CN105002213A - Unconformable deletable novel non-viral vector, and construction method and use thereof - Google Patents

Abstract

The invention relates to an unconformable deletable novel non-viral vector, and a construction method and a use thereof. The non-viral vector includes an S/MAR sequence, an SV40 replication origin and a Cre-ERT2 expression sequence, the upstream and the downstream of the S/MAR sequence respectively have a loxP sequence, and one of the loxP sequences is positioned between the S/MAR sequence and the SV40 replication origin. The non-viral vector is free from genome, stably inherits with the cell cycle, does not express viral proteins, can be deleted from cells through induction of Tamoxifen at a proper time, is highly safe, and is in favor of promoting early application of an induced pluripotent stem cell technology and a transdifferentiation technology in clinic treatment.

Description

A kind of unconformability can delete novel non-virus carrier and construction process thereof and purposes

[technical field]

The present invention relates to a kind of non-virus carrier of biological field, specifically, relate to a kind of unconformability and can delete non-virus carrier and construction process thereof and purposes.

[background technology]

Nowadays, transgenic technology, not merely for scientific research, has also been widely used in social production life.After induction versatile stem cell technology and transdifferentiation technological invention, it has been inexorable trend that transgenic technology is widely used in clinical.It is exactly security that present transgenic technology is used for one of them clinical obstacle: first, and foreign gene radom insertion, on genome, exists and causes the potential risk such as transgenation, gene silencing; Secondly, external source goal gene cannot be removed in time, and particularly when goal gene has into knurl effect, this is breakneck; Finally, some carriers need to express viral protein, and some viral proteins itself have carcinogenesis, and have higher immunogenicity, are very limited in clinical application.

After transgenic technology occurs, investigator does unremitting effort to the raising of the security of transgene carrier always.First be the appearance of the carrier of a class based on SV40, BPV, EBV virus.This kind of carrier achieves and carries out copying heredity with episomal form in eukaryotic cell, thus solves a difficult problem for vector gene radom insertion in host cell gene group.But the copying of this kind of carrier all needs the trans-acting factor of expressing viral source, and this proteinoid meeting transfaunation cell, such as: the carrier based on SV40 virus copies, need to express large T antigen (other albumen are provided by host cell), and large T antigen energy immortalization primary cell, when being applied to animal, oncogenic generation will be led.

1999, H.J.Lipps laboratory finds the S/MAR element of human origin to instead of SV40 large T antigen gene, and retain the replication origin (origin) of SV40, the carrier pEPI-1 built still can copy heredity with episomal form in Chinese hamster ovary celI, and when there is no resistance screening, 100 generations more than can be retained in Chinese hamster ovary celI.S/MAR sequence derives from mankind's interferon-β gene 5 ' end support adhesion district, and this kind of region is typical A/T enriched sequence, plays an important role in maintenance chromosome structure.PEPI-1 have passed through and repeatedly improves, and all concentrates on and simplifies sequence and reduce on CpG original paper, thus improves transfection efficiency and the expression efficiency of carrier, as pEPito.H.J.Lipps laboratory and Anthony Atala induced in versatile stem cell in experimentation on animals and the mankind respectively afterwards, demonstrated the feasibility based on S/MAR-SV40-Origin serial carrier.

As unconformable non-virus carrier, S/MAR-SV40-Origin carrier has improve very large security, but still there is hidden danger.In order to improve expression efficiency and transformation efficiency in inducing somatic reprogrammed process, usually can use strong promoter, and be applied to the clinical reprogrammed cell that needs and again break up, it is that we do not want to see that early stage foreign gene is broken up in the expression at this moment continued.

In sum, also need badly and build a kind of safer transfection carrier, to promote that induction versatile stem cell technology and transdifferentiation technology are applied to clinical treatment early.

[summary of the invention]

The object of the invention is for deficiency of the prior art, provide a kind of unconformability can delete novel non-virus carrier.

Of the present invention again one object be that a kind of construction process of non-virus carrier as above is provided.

Another object of the present invention provides the purposes of non-virus carrier as above.

For achieving the above object, the technical scheme that the present invention takes is:

A kind of unconformability non-virus carrier, described non-virus carrier comprises S/MAR sequence, SV40 replication origin and Cre-ERT2 expressed sequence, the upstream and downstream of described S/MAR sequence has a loxP sequence respectively, two loxP directions are identical, and one of them loxP sequence is between S/MAR sequence and SV40 replication origin.

Described non-virus carrier also comprises external source goal gene, preferably EGFP.

Described S/MAR sequence, Cre-ERT2 expressed sequence and external source goal gene share promotor and terminator, and described promotor is preferably the promotor of eukaryotic expression.

Described Cre-ERT2 expressed sequence is connected with external source goal gene IRES sequence.

A LoxP sequence connects in described promotor upstream, and another loxP sequence connects in the downstream of S/MAR sequence.

Described S/MAR sequence is as shown in SEQ ID NO.6, the sequence of described SV40 replication origin is as shown in SEQ ID NO.4, described Cre-ERT2 expressed sequence is as shown in SEQ ID NO.2, described loxP sequence and SEQ ID NO.8 have 85%-100% similarity, and preferred LoxP sequence is as shown in SEQ ID NO.8.

Described non-virus carrier builds by the following method:

A) from the pEP4-Cre-EGFP plasmid of sequence as shown in SEQ ID NO.1, Cre-ERT2-IRES-EGFP fragment is cloned,

B) Cre-ERT2-IRES-EGFP fragment is inserted the CMV Promoter downstream of pcDNA3.1 (-) plasmid, obtains pcDNA-Cre-EGFP plasmid,

C) pECG plasmid is obtained with the CMV Promoter that EF1 α Promoter replaces in pcDNA-Cre-EGFP,

D) S/MAR fragment is inserted in pECG carrier, obtains pECG-S/MAR plasmid,

E) primer shown in SEQ ID NO.18 and SEQ ID NO.19 is utilized with pECG-S/MAR plasmid for template clones Afl II-LoxP fragment,

F) by pECG-S/MAR plasmid and Afl II-LoxP fragment Afl II and Xma I double digestion, pECG-S/MAR carrier and Afl II-LoxP-XmaI fragment is obtained respectively,

G) Afl II-LoxP-Xma I fragment is inserted in pECG-S/MAR carrier, obtains pECG-S/MAR-Afl IILoxP plasmid,

H) hold with the EF1 α promoter 5 ' that another loxP to be inserted into pECG-S/MAR-Afl IILoxP plasmid by the method same with step g), obtain pECG-S/MAR-LoxP.

