
9) by pECG and S/MAR fragment EcoR I and Not I double digestion, pECG carrier and S/MAR fragment (being wherein finally connected into the sequence of the S/MAR fragment in carrier as shown in SEQ ID NO.6) is obtained respectively.
37 DEG C of insulations, enzyme cuts 6 hours.
37 DEG C of insulations, enzyme cuts 6 hours.
Reclaim digestion products pECG carrier and S/MAR fragment.
10) S/MAR fragment is inserted in pECG carrier, obtains pECG-S/MAR plasmid (plasmid map is shown in Fig. 8).
After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion TB4180 competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, and by digestion verification, enzyme is cut and be the results are shown in Figure 7.
11) utilizing primer Afl II-LoxP and Neo-BX-AS in subordinate list 1, is that template clones Afl II-LoxP fragment with pECG-S/MAR.
PCR is utilized to reclaim the Afl II-LoxP fragment of test kit recovery PCR.
12) by pECG-S/MAR plasmid and Afl II-LoxP fragment Afl II and Xma I double digestion, (Afl II-LoxP-XmaI fragment sequence is as shown in SEQ ID NO.7 to obtain pECG-S/MAR carrier and Afl II-LoxP-XmaI fragment respectively, wherein 6-39 position Nucleotide is LoxP sequence: ataacttcgtatagcatacattatacgaagttat, is designated as SEQ ID NO.8).
37 DEG C of insulations, enzyme cuts 6 hours.
37 DEG C of insulations, enzyme cuts 6 hours.
Reclaim digestion products pECG-S/MAR carrier and Afl II-LoxP-Xma I fragment.
13) Afl II-LoxP-Xma I fragment is inserted in pECG-S/MAR carrier, obtains pECG-S/MAR-Afl IILoxP plasmid.
After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion TB4180 competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, and pass through digestion verification.
14) to use the same method another loxP(herein containing the sequence of loxP fragment as shown in SEQ ID NO.9, wherein 6-39 position Nucleotide is LoxP sequence: ataacttcgtatagcatacattatacgaagttat) the EF1 α promoter 5 ' that is inserted into pECG-S/MAR-Afl IILoxP plasmid holds, obtain pECG-S/MAR-LoxP(plasmid map and see Fig. 9), and cut and sequence verification by enzyme, enzyme is cut and be the results are shown in Figure 7.
, carrier such as screening pECG-S/MAR-LoxP etc. surely turns clone
1) appropriate HEK293 cell is spread in 6-well-dish at day before transfection.
2) when cell density reaches 80%, with FuGen-HD, pECG-S/MAR-LoxP is forwarded in HEK293 cell, and with pECG and pECG-S/MAR in contrast.
3) at transfection 48 h before harvest cell, get part cell, with flow cytomery transfection efficiency (Figure 10), find that S/MAR and loxP is not very large on the impact of plasmid transfection efficiency.
4) remaining cell starts with the Screening of Media containing 500 μ g/ml G418.
5) GFP positive cell (Figure 10) is again detected with flow cytometer in screening after two weeks, at this moment find that the expression level of GFP positive cell GFP reaches unanimity, the GFP positive rate of the cell of transfection pECG-S/MAR and pECG-S/MAR-LOXP is respectively 31.8% and 23.8%, higher than transfection not containing the positive rate 15.1% of the cell of the pECG of S/MAR sequence.
6) in screening after three weeks, collecting cell, goes out the cell mass of the GFP positive with selected by flow cytometry apoptosis.Sorting obtains about 3 × 10
5individual cell, continues to cultivate in containing the substratum of 500 μ g/ml G418.
, pECG-S/MAR-LoxP surely turns the frozen of clone and recovery
1) get a 10cm culture dish covered with, peptic cell, by cell harvesting in 15ml centrifuge tube.
2) centrifugal 5 minutes of 1000rpm, abandons supernatant liquor.
3) add 8ml PBS, Eddy diffusion cell, keep sample and detect GFP positive rate, repeat the 2nd step.
4) 1.5ml substratum Eddy diffusion cell is added.
5) 2x frozen storing liquid is prepared: get 0.3ml DMSO and be dissolved in 1.2ml FBS.
6) 2x frozen storing liquid is slowly added in cell suspending liquid, mix gently.DMSO final concentration is 10%.
7) 3ml mixed solution is dispensed in 3 cryopreservation tubes, often pipe 1ml.
8) cryopreservation tube is put into freezing storing box, put people's-80 DEG C of refrigerators.
9) recovery cell after 1 month.
10) get a frozen cell, melt rapidly in 37 DEG C of water-baths.
11) cell suspending liquid is transferred in 15ml centrifuge tube, is diluted in 10ml nutrient solution.
12) centrifugal 5 minutes of 1000rpm, abandons supernatant liquor.
13) with 5ml nutrient solution Eddy diffusion cell, be transferred in 10cm culture dish, subsidy substratum.
14) second day, abandon supernatant, add fresh culture.
15) the 3rd day, passage, and the detection GFP positive rate that keeps sample.There is the positive rate of 96.3% before cell cryopreservation, still have 93.1%GFP positive rate after recovery, see Figure 11.
, check the deletion efficiency of carrier pECG-S/MAR-LoxP in cell under Tamoxifen process
1) 5 × 10 are spread
4the GFP positive cell in individual every hole, in 24-well-dish, is used not containing the base culture base of G418.
2) Tamoxifen is dissolved in dehydrated alcohol in advance, is mixed with the solution of 2mg/ml.Join in substratum with the ratio of 1:1000, make final concentration be 2 μ g/ml.
3), after 6 hours, discard supernatant, add fresh culture.
After 48 hours, every 24 hr collections cell detection GFP positive rates once, continuous detecting 4 days (Figure 12).From figure, we can see, the cell of pECG-S/MAR-LoxP transfection offset from the GFP positive to feminine gender gradually and finally becomes GFP negative cells from second day, and this phenomenon is not observed in two other control group.
Subordinate list 1 primer sequence
The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the prerequisite not departing from the inventive method; can also make some improvement and supplement, these improve and supplement and also should be considered as protection scope of the present invention.
SEQUENCE LISTING
<110> Institut Pasteur of Shanghai, Chinese Academy of Sciences
<120> unconformability can delete novel non-virus carrier and construction process thereof and purposes
<130> /
<160> 19
<170> PatentIn version 3.3
<210> 1
<211> 11840
<212> DNA
<213> artificial sequence
<400> 1
gctagcggct ccggtgcccg tcagtgggca gagcgcacat cgcccacagt ccccgagaag 60
ttggggggag gggtcggcaa ttgaaccggt gcctagagaa ggtggcgcgg ggtaaactgg 120
gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata 180
agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggta 240
agtgccgtgt gtggttcccg cgggcctggc ctctttacgg gttatggccc ttgcgtgcct 300
tgaattactt ccacctggct ccagtacgtg attcttgatc ccgagctgga gccaggggcg 360
ggccttgcgc tttaggagcc ccttcgcctc gtgcttgagt tgaggcctgg cctgggcgct 420
ggggccgccg cgtgcgaatc tggtggcacc ttcgcgcctg tctcgctgct ttcgataagt 480
ctctagccat ttaaaatttt tgatgacctg ctgcgacgct ttttttctgg caagatagtc 540
ttgtaaatgc gggccaggat ctgcacactg gtatttcggt ttttgggccc gcggccggcg 600
acggggcccg tgcgtcccag cgcacatgtt cggcgaggcg gggcctgcga gcgcggccac 660
cgagaatcgg acgggggtag tctcaagctg gccggcctgc tctggtgcct ggcctcgcgc 720
cgccgtgtat cgccccgccc tgggcggcaa ggctggcccg gtcggcacca gttgcgtgag 780
cggaaagatg gccgcttccc ggccctgctc cagggggctc aaaatggagg acgcggcgct 840
cgggagagcg ggcgggtgag tcacccacac aaaggaaaag ggcctttccg tcctcagccg 900
tcgcttcatg tgactccacg gagtaccggg cgccgtccag gcacctcgat tagttctgga 960
gcttttggag tacgtcgtct ttaggttggg gggaggggtt ttatgcgatg gagtttcccc 1020
acactgagtg ggtggagact gaagttaggc cagcttggca cttgatgtaa ttctcgttgg 1080
aatttgccct ttttgagttt ggatcttggt tcattctcaa gcctcagaca gtggttcaaa 1140
gtttttttct tccatttcag gtgtcgtgaa cacgtggtcg cggccaattc tgcagtcgag 1200
ctcaagcttc ctgcaggccg ccaccatgtc caatttactg accgtacacc aaaatttgcc 1260
tgcattaccg gtcgatgcaa cgagtgatga ggttcgcaag aacctgatgg acatgttcag 1320
ggatcgccag gcgttttctg agcatacctg gaaaatgctt ctgtccgttt gccggtcgtg 1380
ggcggcatgg tgcaagttga ataaccggaa atggtttccc gcagaacctg aagatgttcg 1440
cgattatctt ctatatcttc aggcgcgcgg tctggcagta aaaactatcc agcaacattt 1500
gggccagcta aacatgcttc atcgtcggtc cgggctgcca cgaccaagtg acagcaatgc 1560
tgtttcactg gttatgcggc ggatccgaaa agaaaacgtt gatgccggtg aacgtgcaaa 1620
acaggctcta gcgttcgaac gcactgattt cgaccaggtt cgttcactca tggaaaatag 1680
cgatcgctgc caggatatac gtaatctggc atttctgggg attgcttata acaccctgtt 1740
acgtatagcc gaaattgcca ggatcagggt taaagatatc tcacgtactg acggtgggag 1800
aatgttaatc catattggca gaacgaaaac gctggttagc accgcaggtg tagagaaggc 1860
acttagcctg ggggtaacta aactggtcga gcgatggatt tccgtctctg gtgtagctga 1920
tgatccgaat aactacctgt tttgccgggt cagaaaaaat ggtgttgccg cgccatctgc 1980
caccagccag ctatcaactc gcgccctgga agggattttt gaagcaactc atcgattgat 2040
ttacggcgct aaggatgact ctggtcagag atacctggcc tggtctggac acagtgcccg 2100
tgtcggagcc gcgcgagata tggcccgcgc tggagtttca ataccggaga tcatgcaagc 2160
tggtggctgg accaatgtaa atattgtcat gaactatatc cgtaacctgg atagtgaaac 2220
aggggcaatg gtgcgcctgc tggaagatgg cgatctcgag ccatctgctg gagacatgag 2280
agctgccaac ctttggccaa gcccgctcat gatcaaacgc tctaagaaga acagcctggc 2340
cttgtccctg acggccgacc agatggtcag tgccttgttg gatgctgagc cccccatact 2400
ctattccgag tatgatccta ccagaccctt cagtgaagct tcgatgatgg gcttactgac 2460
caacctggca gacagggagc tggttcacat gatcaactgg gcgaagaggg tgccaggctt 2520
tgtggatttg accctccatg atcaggtcca ccttctagaa tgtgcctggc tagagatcct 2580
gatgattggt ctcgtctggc gctccatgga gcacccagtg aagctactgt ttgctcctaa 2640
cttgctcttg gacaggaacc agggaaaatg tgtagagggc atggtggaga tcttcgacat 2700
gctgctggct acatcatctc ggttccgcat gatgaatctg cagggagagg agtttgtgtg 2760
cctcaaatct attattttgc ttaattctgg agtgtacaca tttctgtcca gcaccctgaa 2820
gtctctggaa gagaaggacc atatccaccg agtcctggac aagatcacag acactttgat 2880
ccacctgatg gccaaggcag gcctgaccct gcagcagcag caccagcggc tggcccagct 2940
cctcctcatc ctctcccaca tcaggcacat gagtaacaaa ggcatggagc atctgtacag 3000
catgaagtgc aagaacgtgg tgcccctcta tgacctgctg ctggaggcgg cggacgccca 3060
ccgcctacat gcgcccacta gccgtggagg ggcatccgtg gaggagacgg accaaagcca 3120
cttggccact gcgggctcta cttcatcgca ttccttgcaa aagtattaca tcacggggga 3180
ggcagagggt ttccctgcca cagcttgagg cgcgcccctc tccctccccc ccccctaacg 3240
ttactggccg aagccgcttg gaataaggcc ggtgtgcgtt tgtctatatg ttattttcca 3300
ccatattgcc gtcttttggc aatgtgaggg cccggaaacc tggccctgtc ttcttgacga 3360
gcattcctag gggtctttcc cctctcgcca aaggaatgca aggtctgttg aatgtcgtga 3420
aggaagcagt tcctctggaa gcttcttgaa gacaaacaac gtctgtagcg accctttgca 3480
ggcagcggaa ccccccacct ggcgacaggt gcctctgcgg ccaaaagcca cgtgtataag 3540
atacacctgc aaaggcggca caaccccagt gccacgttgt gagttggata gttgtggaaa 3600
gagtcaaatg gctctcctca agcgtattca acaaggggct gaaggatgcc cagaaggtac 3660
cccattgtat gggatctgat ctggggcctc ggtacacatg ctttacatgt gtttagtcga 3720
ggttaaaaaa acgtctaggc cccccgaacc acggggacgt ggttttcctt tgaaaaacac 3780
gatgataata tggccacaac ccatggtgag caagggcgag gagctgttca ccggggtggt 3840
gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga 3900
gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa 3960
gctgcccgtg ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag 4020
ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta 4080
cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt 4140
gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga 4200
ggacggcaac atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat 4260
catggccgac aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga 4320
ggacggcagc gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc 4380
cgtgctgctg cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa 4440
cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg 4500
catggacgag ctgtacaagt aagtcgacgg atccgatcca gacatgataa gatacattga 4560
tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa tgctttattt gtgaaatttg 4620