Described non-virus carrier also has drug selectable marker gene and/or real-time riddled basins.

For realizing above-mentioned second object, the technical scheme that the present invention takes is:

A kind of construction process of non-virus carrier as above, comprise the following steps: S/MAR sequence, SV40 replication origin, Cre-ERT2 expressed sequence are implemented in skeleton carrier, and respectively insert a loxP sequence in the upstream and downstream of described S/MAR sequence, ensure that one of them loxP sequence is between S/MAR sequence and SV40 replication origin simultaneously.

For realizing above-mentioned 3rd object, the technical scheme that the present invention takes is:

As above the purposes of arbitrary described non-virus carrier, enters host cell for mediating external source goal gene and expresses in host cell.

In the present invention, described " sequence ", " expressed sequence ", " element ", " gene ", " fragment " can exchange use; Described Cre-ERT2 and Cre recombinase-estrogen receptor T2, described Cre-ERT2 expressed sequence, gene, element or sequence are all the polynucleotide sequence of expressing Cre-ERT2; Described S/MAR sequence or element, be all the polynucleotide sequence of expressing S/MAR, it is human origin, share with SV40 replication origin, can ensure that carrier does not insert in genome and realize expressing and copying heredity.Every S/MAR sequence, SV40 replication origin realizing above-mentioned purpose includes within the scope of the invention.Described " loxP " (locus of X-over P1) sequence, derive from P1 phage, be jointly made up of two 13bp inverted repeats and midfeather 8bp sequence, the intervening sequence of 8bp also determines the direction of loxP simultaneously.LoxP sequence comprises sequence as shown in: ATAACTTCGTATA (13bp)-NNNTANNN (8bp)-TATACGAAGTTAT (13bp), and " N " represents any Nucleotide; Described loxP sequence also can comprise the sequence of the inverted repeats of an above-mentioned 13bp or the intervening sequence sudden change of 8bp, such as, in following table listed sequence:

Described Cre-ERT2 expressed sequence can express Cre-ERT2 albumen, after Tamoxifen process, Cre-ERT2 albumen can enter the restructuring of loxP sequence in the same way of core specificity induction S/MAR sequence both sides, S/MAR sequence is separated with SV40 replication origin, thus non-virus carrier of the present invention is lost copy Genetic Function.Described " upstream and downstream of S/MAR sequence has a loxP sequence respectively " refers to that two loxP sequences lay respectively at the upstream and downstream of S/MAR sequence, two loxP directions are identical, and two loxP sequences are not closely must be connected with the upstream and downstream sequence of S/MAR gene fragment, also other fragment can be comprised, as long as S/MAR sequence is separated with SV40 replication origin after ensureing two loxP sequence restructuring between itself and S/MAR sequence.The concrete nucleotide sequence of described S/MAR sequence, SV40 replication origin, Cre-ERT2 expressed sequence, loxP sequence is all not limited to embodiments of the invention, and preferably itself and the sequence shown in the embodiment of the present invention have the similarity of 85%-100% usually.For ensureing the transfection efficiency of the non-virus carrier built and taking into account the convenience of carrier construction, described S/MAR sequence, Cre-ERT2 expressed sequence and external source goal gene can share promotor and terminator, as shared EF1 α Promoter and BGH pA in the present invention, but obvious, three can have respective promotor and terminator respectively.Promotor used is preferably the promotor of eukaryotic expression, as EF1 α Promoter, ensures that it can start transcribing of coding region in most eukaryotes.Preferably, described Cre-ERT2 expressed sequence is positioned at external source goal gene upstream, and is provided with IRES sequence therebetween, IRES is ribosome binding sequence, so transcribing out is a RNA, what guarantee was expressed is Cre-ERT2 albumen and external source target protein, instead of fusion rotein.Described drug selectable marker gene can be Amp gene, kanamycin gene etc., and described real-time riddled basins is EGFP gene, GFP gene etc.Described " skeleton carrier " refers to primary expression carrier, and in expression vector establishment process, we select a carrier as skeleton carrier usually, plays the effect of basic framework, other object fragment is connected into successively in this skeleton carrier.Non-virus carrier of the present invention can be used for mediation external source goal gene and enters host cell and express in host cell, this purposes is preferably non-treatment object, carry external source object goal gene as utilized non-virus carrier of the present invention and enter host cell expression, but this way is not be directly used in medical diagnosis on disease or treatment, and for example non-virus carrier of the present invention is entered host cell and the product of expressing in host cell for the preparation of mediation external source goal gene.Described " external source goal gene " refers to the gene that can be used for expressing target protein, the albumen etc. such as can express real-time selection markers albumen, having an impact to target cell Physiology and biochemistry or genetic expression.

The invention has the advantages that:

Chromosome scaffold/the matrix in people source is glued district S/MAR sequence by the present invention, and Cre-ERT2 expressed sequence, LoxP sequence etc. are incorporated on carrier, this carrier can be free on outside genome, and along with cell cycle genetic stability, do not express viral protein, and the induction in due course by Tamoxifen is deleted from cell, and security is higher.Gene therapy is in the past mostly for genetic flaw, and it is more how to allow foreign gene express lastingly that investigator pays close attention to, and usually do not consider how to delete, the present invention compensate for the deficiency of this aspect.

As one embodiment of the present of invention, take pcDNA-3.1 as skeleton, overcome loxP sequence and easily form the difficulties such as hairpin structure when being inserted into carrier, the distance simultaneously between two loxP sequences arranges rationally, successfully constructs pECG-S/MAR-LoxP carrier.Under normal culture condition, due to the effect of S/MAR-SV40-origin, carrier can not insert in genome and realize expressing and copying heredity.And with after Tamoxifen process, Cre-ERT2 albumen can enter the restructuring of loxP sequence in the same way of core specificity induction S/MAR sequence both sides, S/MAR sequence is separated with SV40-origin, thus realizes whole carrier and delete in cell.Carrier has been transfected in HEK293 cell also successfully to obtain and has surely turned clone by we.Surely turn clone not have under resistance screening pressure condition can stably express GFP100 generation above and can freezing and thawing.Surely turn clone after Tamoxifen process, carrier has higher deletion efficiency, the 5th day GFP negative rate more than 50%.

Promotion induction versatile stem cell technology and transdifferentiation technology are applied to clinical treatment by safer transfection carrier that the present invention builds early.

[accompanying drawing explanation]

Fig. 1, pEP4 EO2S EN2K plasmid map.

Fig. 2, pEP4-Cre-EGFP plasmid map.

Fig. 3, pcDNA3.1 (-) plasmid map.

Fig. 4, pcDNA-Cre-EGFP plasmid map.

The pEP4-Cre-EGFP plasmid map of Fig. 5, display restriction enzyme site.

Fig. 6, pECG plasmid map.

Fig. 7, pECG, pECG-S/MAR, pECG-S/MAR-LOXP plasmid enzyme restriction is identified, 1,2,3 are respectively pECG-S/MAR-LOXP, pECG, pECG-S/MAR result after Hind III digestion.

Fig. 8, pECG-S/MAR plasmid map.

Fig. 9, pECG-S/MAR-LoxP plasmid map.

The transfection efficiency of Figure 10, pECG, pECG-S/MAR, pECG-S/MAR-LoxP transfection HEK293 and screening be after 2 weeks, the GFP positive rate of cell.Upper row is the transfection result of 48 hours, and lower row is screening 2 weeks rear results.

The change of the HEK293 cell of Figure 11, pECG-S/MAR-LoxP transfection GFP positive rate before frozen and after recovery.

After Figure 12, Tamoxifen process, the change to the 5th day GFP positive cell in second day.

[embodiment]

Below in conjunction with accompanying drawing, embodiment provided by the invention is elaborated.

embodiment 1

1, pEP4-Cre-EGFP plasmid is built

1) primer I RES-EGFP-S and IRES-EGFP-AS in subordinate list 1 is utilized, with LV-EF1 α-IRES-EGFP for template clones IRES-EGFP fragment.

 

The IRES-EGFP fragment that test kit reclaims PCR is reclaimed with PCR.

2) the IRES-EGFP fragment BamH I and the Asc I double digestion that will reclaim.

37 DEG C of insulations, enzyme cuts 6 hours.Reclaim test kit with PCR and reclaim endonuclease bamhi.

3) primer Cre-ERT2-S and Cre-ERT2-AS in subordinate list 1 is utilized, with Cre-ERT2 mouse mouse tail DNA for template clones Cre-ERT2 fragment.

The Cre-ERT2 fragment that test kit reclaims PCR is reclaimed with PCR.

4) by the Cre-ERT2 fragment HindIII of recovery and Asc I double digestion.

37 DEG C of insulations, enzyme cuts 6 hours.Reclaim test kit with PCR and reclaim endonuclease bamhi.

5) by pEP4 EO2S EN2K plasmid (plasmid map is shown in Fig. 1) Hind III and BamH I double digestion.

37 DEG C of insulations, enzyme cuts 6 hours.Reclaim digestion products pEP4 fragment (8510bp).

6) by above 2), 4), 5) endonuclease bamhi that obtains of step connects with T4 ligase enzyme.

After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion TBE180 competent cell, cultivate 14h for 37 DEG C, picking mono-clonal, extract plasmid pEP4-Cre-EGFP, and by digestion verification (pEP4-Cre-EGFP plasmid map is shown in Fig. 2, and plasmid sequence is as shown in SEQ ID NO.1).

, build pECG, pECG-S/MAR, pECG-S/MAR-loxP plasmid

1) primer Cre-EGFP-S and Cre-EGFP-AS in subordinate list 1 is utilized, with the pEP4-Cre-EGFP plasmid of above-mentioned structure for template clones Cre-ERT2-IRES-EGFP fragment (be finally connected into Cre-ERT2 fragment sequence as shown in SEQ ID NO.2) in carrier.

2) PCR is utilized to reclaim the Cre-ERT2-IRES-EGFP fragment of test kit recovery PCR.

3) by the 2nd) the Cre-ERT2-IRES-EGFP fragment that obtains of step is connected in pEASY-Blunt carrier (being purchased from Quan Shi King Company), obtains pEASY-Cre-EGFP plasmid.

After room temperature reaction 25mins, get 3 μ l and connect product conversion E.coli DH5 ɑ competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, sequence verification.

4) by pEASY-Cre-EGFP and pcDNA3.1 (-) plasmid, (plasmid map is shown in Fig. 3, plasmid sequence is as shown in SEQ ID NO.3, this plasmid carries SV40 origin, and SV40 origin sequence is as shown in SEQ ID NO.4) use Not I and Nhe I double digestion.

37 DEG C of insulations, enzyme cuts 6 hours.

37 DEG C of insulations, enzyme cuts 6 hours.

Reclaim digestion products Cre-ERT2-IRES-EGFP fragment and pcDNA3.1 (-) carrier.

5) Cre-ERT2-IRES-EGFP fragment is inserted in pcDNA3.1 (-) obtains pcDNA-Cre-EGFP plasmid (plasmid map is shown in Fig. 4).

After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion E.coli DH5 ɑ competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, and pass through digestion verification.

6) by pcDNA-Cre-EGFP Xba I and Mfe I double digestion, plasmid map pEP4-Cre-EGFP(being shown restriction enzyme site is shown in Fig. 5) obtain EF1 α Promoter fragment with Xba I and Mfe I double digestion.

37 DEG C of insulations, enzyme cuts 6 hours.

37 DEG C of insulations, enzyme cuts 6 hours.

Reclaim digestion products EF1 α Promoter fragment and pcDNA-Cre-EGFP carrier.