tgatgctatt gctttatttg taaccattat aagctgcaat aaacaagtta acaacaacaa 4680
ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg gaggtttttt aaagcaagta 4740
aaacctctac aaatgtggta tggctgatta tgatccggct gcctcgcgcg tttcggtgat 4800
gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg tctgtaagcg 4860
gatgccggga gcagacaagc ccgtcaggcg tcagcgggtg ttggcgggtg tcggggcgca 4920
gccatgaggt cgatcgactc tagctagagg atcgatgccc cgccccggac gaactaaacc 4980
tgactacgac atctctgccc cttcttcgcg gggcagtgca tgtaatccct tcagttggtt 5040
ggtacaactt gccaactggg ccctgttcca catgtgacac ggggggggac caaacacaaa 5100
ggggttctct gactgtagtt gacatcctta taaatggatg tgcacatttg ccaacactga 5160
gtggctttca tcctggagca gactttgcag tctgtggact gcaacacaac attgccttta 5220
tgtgtaactc ttggctgaag ctcttacacc aatgctgggg gacatgtacc tcccaggggc 5280
ccaggaagac tacgggaggc tacaccaacg tcaatcagag gggcctgtgt agctaccgat 5340
aagcggaccc tcaagagggc attagcaata gtgtttataa ggcccccttg ttaaccctaa 5400
acgggtagca tatgcttccc gggtagtagt atatactatc cagactaacc ctaattcaat 5460
agcatatgtt acccaacggg aagcatatgc tatcgaatta gggttagtaa aagggtccta 5520
aggaacagcg atatctccca ccccatgagc tgtcacggtt ttatttacat ggggtcagga 5580
ttccacgagg gtagtgaacc attttagtca caagggcagt ggctgaagat caaggagcgg 5640
gcagtgaact ctcctgaatc ttcgcctgct tcttcattct ccttcgttta gctaatagaa 5700
taactgctga gttgtgaaca gtaaggtgta tgtgaggtgc tcgaaaacaa ggtttcaggt 5760
gacgccccca gaataaaatt tggacggggg gttcagtggt ggcattgtgc tatgacacca 5820
atataaccct cacaaacccc ttgggcaata aatactagtg taggaatgaa acattctgaa 5880
tatctttaac aatagaaatc catggggtgg ggacaagccg taaagactgg atgtccatct 5940
cacacgaatt tatggctatg ggcaacacat aatcctagtg caatatgata ctggggttat 6000
taagatgtgt cccaggcagg gaccaagaca ggtgaaccat gttgttacac tctatttgta 6060
acaaggggaa agagagtgga cgccgacagc agcggactcc actggttgtc tctaacaccc 6120
ccgaaaatta aacggggctc cacgccaatg gggcccataa acaaagacaa gtggccactc 6180
ttttttttga aattgtggag tgggggcacg cgtcagcccc cacacgccgc cctgcggttt 6240
tggactgtaa aataagggtg taataacttg gctgattgta accccgctaa ccactgcggt 6300
caaaccactt gcccacaaaa ccactaatgg caccccgggg aatacctgca taagtaggtg 6360
ggcgggccaa gataggggcg cgattgctgc gatctggagg acaaattaca cacacttgcg 6420
cctgagcgcc aagcacaggg ttgttggtcc tcatattcac gaggtcgctg agagcacggt 6480
gggctaatgt tgccatgggt agcatatact acccaaatat ctggatagca tatgctatcc 6540
taatctatat ctgggtagca taggctatcc taatctatat ctgggtagca tatgctatcc 6600
taatctatat ctgggtagta tatgctatcc taatttatat ctgggtagca taggctatcc 6660
taatctatat ctgggtagca tatgctatcc taatctatat ctgggtagta tatgctatcc 6720
taatctgtat ccgggtagca tatgctatcc taatagagat tagggtagta tatgctatcc 6780
taatttatat ctgggtagca tatactaccc aaatatctgg atagcatatg ctatcctaat 6840
ctatatctgg gtagcatatg ctatcctaat ctatatctgg gtagcatagg ctatcctaat 6900
ctatatctgg gtagcatatg ctatcctaat ctatatctgg gtagtatatg ctatcctaat 6960
ttatatctgg gtagcatagg ctatcctaat ctatatctgg gtagcatatg ctatcctaat 7020
ctatatctgg gtagtatatg ctatcctaat ctgtatccgg gtagcatatg ctatcctcat 7080
gcatatacag tcagcatatg atacccagta gtagagtggg agtgctatcc tttgcatatg 7140
ccgccacctc ccaagggggc gtgaattttc gctgcttgtc cttttcctgc tggttgctcc 7200
cattcttagg tgaatttaag gaggccaggc taaagccgtc gcatgtctga ttgctcgaat 7260
tcaccaggta aatgtcgcta atgttttcca acgcgagaag gtgttgagcg cggagctgag 7320
tgacgtgaca acatgggtat gcccaattgc cccatgttgg gaggacgaaa atggtgacaa 7380
gacagatggc cagaaataca ccaacagcac gcatgatgtc tactggggat ttattcttta 7440
gtgcggggga atacacggct tttaatacga ttgagggcgt ctcctaacaa gttacatcac 7500
tcctgccctt cctcaccctc atctccatca cctccttcat ctccgtcatc tccgtcatca 7560
ccctccgcgg cagccccttc caccataggt ggaaaccagg gaggcaaatc tactccatcg 7620
tcaaagctgc acacagtcac cctgatattg caggtaggag cgggctttgt cataacaagg 7680
tccttaatcg catccttcaa aacctcagca aatatatgag tttgtaaaaa gaccatgaaa 7740
taacagacaa tggactccct tagcgggcca ggttgtgggc cgggtccagg ggccattcca 7800
aaggggagac gactcaatgg tgtaagacga cattgtggaa tagcaagggc agttcctcgc 7860
cttaggttgt aaagggaggt cttactacct ccatatacga acacaccggc gacccaagtt 7920
ccttcgtcgg tagtcctttc tacgtgactc ctagccagga gagctcttaa accttctgca 7980
atgttctcaa atttcgggtt ggaacctcct tgaccacgat gctttccaaa ccaccctcct 8040
tttttgcgcc tgcctccatc accctgaccc cggggtccag tgcttgggcc ttctcctggg 8100
tcatctgcgg ggccctgctc tatcgctccc gggggcacgt caggctcacc atctgggcca 8160
ccttcttggt ggtattcaaa ataatcggct tcccctacag ggtggaaaaa tggccttcta 8220
cctggagggg gcctgcgcgg tggagacccg gatgatgatg actgactact gggactcctg 8280
ggcctctttt ctccacgtcc acgacctctc cccctggctc tttcacgact tccccccctg 8340
gctctttcac gtcctctacc ccggcggcct ccactacctc ctcgaccccg gcctccacta 8400
cctcctcgac cccggcctcc actgcctcct cgaccccggc ctccacctcc tgctcctgcc 8460
cctcctgctc ctgcccctcc tcctgctcct gcccctcctg cccctcctgc tcctgcccct 8520
cctgcccctc ctgctcctgc ccctcctgcc cctcctgctc ctgcccctcc tgcccctcct 8580
cctgctcctg cccctcctgc ccctcctcct gctcctgccc ctcctgcccc tcctgctcct 8640
gcccctcctg cccctcctgc tcctgcccct cctgcccctc ctgctcctgc ccctcctgct 8700
cctgcccctc ctgctcctgc ccctcctgct cctgcccctc ctgcccctcc tgcccctcct 8760
cctgctcctg cccctcctgc tcctgcccct cctgcccctc ctgcccctcc tgctcctgcc 8820
cctcctcctg ctcctgcccc tcctgcccct cctgcccctc ctcctgctcc tgcccctcct 8880
gcccctcctc ctgctcctgc ccctcctcct gctcctgccc ctcctgcccc tcctgcccct 8940
cctcctgctc ctgcccctcc tgcccctcct cctgctcctg cccctcctcc tgctcctgcc 9000
cctcctgccc ctcctgcccc tcctcctgct cctgcccctc ctcctgctcc tgcccctcct 9060
gcccctcctg cccctcctgc ccctcctcct gctcctgccc ctcctcctgc tcctgcccct 9120
cctgctcctg cccctcccgc tcctgctcct gctcctgttc caccgtgggt ccctttgcag 9180
ccaatgcaac ttggacgttt ttggggtctc cggacaccat ctctatgtct tggccctgat 9240
cctgagccgc ccggggctcc tggtcttccg cctcctcgtc ctcgtcctct tccccgtcct 9300
cgtccatggt tatcaccccc tcttctttga ggtccactgc cgccggagcc ttctggtcca 9360
gatgtgtctc ccttctctcc taggccattt ccaggtcctg tacctggccc ctcgtcagac 9420