7) sequence of the EF1 α Promoter of carrier is finally connected into EF1 α Promoter(as shown in SEQ ID NO.5) the CMV Promoter replaced in pcDNA-Cre-EGFP obtains pECG(plasmid map and sees Fig. 6).

After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion TBE180 competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, and by digestion verification, enzyme is cut and be the results are shown in Figure 7.

8) primer S/MAR-AS1 and S/MAR-Ps in subordinate list 1 is utilized, with 293T cell genomic dna for template clones S/MAR fragment.

PCR is utilized to reclaim the S/MAR fragment of test kit recovery PCR.

9) by pECG and S/MAR fragment EcoR I and Not I double digestion, pECG carrier and S/MAR fragment (being wherein finally connected into the sequence of the S/MAR fragment in carrier as shown in SEQ ID NO.6) is obtained respectively.

37 DEG C of insulations, enzyme cuts 6 hours.

37 DEG C of insulations, enzyme cuts 6 hours.

Reclaim digestion products pECG carrier and S/MAR fragment.

10) S/MAR fragment is inserted in pECG carrier, obtains pECG-S/MAR plasmid (plasmid map is shown in Fig. 8).

After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion TB4180 competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, and by digestion verification, enzyme is cut and be the results are shown in Figure 7.

11) utilizing primer Afl II-LoxP and Neo-BX-AS in subordinate list 1, is that template clones Afl II-LoxP fragment with pECG-S/MAR.

PCR is utilized to reclaim the Afl II-LoxP fragment of test kit recovery PCR.

12) by pECG-S/MAR plasmid and Afl II-LoxP fragment Afl II and Xma I double digestion, (Afl II-LoxP-XmaI fragment sequence is as shown in SEQ ID NO.7 to obtain pECG-S/MAR carrier and Afl II-LoxP-XmaI fragment respectively, wherein 6-39 position Nucleotide is LoxP sequence: ataacttcgtatagcatacattatacgaagttat, is designated as SEQ ID NO.8).

37 DEG C of insulations, enzyme cuts 6 hours.

37 DEG C of insulations, enzyme cuts 6 hours.

Reclaim digestion products pECG-S/MAR carrier and Afl II-LoxP-Xma I fragment.

13) Afl II-LoxP-Xma I fragment is inserted in pECG-S/MAR carrier, obtains pECG-S/MAR-Afl IILoxP plasmid.

After 16 DEG C of reaction 4h, get 3 μ l and connect product conversion TB4180 competent cell, cultivate 14h, picking mono-clonal for 37 DEG C, extract plasmid, and pass through digestion verification.

14) to use the same method another loxP(herein containing the sequence of loxP fragment as shown in SEQ ID NO.9, wherein 6-39 position Nucleotide is LoxP sequence: ataacttcgtatagcatacattatacgaagttat) the EF1 α promoter 5 ' that is inserted into pECG-S/MAR-Afl IILoxP plasmid holds, obtain pECG-S/MAR-LoxP(plasmid map and see Fig. 9), and cut and sequence verification by enzyme, enzyme is cut and be the results are shown in Figure 7.

, carrier such as screening pECG-S/MAR-LoxP etc. surely turns clone

1) appropriate HEK293 cell is spread in 6-well-dish at day before transfection.

2) when cell density reaches 80%, with FuGen-HD, pECG-S/MAR-LoxP is forwarded in HEK293 cell, and with pECG and pECG-S/MAR in contrast.

3) at transfection 48 h before harvest cell, get part cell, with flow cytomery transfection efficiency (Figure 10), find that S/MAR and loxP is not very large on the impact of plasmid transfection efficiency.

4) remaining cell starts with the Screening of Media containing 500 μ g/ml G418.

5) GFP positive cell (Figure 10) is again detected with flow cytometer in screening after two weeks, at this moment find that the expression level of GFP positive cell GFP reaches unanimity, the GFP positive rate of the cell of transfection pECG-S/MAR and pECG-S/MAR-LOXP is respectively 31.8% and 23.8%, higher than transfection not containing the positive rate 15.1% of the cell of the pECG of S/MAR sequence.

6) in screening after three weeks, collecting cell, goes out the cell mass of the GFP positive with selected by flow cytometry apoptosis.Sorting obtains about 3 × 10 ⁵individual cell, continues to cultivate in containing the substratum of 500 μ g/ml G418.

, pECG-S/MAR-LoxP surely turns the frozen of clone and recovery

1) get a 10cm culture dish covered with, peptic cell, by cell harvesting in 15ml centrifuge tube.

2) centrifugal 5 minutes of 1000rpm, abandons supernatant liquor.

3) add 8ml PBS, Eddy diffusion cell, keep sample and detect GFP positive rate, repeat the 2nd step.

4) 1.5ml substratum Eddy diffusion cell is added.

5) 2x frozen storing liquid is prepared: get 0.3ml DMSO and be dissolved in 1.2ml FBS.

6) 2x frozen storing liquid is slowly added in cell suspending liquid, mix gently.DMSO final concentration is 10%.

7) 3ml mixed solution is dispensed in 3 cryopreservation tubes, often pipe 1ml.

8) cryopreservation tube is put into freezing storing box, put people's-80 DEG C of refrigerators.

9) recovery cell after 1 month.

10) get a frozen cell, melt rapidly in 37 DEG C of water-baths.

11) cell suspending liquid is transferred in 15ml centrifuge tube, is diluted in 10ml nutrient solution.

12) centrifugal 5 minutes of 1000rpm, abandons supernatant liquor.

13) with 5ml nutrient solution Eddy diffusion cell, be transferred in 10cm culture dish, subsidy substratum.

14) second day, abandon supernatant, add fresh culture.

15) the 3rd day, passage, and the detection GFP positive rate that keeps sample.There is the positive rate of 96.3% before cell cryopreservation, still have 93.1%GFP positive rate after recovery, see Figure 11.

, check the deletion efficiency of carrier pECG-S/MAR-LoxP in cell under Tamoxifen process

1) 5 × 10 are spread ⁴the GFP positive cell in individual every hole, in 24-well-dish, is used not containing the base culture base of G418.

2) Tamoxifen is dissolved in dehydrated alcohol in advance, is mixed with the solution of 2mg/ml.Join in substratum with the ratio of 1:1000, make final concentration be 2 μ g/ml.

3), after 6 hours, discard supernatant, add fresh culture.

After 48 hours, every 24 hr collections cell detection GFP positive rates once, continuous detecting 4 days (Figure 12).From figure, we can see, the cell of pECG-S/MAR-LoxP transfection offset from the GFP positive to feminine gender gradually and finally becomes GFP negative cells from second day, and this phenomenon is not observed in two other control group.

Subordinate list 1 primer sequence

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the prerequisite not departing from the inventive method; can also make some improvement and supplement, these improve and supplement and also should be considered as protection scope of the present invention.

SEQUENCE LISTING

<110> Institut Pasteur of Shanghai, Chinese Academy of Sciences

<120> unconformability can delete novel non-virus carrier and construction process thereof and purposes

<130> /

<160> 19

<170> PatentIn version 3.3

<210> 1

<211> 11840

<212> DNA

<213> artificial sequence

<400> 1

gctagcggct ccggtgcccg tcagtgggca gagcgcacat cgcccacagt ccccgagaag 60

ttggggggag gggtcggcaa ttgaaccggt gcctagagaa ggtggcgcgg ggtaaactgg 120

gaaagtgatg tcgtgtactg gctccgcctt tttcccgagg gtgggggaga accgtatata 180

agtgcagtag tcgccgtgaa cgttcttttt cgcaacgggt ttgccgccag aacacaggta 240

agtgccgtgt gtggttcccg cgggcctggc ctctttacgg gttatggccc ttgcgtgcct 300

tgaattactt ccacctggct ccagtacgtg attcttgatc ccgagctgga gccaggggcg 360

ggccttgcgc tttaggagcc ccttcgcctc gtgcttgagt tgaggcctgg cctgggcgct 420

ggggccgccg cgtgcgaatc tggtggcacc ttcgcgcctg tctcgctgct ttcgataagt 480

ctctagccat ttaaaatttt tgatgacctg ctgcgacgct ttttttctgg caagatagtc 540

ttgtaaatgc gggccaggat ctgcacactg gtatttcggt ttttgggccc gcggccggcg 600

acggggcccg tgcgtcccag cgcacatgtt cggcgaggcg gggcctgcga gcgcggccac 660

cgagaatcgg acgggggtag tctcaagctg gccggcctgc tctggtgcct ggcctcgcgc 720

cgccgtgtat cgccccgccc tgggcggcaa ggctggcccg gtcggcacca gttgcgtgag 780

cggaaagatg gccgcttccc ggccctgctc cagggggctc aaaatggagg acgcggcgct 840

cgggagagcg ggcgggtgag tcacccacac aaaggaaaag ggcctttccg tcctcagccg 900

tcgcttcatg tgactccacg gagtaccggg cgccgtccag gcacctcgat tagttctgga 960

gcttttggag tacgtcgtct ttaggttggg gggaggggtt ttatgcgatg gagtttcccc 1020

acactgagtg ggtggagact gaagttaggc cagcttggca cttgatgtaa ttctcgttgg 1080

aatttgccct ttttgagttt ggatcttggt tcattctcaa gcctcagaca gtggttcaaa 1140

gtttttttct tccatttcag gtgtcgtgaa cacgtggtcg cggccaattc tgcagtcgag 1200

ctcaagcttc ctgcaggccg ccaccatgtc caatttactg accgtacacc aaaatttgcc 1260

tgcattaccg gtcgatgcaa cgagtgatga ggttcgcaag aacctgatgg acatgttcag 1320

ggatcgccag gcgttttctg agcatacctg gaaaatgctt ctgtccgttt gccggtcgtg 1380

ggcggcatgg tgcaagttga ataaccggaa atggtttccc gcagaacctg aagatgttcg 1440

cgattatctt ctatatcttc aggcgcgcgg tctggcagta aaaactatcc agcaacattt 1500

gggccagcta aacatgcttc atcgtcggtc cgggctgcca cgaccaagtg acagcaatgc 1560

tgtttcactg gttatgcggc ggatccgaaa agaaaacgtt gatgccggtg aacgtgcaaa 1620

acaggctcta gcgttcgaac gcactgattt cgaccaggtt cgttcactca tggaaaatag 1680

cgatcgctgc caggatatac gtaatctggc atttctgggg attgcttata acaccctgtt 1740

acgtatagcc gaaattgcca ggatcagggt taaagatatc tcacgtactg acggtgggag 1800

aatgttaatc catattggca gaacgaaaac gctggttagc accgcaggtg tagagaaggc 1860

acttagcctg ggggtaacta aactggtcga gcgatggatt tccgtctctg gtgtagctga 1920

tgatccgaat aactacctgt tttgccgggt cagaaaaaat ggtgttgccg cgccatctgc 1980

caccagccag ctatcaactc gcgccctgga agggattttt gaagcaactc atcgattgat 2040

ttacggcgct aaggatgact ctggtcagag atacctggcc tggtctggac acagtgcccg 2100

tgtcggagcc gcgcgagata tggcccgcgc tggagtttca ataccggaga tcatgcaagc 2160

tggtggctgg accaatgtaa atattgtcat gaactatatc cgtaacctgg atagtgaaac 2220

aggggcaatg gtgcgcctgc tggaagatgg cgatctcgag ccatctgctg gagacatgag 2280

agctgccaac ctttggccaa gcccgctcat gatcaaacgc tctaagaaga acagcctggc 2340

cttgtccctg acggccgacc agatggtcag tgccttgttg gatgctgagc cccccatact 2400