atgattcaca ctaaaagaga tcaatagaca tctttattag acgacgctca gtgaatacag 9480
ggagtgcaga ctcctgcccc ctccaacagc ccccccaccc tcatcccctt catggtcgct 9540
gtcagacaga tccaggtctg aaaattcccc atcctccgaa ccatcctcgt cctcatcacc 9600
aattactcgc agcccggaaa actcccgctg aacatcctca agatttgcgt cctgagcctc 9660
aagccaggcc tcaaattcct cgtccccctt tttgctggac ggtagggatg gggattctcg 9720
ggacccctcc tcttcctctt caaggtcacc agacagagat gctactgggg caacggaaga 9780
aaagctgggt gcggcctgtg aggatcagct tatcgatgat aagctgtcaa acatgagaat 9840
taattcttga agacgaaagg gcctcgtgat acgcctattt ttataggtta atgtcatgat 9900
aataatggtt tcttagacgt caggtggcac ttttcgggga aatgtgcgcg gaacccctat 9960
ttgtttattt ttctaaatac attcaaatat gtatccgctc atgagacaat aaccctgata 10020
aatgcttcaa taatattgaa aaaggaagag tatgagtatt caacatttcc gtgtcgccct 10080
tattcccttt tttgcggcat tttgccttcc tgtttttgct cacccagaaa cgctggtgaa 10140
agtaaaagat gctgaagatc agttgggtgc acgagtgggt tacatcgaac tggatctcaa 10200
cagcggtaag atccttgaga gttttcgccc cgaagaacgt tttccaatga tgagcacttt 10260
taaagttctg ctatgtggcg cggtattatc ccgtgttgac gccgggcaag agcaactcgg 10320
tcgccgcata cactattctc agaatgactt ggttgagtac tcaccagtca cagaaaagca 10380
tcttacggat ggcatgacag taagagaatt atgcagtgct gccataacca tgagtgataa 10440
cactgcggcc aacttacttc tgacaacgat cggaggaccg aaggagctaa ccgctttttt 10500
gcacaacatg ggggatcatg taactcgcct tgatcgttgg gaaccggagc tgaatgaagc 10560
cataccaaac gacgagcgtg acaccacgat gcctgcagca atggcaacaa cgttgcgcaa 10620
actattaact ggcgaactac ttactctagc ttcccggcaa caattaatag actggatgga 10680
ggcggataaa gttgcaggac cacttctgcg ctcggccctt ccggctggct ggtttattgc 10740
tgataaatct ggagccggtg agcgtgggtc tcgcggtatc attgcagcac tggggccaga 10800
tggtaagccc tcccgtatcg tagttatcta cacgacgggg agtcaggcaa ctatggatga 10860
acgaaataga cagatcgctg agataggtgc ctcactgatt aagcattggt aactgtcaga 10920
ccaagtttac tcatatatac tttagattga tttaaaactt catttttaat ttaaaaggat 10980
ctaggtgaag atcctttttg ataatctcat gaccaaaatc ccttaacgtg agttttcgtt 11040
ccactgagcg tcagaccccg tagaaaagat caaaggatct tcttgagatc ctttttttct 11100
gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc 11160
ggatcaagag ctaccaactc tttttccgaa ggtaactggc ttcagcagag cgcagatacc 11220
aaatactgtc cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc 11280
gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg gcgataagtc 11340
gtgtcttacc gggttggact caagacgata gttaccggat aaggcgcagc ggtcgggctg 11400
aacggggggt tcgtgcacac agcccagctt ggagcgaacg acctacaccg aactgagata 11460
cctacagcgt gagctatgag aaagcgccac gcttcccgaa gggagaaagg cggacaggta 11520
tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg gagcttccag ggggaaacgc 11580
ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc gatttttgtg 11640
atgctcgtca ggggggcgga gcctatggaa aaacgccagc aacgcggcct ttttacggtt 11700
cctggccttt tgctggcctt gaagctgtcc ctgatggtcg tcatctacct gcctggacag 11760
catggcctgc aacgcgggca tcccgatgcc gccggaagcg agaagaatca taatggggaa 11820
ggccatccag cctcgcgtcg 11840
<210> 2
<211> 3313
<212> DNA
<213> artificial sequence
<400> 2
cctgcaggcc gccaccatgt ccaatttact gaccgtacac caaaatttgc ctgcattacc 60
ggtcgatgca acgagtgatg aggttcgcaa gaacctgatg gacatgttca gggatcgcca 120
ggcgttttct gagcatacct ggaaaatgct tctgtccgtt tgccggtcgt gggcggcatg 180
gtgcaagttg aataaccgga aatggtttcc cgcagaacct gaagatgttc gcgattatct 240
tctatatctt caggcgcgcg gtctggcagt aaaaactatc cagcaacatt tgggccagct 300
aaacatgctt catcgtcggt ccgggctgcc acgaccaagt gacagcaatg ctgtttcact 360
ggttatgcgg cggatccgaa aagaaaacgt tgatgccggt gaacgtgcaa aacaggctct 420
agcgttcgaa cgcactgatt tcgaccaggt tcgttcactc atggaaaata gcgatcgctg 480
ccaggatata cgtaatctgg catttctggg gattgcttat aacaccctgt tacgtatagc 540
cgaaattgcc aggatcaggg ttaaagatat ctcacgtact gacggtggga gaatgttaat 600
ccatattggc agaacgaaaa cgctggttag caccgcaggt gtagagaagg cacttagcct 660
gggggtaact aaactggtcg agcgatggat ttccgtctct ggtgtagctg atgatccgaa 720
taactacctg ttttgccggg tcagaaaaaa tggtgttgcc gcgccatctg ccaccagcca 780
gctatcaact cgcgccctgg aagggatttt tgaagcaact catcgattga tttacggcgc 840
taaggatgac tctggtcaga gatacctggc ctggtctgga cacagtgccc gtgtcggagc 900
cgcgcgagat atggcccgcg ctggagtttc aataccggag atcatgcaag ctggtggctg 960
gaccaatgta aatattgtca tgaactatat ccgtaacctg gatagtgaaa caggggcaat 1020
ggtgcgcctg ctggaagatg gcgatctcga gccatctgct ggagacatga gagctgccaa 1080
cctttggcca agcccgctca tgatcaaacg ctctaagaag aacagcctgg ccttgtccct 1140
gacggccgac cagatggtca gtgccttgtt ggatgctgag ccccccatac tctattccga 1200
gtatgatcct accagaccct tcagtgaagc ttcgatgatg ggcttactga ccaacctggc 1260
agacagggag ctggttcaca tgatcaactg ggcgaagagg gtgccaggct ttgtggattt 1320
gaccctccat gatcaggtcc accttctaga atgtgcctgg ctagagatcc tgatgattgg 1380
tctcgtctgg cgctccatgg agcacccagt gaagctactg tttgctccta acttgctctt 1440
ggacaggaac cagggaaaat gtgtagaggg catggtggag atcttcgaca tgctgctggc 1500
tacatcatct cggttccgca tgatgaatct gcagggagag gagtttgtgt gcctcaaatc 1560
tattattttg cttaattctg gagtgtacac atttctgtcc agcaccctga agtctctgga 1620
agagaaggac catatccacc gagtcctgga caagatcaca gacactttga tccacctgat 1680
ggccaaggca ggcctgaccc tgcagcagca gcaccagcgg ctggcccagc tcctcctcat 1740
cctctcccac atcaggcaca tgagtaacaa aggcatggag catctgtaca gcatgaagtg 1800
caagaacgtg gtgcccctct atgacctgct gctggaggcg gcggacgccc accgcctaca 1860
tgcgcccact agccgtggag gggcatccgt ggaggagacg gaccaaagcc acttggccac 1920
tgcgggctct acttcatcgc attccttgca aaagtattac atcacggggg aggcagaggg 1980
tttccctgcc acagcttgag gcgcgcccct ctccctcccc cccccctaac gttactggcc 2040
gaagccgctt ggaataaggc cggtgtgcgt ttgtctatat gttattttcc accatattgc 2100
cgtcttttgg caatgtgagg gcccggaaac ctggccctgt cttcttgacg agcattccta 2160
ggggtctttc ccctctcgcc aaaggaatgc aaggtctgtt gaatgtcgtg aaggaagcag 2220
ttcctctgga agcttcttga agacaaacaa cgtctgtagc gaccctttgc aggcagcgga 2280