ctattccgag tatgatccta ccagaccctt cagtgaagct tcgatgatgg gcttactgac 2460

caacctggca gacagggagc tggttcacat gatcaactgg gcgaagaggg tgccaggctt 2520

tgtggatttg accctccatg atcaggtcca ccttctagaa tgtgcctggc tagagatcct 2580

gatgattggt ctcgtctggc gctccatgga gcacccagtg aagctactgt ttgctcctaa 2640

cttgctcttg gacaggaacc agggaaaatg tgtagagggc atggtggaga tcttcgacat 2700

gctgctggct acatcatctc ggttccgcat gatgaatctg cagggagagg agtttgtgtg 2760

cctcaaatct attattttgc ttaattctgg agtgtacaca tttctgtcca gcaccctgaa 2820

gtctctggaa gagaaggacc atatccaccg agtcctggac aagatcacag acactttgat 2880

ccacctgatg gccaaggcag gcctgaccct gcagcagcag caccagcggc tggcccagct 2940

cctcctcatc ctctcccaca tcaggcacat gagtaacaaa ggcatggagc atctgtacag 3000

catgaagtgc aagaacgtgg tgcccctcta tgacctgctg ctggaggcgg cggacgccca 3060

ccgcctacat gcgcccacta gccgtggagg ggcatccgtg gaggagacgg accaaagcca 3120

cttggccact gcgggctcta cttcatcgca ttccttgcaa aagtattaca tcacggggga 3180

ggcagagggt ttccctgcca cagcttgagg cgcgcccctc tccctccccc ccccctaacg 3240

ttactggccg aagccgcttg gaataaggcc ggtgtgcgtt tgtctatatg ttattttcca 3300

ccatattgcc gtcttttggc aatgtgaggg cccggaaacc tggccctgtc ttcttgacga 3360

gcattcctag gggtctttcc cctctcgcca aaggaatgca aggtctgttg aatgtcgtga 3420

aggaagcagt tcctctggaa gcttcttgaa gacaaacaac gtctgtagcg accctttgca 3480

ggcagcggaa ccccccacct ggcgacaggt gcctctgcgg ccaaaagcca cgtgtataag 3540

atacacctgc aaaggcggca caaccccagt gccacgttgt gagttggata gttgtggaaa 3600

gagtcaaatg gctctcctca agcgtattca acaaggggct gaaggatgcc cagaaggtac 3660

cccattgtat gggatctgat ctggggcctc ggtacacatg ctttacatgt gtttagtcga 3720

ggttaaaaaa acgtctaggc cccccgaacc acggggacgt ggttttcctt tgaaaaacac 3780

gatgataata tggccacaac ccatggtgag caagggcgag gagctgttca ccggggtggt 3840

gcccatcctg gtcgagctgg acggcgacgt aaacggccac aagttcagcg tgtccggcga 3900

gggcgagggc gatgccacct acggcaagct gaccctgaag ttcatctgca ccaccggcaa 3960

gctgcccgtg ccctggccca ccctcgtgac caccctgacc tacggcgtgc agtgcttcag 4020

ccgctacccc gaccacatga agcagcacga cttcttcaag tccgccatgc ccgaaggcta 4080

cgtccaggag cgcaccatct tcttcaagga cgacggcaac tacaagaccc gcgccgaggt 4140

gaagttcgag ggcgacaccc tggtgaaccg catcgagctg aagggcatcg acttcaagga 4200

ggacggcaac atcctggggc acaagctgga gtacaactac aacagccaca acgtctatat 4260

catggccgac aagcagaaga acggcatcaa ggtgaacttc aagatccgcc acaacatcga 4320

ggacggcagc gtgcagctcg ccgaccacta ccagcagaac acccccatcg gcgacggccc 4380

cgtgctgctg cccgacaacc actacctgag cacccagtcc gccctgagca aagaccccaa 4440

cgagaagcgc gatcacatgg tcctgctgga gttcgtgacc gccgccggga tcactctcgg 4500

catggacgag ctgtacaagt aagtcgacgg atccgatcca gacatgataa gatacattga 4560

tgagtttgga caaaccacaa ctagaatgca gtgaaaaaaa tgctttattt gtgaaatttg 4620

tgatgctatt gctttatttg taaccattat aagctgcaat aaacaagtta acaacaacaa 4680

ttgcattcat tttatgtttc aggttcaggg ggaggtgtgg gaggtttttt aaagcaagta 4740

aaacctctac aaatgtggta tggctgatta tgatccggct gcctcgcgcg tttcggtgat 4800

gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg tctgtaagcg 4860

gatgccggga gcagacaagc ccgtcaggcg tcagcgggtg ttggcgggtg tcggggcgca 4920

gccatgaggt cgatcgactc tagctagagg atcgatgccc cgccccggac gaactaaacc 4980

tgactacgac atctctgccc cttcttcgcg gggcagtgca tgtaatccct tcagttggtt 5040

ggtacaactt gccaactggg ccctgttcca catgtgacac ggggggggac caaacacaaa 5100

ggggttctct gactgtagtt gacatcctta taaatggatg tgcacatttg ccaacactga 5160

gtggctttca tcctggagca gactttgcag tctgtggact gcaacacaac attgccttta 5220

tgtgtaactc ttggctgaag ctcttacacc aatgctgggg gacatgtacc tcccaggggc 5280

ccaggaagac tacgggaggc tacaccaacg tcaatcagag gggcctgtgt agctaccgat 5340

aagcggaccc tcaagagggc attagcaata gtgtttataa ggcccccttg ttaaccctaa 5400

acgggtagca tatgcttccc gggtagtagt atatactatc cagactaacc ctaattcaat 5460

agcatatgtt acccaacggg aagcatatgc tatcgaatta gggttagtaa aagggtccta 5520

aggaacagcg atatctccca ccccatgagc tgtcacggtt ttatttacat ggggtcagga 5580

ttccacgagg gtagtgaacc attttagtca caagggcagt ggctgaagat caaggagcgg 5640

gcagtgaact ctcctgaatc ttcgcctgct tcttcattct ccttcgttta gctaatagaa 5700

taactgctga gttgtgaaca gtaaggtgta tgtgaggtgc tcgaaaacaa ggtttcaggt 5760

gacgccccca gaataaaatt tggacggggg gttcagtggt ggcattgtgc tatgacacca 5820

atataaccct cacaaacccc ttgggcaata aatactagtg taggaatgaa acattctgaa 5880

tatctttaac aatagaaatc catggggtgg ggacaagccg taaagactgg atgtccatct 5940

cacacgaatt tatggctatg ggcaacacat aatcctagtg caatatgata ctggggttat 6000

taagatgtgt cccaggcagg gaccaagaca ggtgaaccat gttgttacac tctatttgta 6060

acaaggggaa agagagtgga cgccgacagc agcggactcc actggttgtc tctaacaccc 6120

ccgaaaatta aacggggctc cacgccaatg gggcccataa acaaagacaa gtggccactc 6180

ttttttttga aattgtggag tgggggcacg cgtcagcccc cacacgccgc cctgcggttt 6240

tggactgtaa aataagggtg taataacttg gctgattgta accccgctaa ccactgcggt 6300

caaaccactt gcccacaaaa ccactaatgg caccccgggg aatacctgca taagtaggtg 6360

ggcgggccaa gataggggcg cgattgctgc gatctggagg acaaattaca cacacttgcg 6420

cctgagcgcc aagcacaggg ttgttggtcc tcatattcac gaggtcgctg agagcacggt 6480

gggctaatgt tgccatgggt agcatatact acccaaatat ctggatagca tatgctatcc 6540

taatctatat ctgggtagca taggctatcc taatctatat ctgggtagca tatgctatcc 6600

taatctatat ctgggtagta tatgctatcc taatttatat ctgggtagca taggctatcc 6660

taatctatat ctgggtagca tatgctatcc taatctatat ctgggtagta tatgctatcc 6720

taatctgtat ccgggtagca tatgctatcc taatagagat tagggtagta tatgctatcc 6780

taatttatat ctgggtagca tatactaccc aaatatctgg atagcatatg ctatcctaat 6840

ctatatctgg gtagcatatg ctatcctaat ctatatctgg gtagcatagg ctatcctaat 6900

ctatatctgg gtagcatatg ctatcctaat ctatatctgg gtagtatatg ctatcctaat 6960

ttatatctgg gtagcatagg ctatcctaat ctatatctgg gtagcatatg ctatcctaat 7020

ctatatctgg gtagtatatg ctatcctaat ctgtatccgg gtagcatatg ctatcctcat 7080

gcatatacag tcagcatatg atacccagta gtagagtggg agtgctatcc tttgcatatg 7140

ccgccacctc ccaagggggc gtgaattttc gctgcttgtc cttttcctgc tggttgctcc 7200

cattcttagg tgaatttaag gaggccaggc taaagccgtc gcatgtctga ttgctcgaat 7260

tcaccaggta aatgtcgcta atgttttcca acgcgagaag gtgttgagcg cggagctgag 7320

tgacgtgaca acatgggtat gcccaattgc cccatgttgg gaggacgaaa atggtgacaa 7380

gacagatggc cagaaataca ccaacagcac gcatgatgtc tactggggat ttattcttta 7440

gtgcggggga atacacggct tttaatacga ttgagggcgt ctcctaacaa gttacatcac 7500

tcctgccctt cctcaccctc atctccatca cctccttcat ctccgtcatc tccgtcatca 7560

ccctccgcgg cagccccttc caccataggt ggaaaccagg gaggcaaatc tactccatcg 7620

tcaaagctgc acacagtcac cctgatattg caggtaggag cgggctttgt cataacaagg 7680

tccttaatcg catccttcaa aacctcagca aatatatgag tttgtaaaaa gaccatgaaa 7740

taacagacaa tggactccct tagcgggcca ggttgtgggc cgggtccagg ggccattcca 7800

aaggggagac gactcaatgg tgtaagacga cattgtggaa tagcaagggc agttcctcgc 7860

cttaggttgt aaagggaggt cttactacct ccatatacga acacaccggc gacccaagtt 7920

ccttcgtcgg tagtcctttc tacgtgactc ctagccagga gagctcttaa accttctgca 7980

atgttctcaa atttcgggtt ggaacctcct tgaccacgat gctttccaaa ccaccctcct 8040

tttttgcgcc tgcctccatc accctgaccc cggggtccag tgcttgggcc ttctcctggg 8100

tcatctgcgg ggccctgctc tatcgctccc gggggcacgt caggctcacc atctgggcca 8160

ccttcttggt ggtattcaaa ataatcggct tcccctacag ggtggaaaaa tggccttcta 8220

cctggagggg gcctgcgcgg tggagacccg gatgatgatg actgactact gggactcctg 8280

ggcctctttt ctccacgtcc acgacctctc cccctggctc tttcacgact tccccccctg 8340

gctctttcac gtcctctacc ccggcggcct ccactacctc ctcgaccccg gcctccacta 8400

cctcctcgac cccggcctcc actgcctcct cgaccccggc ctccacctcc tgctcctgcc 8460

cctcctgctc ctgcccctcc tcctgctcct gcccctcctg cccctcctgc tcctgcccct 8520

cctgcccctc ctgctcctgc ccctcctgcc cctcctgctc ctgcccctcc tgcccctcct 8580

cctgctcctg cccctcctgc ccctcctcct gctcctgccc ctcctgcccc tcctgctcct 8640

gcccctcctg cccctcctgc tcctgcccct cctgcccctc ctgctcctgc ccctcctgct 8700

cctgcccctc ctgctcctgc ccctcctgct cctgcccctc ctgcccctcc tgcccctcct 8760

cctgctcctg cccctcctgc tcctgcccct cctgcccctc ctgcccctcc tgctcctgcc 8820

cctcctcctg ctcctgcccc tcctgcccct cctgcccctc ctcctgctcc tgcccctcct 8880

gcccctcctc ctgctcctgc ccctcctcct gctcctgccc ctcctgcccc tcctgcccct 8940

cctcctgctc ctgcccctcc tgcccctcct cctgctcctg cccctcctcc tgctcctgcc 9000

cctcctgccc ctcctgcccc tcctcctgct cctgcccctc ctcctgctcc tgcccctcct 9060

gcccctcctg cccctcctgc ccctcctcct gctcctgccc ctcctcctgc tcctgcccct 9120

cctgctcctg cccctcccgc tcctgctcct gctcctgttc caccgtgggt ccctttgcag 9180