accccccacc tggcgacagg tgcctctgcg gccaaaagcc acgtgtataa gatacacctg 2340
caaaggcggc acaaccccag tgccacgttg tgagttggat agttgtggaa agagtcaaat 2400
ggctctcctc aagcgtattc aacaaggggc tgaaggatgc ccagaaggta ccccattgta 2460
tgggatctga tctggggcct cggtacacat gctttacatg tgtttagtcg aggttaaaaa 2520
aacgtctagg ccccccgaac cacggggacg tggttttcct ttgaaaaaca cgatgataat 2580
atggccacaa cccatggtga gcaagggcga ggagctgttc accggggtgg tgcccatcct 2640
ggtcgagctg gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg 2700
cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt 2760
gccctggccc accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc 2820
cgaccacatg aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga 2880
gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg tgaagttcga 2940
gggcgacacc ctggtgaacc gcatcgagct gaagggcatc gacttcaagg aggacggcaa 3000
catcctgggg cacaagctgg agtacaacta caacagccac aacgtctata tcatggccga 3060
caagcagaag aacggcatca aggtgaactt caagatccgc cacaacatcg aggacggcag 3120
cgtgcagctc gccgaccact accagcagaa cacccccatc ggcgacggcc ccgtgctgct 3180
gcccgacaac cactacctga gcacccagtc cgccctgagc aaagacccca acgagaagcg 3240
cgatcacatg gtcctgctgg agttcgtgac cgccgccggg atcactctcg gcatggacga 3300
gctgtacaag taa 3313
<210> 3
<211> 5427
<212> DNA
<213> artificial sequence
<400> 3
gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gtttaaacgg gccctctaga ctcgagcggc cgccactgtg ctggatatct gcagaattcc 960
accacactgg actagtggat ccgagctcgg taccaagctt aagtttaaac cgctgatcag 1020
cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct 1080
tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc 1140
attgtctgag taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg 1200
aggattggga agacaatagc aggcatgctg gggatgcggt gggctctatg gcttctgagg 1260
cggaaagaac cagctggggc tctagggggt atccccacgc gccctgtagc ggcgcattaa 1320
gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc 1380
ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag 1440
ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca 1500
aaaaacttga ttagggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc 1560
gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa 1620
cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg atttcggcct 1680
attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattaattc tgtggaatgt 1740
gtgtcagtta gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat 1800
gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag 1860
tatgcaaagc atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat 1920
cccgccccta actccgccca gttccgccca ttctccgccc catggctgac taattttttt 1980
tatttatgca gaggccgagg ccgcctctgc ctctgagcta ttccagaagt agtgaggagg 2040
cttttttgga ggcctaggct tttgcaaaaa gctcccggga gcttgtatat ccattttcgg 2100
atctgatcaa gagacaggat gaggatcgtt tcgcatgatt gaacaagatg gattgcacgc 2160
aggttctccg gccgcttggg tggagaggct attcggctat gactgggcac aacagacaat 2220
cggctgctct gatgccgccg tgttccggct gtcagcgcag gggcgcccgg ttctttttgt 2280
caagaccgac ctgtccggtg ccctgaatga actgcaggac gaggcagcgc ggctatcgtg 2340
gctggccacg acgggcgttc cttgcgcagc tgtgctcgac gttgtcactg aagcgggaag 2400
ggactggctg ctattgggcg aagtgccggg gcaggatctc ctgtcatctc accttgctcc 2460
tgccgagaaa gtatccatca tggctgatgc aatgcggcgg ctgcatacgc ttgatccggc 2520
tacctgccca ttcgaccacc aagcgaaaca tcgcatcgag cgagcacgta ctcggatgga 2580
agccggtctt gtcgatcagg atgatctgga cgaagagcat caggggctcg cgccagccga 2640
actgttcgcc aggctcaagg cgcgcatgcc cgacggcgag gatctcgtcg tgacccatgg 2700
cgatgcctgc ttgccgaata tcatggtgga aaatggccgc ttttctggat tcatcgactg 2760
tggccggctg ggtgtggcgg accgctatca ggacatagcg ttggctaccc gtgatattgc 2820
tgaagagctt ggcggcgaat gggctgaccg cttcctcgtg ctttacggta tcgccgctcc 2880
cgattcgcag cgcatcgcct tctatcgcct tcttgacgag ttcttctgag cgggactctg 2940
gggttcgaaa tgaccgacca agcgacgccc aacctgccat cacgagattt cgattccacc 3000
gccgccttct atgaaaggtt gggcttcgga atcgttttcc gggacgccgg ctggatgatc 3060
ctccagcgcg gggatctcat gctggagttc ttcgcccacc ccaacttgtt tattgcagct 3120
tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc atttttttca 3180
ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctgtataccg 3240
tcgacctcta gctagagctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt 3300
tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt 3360
gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg 3420
ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg 3480
cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 3540
cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat 3600
aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 3660
gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc 3720
tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga 3780
agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt 3840
ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg 3900
taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 3960
gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg 4020
gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 4080
ttgaagtggt ggcctaacta cggctacact agaagaacag tatttggtat ctgcgctctg 4140
ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 4200
gctggtagcg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 4260
gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 4320
gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 4380
tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc 4440
ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga 4500
ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca 4560
atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc 4620
ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 4680
tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc 4740
attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt 4800
tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 4860
ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg 4920
gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 4980
gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 5040
gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga 5100
aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg 5160
taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg 5220
tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt 5280
tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc 5340
atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 5400
tttccccgaa aagtgccacc tgacgtc 5427
<210> 4
<211> 182
<212> DNA
<213> artificial sequence
<400> 4
cctaactccg cccatcccgc ccctaactcc gcccagttcc gcccattctc cgccccatgg 60
ctgactaatt ttttttattt atgcagaggc cgaggccgcc tctgcctctg agctattcca 120
gaagtagtga ggaggctttt ttggaggcct aggcttttgc aaaaagctcc cgggagcttg 180
ta 182
<210> 5
<211> 2476
<212> DNA
<213> artificial sequence
<400> 5
aattgaaccg gtgcctagag aaggtggcgc ggggtaaact gggaaagtga tgtcgtgtac 60
tggctccgcc tttttcccga gggtggggga gaaccgtata taagtgcagt agtcgccgtg 120
aacgttcttt ttcgcaacgg gtttgccgcc agaacacagg taagtgccgt gtgtggttcc 180
cgcgggcctg gcctctttac gggttatggc ccttgcgtgc cttgaattac ttccacctgg 240
ctccagtacg tgattcttga tcccgagctg gagccagggg cgggccttgc gctttaggag 300
ccccttcgcc tcgtgcttga gttgaggcct ggcctgggcg ctggggccgc cgcgtgcgaa 360
tctggtggca ccttcgcgcc tgtctcgctg ctttcgataa gtctctagcc atttaaaatt 420
tttgatgacc tgctgcgacg ctttttttct ggcaagatag tcttgtaaat gcgggccagg 480
atctgcacac tggtatttcg gtttttgggc ccgcggccgg cgacggggcc cgtgcgtccc 540
agcgcacatg ttcggcgagg cggggcctgc gagcgcggcc accgagaatc ggacgggggt 600
agtctcaagc tggccggcct gctctggtgc ctggcctcgc gccgccgtgt atcgccccgc 660
cctgggcggc aaggctggcc cggtcggcac cagttgcgtg agcggaaaga tggccgcttc 720
ccggccctgc tccagggggc tcaaaatgga ggacgcggcg ctcgggagag cgggcgggtg 780
agtcacccac acaaaggaaa agggcctttc cgtcctcagc cgtcgcttca tgtgactcca 840
cggagtaccg ggcgccgtcc aggcacctcg attagttctg gagcttttgg agtacgtcgt 900
ctttaggttg gggggagggg ttttatgcga tggagtttcc ccacactgag tgggtggaga 960
ctgaagttag gccagcttgg cacttgatgt aattctcgtt ggaatttgcc ctttttgagt 1020
ttggatcttg gttcattctc aagcctcaga cagtggttca aagttttttt cttccatttc 1080
aggtgtcgtg aacacgtggt cgcggccaat tctgcagtcg agctcaagct tcctgcaggc 1140
cgccaccatg tccaatttac tgaccgtaca ccaaaatttg cctgcattac cggtcgatgc 1200
aacgagtgat gaggttcgca agaacctgat ggacatgttc agggatcgcc aggcgttttc 1260
tgagcatacc tggaaaatgc ttctgtccgt ttgccggtcg tgggcggcat ggtgcaagtt 1320
gaataaccgg aaatggtttc ccgcagaacc tgaagatgtt cgcgattatc ttctatatct 1380
tcaggcgcgc ggtctggcag taaaaactat ccagcaacat ttgggccagc taaacatgct 1440
tcatcgtcgg tccgggctgc cacgaccaag tgacagcaat gctgtttcac tggttatgcg 1500
gcggatccga aaagaaaacg ttgatgccgg tgaacgtgca aaacaggctc tagcgttcga 1560
acgcactgat ttcgaccagg ttcgttcact catggaaaat agcgatcgct gccaggatat 1620
acgtaatctg gcatttctgg ggattgctta taacaccctg ttacgtatag ccgaaattgc 1680
caggatcagg gttaaagata tctcacgtac tgacggtggg agaatgttaa tccatattgg 1740
cagaacgaaa acgctggtta gcaccgcagg tgtagagaag gcacttagcc tgggggtaac 1800
taaactggtc gagcgatgga tttccgtctc tggtgtagct gatgatccga ataactacct 1860
gttttgccgg gtcagaaaaa atggtgttgc cgcgccatct gccaccagcc agctatcaac 1920
tcgcgccctg gaagggattt ttgaagcaac tcatcgattg atttacggcg ctaaggatga 1980
ctctggtcag agatacctgg cctggtctgg acacagtgcc cgtgtcggag ccgcgcgaga 2040
tatggcccgc gctggagttt caataccgga gatcatgcaa gctggtggct ggaccaatgt 2100
aaatattgtc atgaactata tccgtaacct ggatagtgaa acaggggcaa tggtgcgcct 2160
gctggaagat ggcgatctcg agccatctgc tggagacatg agagctgcca acctttggcc 2220
aagcccgctc atgatcaaac gctctaagaa gaacagcctg gccttgtccc tgacggccga 2280
ccagatggtc agtgccttgt tggatgctga gccccccata ctctattccg agtatgatcc 2340
taccagaccc ttcagtgaag cttcgatgat gggcttactg accaacctgg cagacaggga 2400
gctggttcac atgatcaact gggcgaagag ggtgccaggc tttgtggatt tgaccctcca 2460
tgatcaggtc cacctt 2476
<210> 6
<211> 1983
<212> DNA
<213> artificial sequence
<400> 6
agatctaaat aaacttataa attgtgagag aaattaatga atgtctaagt taatgcagaa 60
acggagagac atactatatt catgaactaa aagacttaat attgtgaagg tatactttct 120
ttccacataa atttgtagtc aatatgttca ccccaaaaaa gctgtttgtt aacttgccaa 180
cctcattcta aaatgtatat agaagcccaa aagacaataa caaaaatatt cttgtagaac 240
aaaatgggaa agaatgttcc actaaatatc aagatttaga gcaaagcatg agatgtgtgg 300
ggatagacag tgaggctgat aaaatagagt agagctcaga aacagaccca ttgatatatg 360
taagtgacct atgaaaaaaa tatggcattt tacaatggga aaatgatgat ctttttcttt 420
tttagaaaaa cagggaaata tatttatatg taaaaaataa aagggaaccc atatgtcata 480
ccatacacac aaaaaaattc cagtgaatta taagtctaaa tggagaaggc aaaactttaa 540
atcctttaga aaataatata gaagcatgcc atcatgactt cagtgtagag aaaaatttct 600
tatgactcaa agtcctaacc acaaagaaaa gattgttaat tagattgcat gaatattaag 660
acttattttt aaaattaaaa aaccattaag aaaagtcagg ccatagaatg acagaaaata 720
tttgcaacac cccagtaaag agaattgtaa tatgcagatt ataaaaagaa gtcttacaaa 780
tcagtaaaaa ataaaactag acaaaaattt gaacagatga aagagaaact ctaaataatc 840
attacacatg agaaactcaa tctcagaaat cagagaacta tcattgcata tacactaaat 900
tagagaaata ttaaaaggct aagtaacatc tgtggcaata ttgatggtat ataaccttga 960
tatgatgtga tgagaacagt actttacccc atgggcttcc tccccaaacc cttaccccag 1020
tataaatcat gacaaatata ctttaaaaac cattacccta tatctaacca gtactcctca 1080
aaactgtcaa ggtcatcaaa aataagaaaa gtctgaggaa ctgtcaaaac taagaggaac 1140
ccaaggagac atgagaatta tatgtaatgt ggcattctga atgagatccc agaacagaaa 1200
aagaacagta gctaaaaaac taatgaaata taaataaagt ttgaacttta gtttttttta 1260
aaaaagagta gcattaacac ggcaaagcca ttttcatatt tttcttgaac attaagtaca 1320
agtctataat taaaaatttt ttaaatgtag tctggaacat tgccagaaac agaagtacag 1380
cagctatctg tgctgtcgcc taactatcca tagctgattg gtctaaaatg agatacatca 1440
acgctcctcc atgttttttg ttttcttttt aaatgaaaaa ctttattttt taagaggagt 1500
ttcaggttca tagcaaaatt gagaggaagg tacattcaag ctgaggaagt tttcctctat 1560
tcctagttta ctgagagatt gcatcatgaa tgggtgttaa attttgtcaa atgctttttc 1620
tgtgtctatc aatatgacca tgtgattttc ttctttaacc tgttgatggg acaaattacg 1680
ttaattgatt ttcaaacgct gaaccaccct tacatatctg gaataaattc tacttggttg 1740
tggtgtatat tttttgatac attcttggat tctttttgct aatattttgt tgaaaatgtt 1800
tgtatctttg ttcatgagag atattggtct gttgttttct tttcttgtaa tgtcattttc 1860
tagttccggt attaaggtaa tgctggccta gttgaatgat ttaggaagta ttccctctgc 1920
ttctgtcttc tgaaagagat tgtagaaagt tgatacaatt tttttttctt taaatatttg 1980
ata 1983
<210> 7
<211> 1110
<212> DNA
<213> artificial sequence
<400> 7
ttaagataac ttcgtatagc atacattata cgaagttatt ttaaaccgct gatcagcctc 60
gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc cttccttgac 120
cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg catcgcattg 180
tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca agggggagga 240
ttgggaagac aatagcaggc atgctgggga tgcggtgggc tctatggctt ctgaggcgga 300
aagaaccagc tggggctcta gggggtatcc ccacgcgccc tgtagcggcg cattaagcgc 360
ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc 420
tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct 480
aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa 540
acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc 600
tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg gaacaacact 660
caaccctatc tcggtctatt cttttgattt ataagggatt ttgccgattt cggcctattg 720
gttaaaaaat gagctgattt aacaaaaatt taacgcgaat taattctgtg gaatgtgtgt 780
cagttagggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat 840
ctcaattagt cagcaaccag gtgtggaaag tccccaggct ccccagcagg cagaagtatg 900
caaagcatgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg 960
cccctaactc cgcccagttc cgcccattct ccgccccatg gctgactaat tttttttatt 1020
tatgcagagg ccgaggccgc ctctgcctct gagctattcc agaagtagtg aggaggcttt 1080
tttggaggcc taggcttttg caaaaagctc 1110
<210> 8
<211> 34
<212> DNA
<213> artificial sequence
<400> 8
ataacttcgt atagcataca ttatacgaag ttat 34
<210> 9
<211> 1171
<212> DNA
<213> artificial sequence
<400> 9
aattgataac ttcgtatagc atacattata cgaagttata accggtgcct agagaaggtg 60
gcgcggggta aactgggaaa gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg 120
gggagaaccg tatataagtg cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc 180
cgccagaaca caggtaagtg ccgtgtgtgg ttcccgcggg cctggcctct ttacgggtta 240
tggcccttgc gtgccttgaa ttacttccac ctggctccag tacgtgattc ttgatcccga 300
gctggagcca ggggcgggcc ttgcgcttta ggagcccctt cgcctcgtgc ttgagttgag 360
gcctggcctg ggcgctgggg ccgccgcgtg cgaatctggt ggcaccttcg cgcctgtctc 420
gctgctttcg ataagtctct agccatttaa aatttttgat gacctgctgc gacgcttttt 480
ttctggcaag atagtcttgt aaatgcgggc caggatctgc acactggtat ttcggttttt 540
gggcccgcgg ccggcgacgg ggcccgtgcg tcccagcgca catgttcggc gaggcggggc 600
ctgcgagcgc ggccaccgag aatcggacgg gggtagtctc aagctggccg gcctgctctg 660
gtgcctggcc tcgcgccgcc gtgtatcgcc ccgccctggg cggcaaggct ggcccggtcg 720
gcaccagttg cgtgagcgga aagatggccg cttcccggcc ctgctccagg gggctcaaaa 780
tggaggacgc ggcgctcggg agagcgggcg ggtgagtcac ccacacaaag gaaaagggcc 840
tttccgtcct cagccgtcgc ttcatgtgac tccacggagt accgggcgcc gtccaggcac 900
ctcgattagt tctggagctt ttggagtacg tcgtctttag gttgggggga ggggttttat 960
gcgatggagt ttccccacac tgagtgggtg gagactgaag ttaggccagc ttggcacttg 1020
atgtaattct cgttggaatt tgcccttttt gagtttggat cttggttcat tctcaagcct 1080
cagacagtgg ttcaaagttt ttttcttcca tttcaggtgt cgtgaacacg tggtcgcggc 1140
caattctgca gtcgagctca agcttcctgc a 1171
<210> 10
<211> 52
<212> DNA
<213> artificial sequence
<400> 10
gcttagaagc ttcctgcagg ccgccaccat gtccaattta ctgaccgtac ac 52
<210> 11
<211> 38
<212> DNA
<213> artificial sequence
<400> 11
gcttagggcg cgcctcaagc tgtggcaggg aaaccctc 38
<210> 12
<211> 27
<212> DNA
<213> artificial sequence
<400> 12
gcttagggcg cgcccctctc cctcccc 27
<210> 13
<211> 32
<212> DNA
<213> artificial sequence
<400> 13
gcttagggat ccgtcgactt acttgtacag ct 32
<210> 14
<211> 26
<212> DNA
<213> artificial sequence
<400> 14
gctagccctg caggccgcca ccatgt 26
<210> 15
<211> 28
<212> DNA
<213> artificial sequence
<400> 15
gcggccgctt acttgtacag ctcgtcca 28
<210> 16
<211> 20
<212> DNA
<213> artificial sequence
<400> 16
aacaggaagc acaatgccca 20
<210> 17
<211> 37
<212> DNA
<213> artificial sequence
<400> 17
aaggaaaaaa gcggccgcag atctaaataa acttata 37
<210> 18
<211> 66
<212> DNA
<213> artificial sequence
<400> 18
gcggcccaat tgataacttc gtatagcata cattatacga agttatcatg aagaatctgc 60
ttaggg 66
<210> 19
<211> 20
<212> DNA
<213> artificial sequence
<400> 19
gagcacagct gcgcaaggaa 20
Claims (10)
1. a unconformability non-virus carrier, it is characterized in that, described non-virus carrier comprises S/MAR sequence, SV40 replication origin and Cre-ERT2 expressed sequence, the upstream and downstream of described S/MAR sequence has a loxP sequence respectively, two loxP directions are identical, and one of them loxP sequence is between S/MAR sequence and SV40 replication origin.
2. non-virus carrier according to claim 1, is characterized in that, described non-virus carrier also comprises external source goal gene, preferably EGFP.
3. non-virus carrier according to claim 2, is characterized in that, described S/MAR sequence, Cre-ERT2 expressed sequence and external source goal gene share promotor and terminator, and described promotor is preferably the promotor of eukaryotic expression.
4. non-virus carrier according to claim 3, is characterized in that, described Cre-ERT2 expressed sequence is connected with external source goal gene IRES sequence.
5. non-virus carrier according to claim 3, is characterized in that, a LoxP sequence connects in described promotor upstream, and another loxP sequence connects in the downstream of S/MAR sequence.
6. non-virus carrier according to claim 1, it is characterized in that, described S/MAR sequence is as shown in SEQ ID NO.6, the sequence of described SV40 replication origin is as shown in SEQ ID NO.4, described Cre-ERT2 expressed sequence is as shown in SEQ ID NO.2, described loxP sequence and SEQ ID NO.8 have 85%-100% similarity, and preferred LoxP sequence is as shown in SEQ ID NO.8.
7. non-virus carrier according to claim 1, is characterized in that, it builds by the following method:
A) from the pEP4-Cre-EGFP plasmid of sequence as shown in SEQ ID NO.1, Cre-ERT2-IRES-EGFP fragment is cloned,
B) Cre-ERT2-IRES-EGFP fragment is inserted the CMV Promoter downstream of pcDNA3.1 (-) plasmid, obtains pcDNA-Cre-EGFP plasmid,
C) pECG plasmid is obtained with the CMV Promoter that EF1 α Promoter replaces in pcDNA-Cre-EGFP,
D) S/MAR fragment is inserted in pECG carrier, obtains pECG-S/MAR plasmid,
E) primer shown in SEQ ID NO.18 and SEQ ID NO.19 is utilized with pECG-S/MAR plasmid for template clones Afl II-LoxP fragment,
F) by pECG-S/MAR plasmid and Afl II-LoxP fragment Afl II and Xma I double digestion, pECG-S/MAR carrier and Afl II-LoxP-XmaI fragment is obtained respectively,
G) Afl II-LoxP-Xma I fragment is inserted in pECG-S/MAR carrier, obtains pECG-S/MAR-Afl IILoxP plasmid,
H) hold with the EF1 α promoter 5 ' that another loxP to be inserted into pECG-S/MAR-Afl IILoxP plasmid by the method same with step g), obtain pECG-S/MAR-LoxP.
8. non-virus carrier according to claim 1, is characterized in that, described non-virus carrier also has drug selectable marker gene and/or real-time riddled basins.
9. the construction process of a non-virus carrier according to claim 1, it is characterized in that, comprise the following steps: S/MAR sequence, SV40 replication origin, Cre-ERT2 expressed sequence are implemented in skeleton carrier, and respectively insert a loxP sequence in the upstream and downstream of described S/MAR sequence, ensure that one of them loxP sequence is between S/MAR sequence and SV40 replication origin simultaneously.
10. the purposes of the arbitrary described non-virus carrier of claim 1-9, is characterized in that, enter host cell for mediating external source goal gene and express in host cell.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410166521.4A CN105002213A (en) | 2014-04-24 | 2014-04-24 | Unconformable deletable novel non-viral vector, and construction method and use thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410166521.4A CN105002213A (en) | 2014-04-24 | 2014-04-24 | Unconformable deletable novel non-viral vector, and construction method and use thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN105002213A true CN105002213A (en) | 2015-10-28 |
Family
ID=54375075
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410166521.4A Pending CN105002213A (en) | 2014-04-24 | 2014-04-24 | Unconformable deletable novel non-viral vector, and construction method and use thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN105002213A (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2019219649A1 (en) * | 2018-05-14 | 2019-11-21 | Vivet Therapeutics | Gene therapy vectors comprising s/mar sequences |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20100028880A1 (en) * | 2008-08-04 | 2010-02-04 | National Tsing Hua University | Method for sustained expression of an exogenous gene |
CN103725710A (en) * | 2013-12-25 | 2014-04-16 | 北京济福霖生物技术有限公司 | Self-deleting free carrier and application thereof |
CN103740756A (en) * | 2013-12-25 | 2014-04-23 | 中国农业大学 | Non-viral episomal vector capable of controlling deletion and construction method thereof |
-
2014
- 2014-04-24 CN CN201410166521.4A patent/CN105002213A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20100028880A1 (en) * | 2008-08-04 | 2010-02-04 | National Tsing Hua University | Method for sustained expression of an exogenous gene |
CN103725710A (en) * | 2013-12-25 | 2014-04-16 | 北京济福霖生物技术有限公司 | Self-deleting free carrier and application thereof |
CN103740756A (en) * | 2013-12-25 | 2014-04-23 | 中国农业大学 | Non-viral episomal vector capable of controlling deletion and construction method thereof |
Non-Patent Citations (4)
Title |
---|
FENG XIONG ET AL.: ""Targeted Expression in Zebrafish Primordial Germ Cells by Cre/loxP and Gal4/UAS Systems"", 《MAR RIOTECHNOL》 * |
KRISTINA NEHLSEN ET AL.: ""Replicating minicircles:Generation of nonviral episomes for the efficient modification of dividing cells"", 《GENE THERAPY AND MOLECULAR BIOLOGY》 * |
ZHU HUAN-ZHANG ET AL.: ""Conditional Gene Activation in Cultured Hepatocytes Using a Ligand dependent Chimeric Cre Recombinase"", 《生物化学与生物物理学报》 * |
王志蕊等: ""Cre-LoxP重组系统删除内源性选择标记基因的效能评价"", 《中国生物化学与分子生物学报》 * |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2019219649A1 (en) * | 2018-05-14 | 2019-11-21 | Vivet Therapeutics | Gene therapy vectors comprising s/mar sequences |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101320489B1 (en) | Serum-free stable transfection and production of recombinant human proteins in human cell lines | |
US9163219B2 (en) | Single expression vector for generation of a virus with a segmented genome | |
KR101761709B1 (en) | Site-specific integration | |
AU2019343251A1 (en) | Novel interleukin 2 and use thereof | |
KR20190065251A (en) | CRISPR-Cas Genome Processing with Modular AAV Delivery System | |
US20030119104A1 (en) | Chromosome-based platforms | |
KR101921698B1 (en) | Recombinantly produced human factor VIII and IX | |
US20120225090A1 (en) | Methods for enhancing antigen-specific immune responses | |
US11766478B2 (en) | Methods for enhancing antigen-specific immune responses | |
KR20160002880A (en) | Artificial transcription factors engineered to overcome endosomal entrapment | |
WO2016191641A2 (en) | Methods for enhancing antigen-specific immune responses using combination therapy comprising papillomavirus capsid antigens | |
CN111094569A (en) | Light-controlled viral protein, gene thereof, and viral vector containing same | |
CN109666647B (en) | Umbilical cord mesenchymal stem cell for over-expressing IGF-1 and preparation method and application thereof | |
US20030180740A1 (en) | Differential expression screening method | |
CN105002213A (en) | Unconformable deletable novel non-viral vector, and construction method and use thereof | |
CN109762846B (en) | Repair of GALC associated with krabbe disease using base editingC1586TMutational reagents and methods | |
CN109529051A (en) | Saliva acyltransferase recombinant plasmid and its with pemetrexed preparation inhibit bladder cancer proliferation and invasion drug in application | |
CN114908120A (en) | Method for improving expression quantity of recombinant protein | |
CN114908119A (en) | Method for improving expression quantity of recombinant protein | |
CN106520831B (en) | Method for modifying mammalian genome | |
CN110846311A (en) | Preparation of PTC stable cell line by using inhibitory tRNA system and application thereof | |
US20040248081A1 (en) | LANA viral protein binding sites | |
CN101605891A (en) | The genetics of PrP gene melts and uses target to decide the cell of promoter trap strategy method production as the serum-free recombinant proteins of therapeutical agent | |
CN114908110A (en) | Method for improving expression quantity of recombinant protein | |
CN110540962B (en) | Method for preparing human definitive endoderm cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20151028 |