ccaatgcaac ttggacgttt ttggggtctc cggacaccat ctctatgtct tggccctgat 9240

cctgagccgc ccggggctcc tggtcttccg cctcctcgtc ctcgtcctct tccccgtcct 9300

cgtccatggt tatcaccccc tcttctttga ggtccactgc cgccggagcc ttctggtcca 9360

gatgtgtctc ccttctctcc taggccattt ccaggtcctg tacctggccc ctcgtcagac 9420

atgattcaca ctaaaagaga tcaatagaca tctttattag acgacgctca gtgaatacag 9480

ggagtgcaga ctcctgcccc ctccaacagc ccccccaccc tcatcccctt catggtcgct 9540

gtcagacaga tccaggtctg aaaattcccc atcctccgaa ccatcctcgt cctcatcacc 9600

aattactcgc agcccggaaa actcccgctg aacatcctca agatttgcgt cctgagcctc 9660

aagccaggcc tcaaattcct cgtccccctt tttgctggac ggtagggatg gggattctcg 9720

ggacccctcc tcttcctctt caaggtcacc agacagagat gctactgggg caacggaaga 9780

aaagctgggt gcggcctgtg aggatcagct tatcgatgat aagctgtcaa acatgagaat 9840

taattcttga agacgaaagg gcctcgtgat acgcctattt ttataggtta atgtcatgat 9900

aataatggtt tcttagacgt caggtggcac ttttcgggga aatgtgcgcg gaacccctat 9960

ttgtttattt ttctaaatac attcaaatat gtatccgctc atgagacaat aaccctgata 10020

aatgcttcaa taatattgaa aaaggaagag tatgagtatt caacatttcc gtgtcgccct 10080

tattcccttt tttgcggcat tttgccttcc tgtttttgct cacccagaaa cgctggtgaa 10140

agtaaaagat gctgaagatc agttgggtgc acgagtgggt tacatcgaac tggatctcaa 10200

cagcggtaag atccttgaga gttttcgccc cgaagaacgt tttccaatga tgagcacttt 10260

taaagttctg ctatgtggcg cggtattatc ccgtgttgac gccgggcaag agcaactcgg 10320

tcgccgcata cactattctc agaatgactt ggttgagtac tcaccagtca cagaaaagca 10380

tcttacggat ggcatgacag taagagaatt atgcagtgct gccataacca tgagtgataa 10440

cactgcggcc aacttacttc tgacaacgat cggaggaccg aaggagctaa ccgctttttt 10500

gcacaacatg ggggatcatg taactcgcct tgatcgttgg gaaccggagc tgaatgaagc 10560

cataccaaac gacgagcgtg acaccacgat gcctgcagca atggcaacaa cgttgcgcaa 10620

actattaact ggcgaactac ttactctagc ttcccggcaa caattaatag actggatgga 10680

ggcggataaa gttgcaggac cacttctgcg ctcggccctt ccggctggct ggtttattgc 10740

tgataaatct ggagccggtg agcgtgggtc tcgcggtatc attgcagcac tggggccaga 10800

tggtaagccc tcccgtatcg tagttatcta cacgacgggg agtcaggcaa ctatggatga 10860

acgaaataga cagatcgctg agataggtgc ctcactgatt aagcattggt aactgtcaga 10920

ccaagtttac tcatatatac tttagattga tttaaaactt catttttaat ttaaaaggat 10980

ctaggtgaag atcctttttg ataatctcat gaccaaaatc ccttaacgtg agttttcgtt 11040

ccactgagcg tcagaccccg tagaaaagat caaaggatct tcttgagatc ctttttttct 11100

gcgcgtaatc tgctgcttgc aaacaaaaaa accaccgcta ccagcggtgg tttgtttgcc 11160

ggatcaagag ctaccaactc tttttccgaa ggtaactggc ttcagcagag cgcagatacc 11220

aaatactgtc cttctagtgt agccgtagtt aggccaccac ttcaagaact ctgtagcacc 11280

gcctacatac ctcgctctgc taatcctgtt accagtggct gctgccagtg gcgataagtc 11340

gtgtcttacc gggttggact caagacgata gttaccggat aaggcgcagc ggtcgggctg 11400

aacggggggt tcgtgcacac agcccagctt ggagcgaacg acctacaccg aactgagata 11460

cctacagcgt gagctatgag aaagcgccac gcttcccgaa gggagaaagg cggacaggta 11520

tccggtaagc ggcagggtcg gaacaggaga gcgcacgagg gagcttccag ggggaaacgc 11580

ctggtatctt tatagtcctg tcgggtttcg ccacctctga cttgagcgtc gatttttgtg 11640

atgctcgtca ggggggcgga gcctatggaa aaacgccagc aacgcggcct ttttacggtt 11700

cctggccttt tgctggcctt gaagctgtcc ctgatggtcg tcatctacct gcctggacag 11760

catggcctgc aacgcgggca tcccgatgcc gccggaagcg agaagaatca taatggggaa 11820

ggccatccag cctcgcgtcg 11840

<210> 2

<211> 3313

<212> DNA

<213> artificial sequence

<400> 2

cctgcaggcc gccaccatgt ccaatttact gaccgtacac caaaatttgc ctgcattacc 60

ggtcgatgca acgagtgatg aggttcgcaa gaacctgatg gacatgttca gggatcgcca 120

ggcgttttct gagcatacct ggaaaatgct tctgtccgtt tgccggtcgt gggcggcatg 180

gtgcaagttg aataaccgga aatggtttcc cgcagaacct gaagatgttc gcgattatct 240

tctatatctt caggcgcgcg gtctggcagt aaaaactatc cagcaacatt tgggccagct 300

aaacatgctt catcgtcggt ccgggctgcc acgaccaagt gacagcaatg ctgtttcact 360

ggttatgcgg cggatccgaa aagaaaacgt tgatgccggt gaacgtgcaa aacaggctct 420

agcgttcgaa cgcactgatt tcgaccaggt tcgttcactc atggaaaata gcgatcgctg 480

ccaggatata cgtaatctgg catttctggg gattgcttat aacaccctgt tacgtatagc 540

cgaaattgcc aggatcaggg ttaaagatat ctcacgtact gacggtggga gaatgttaat 600

ccatattggc agaacgaaaa cgctggttag caccgcaggt gtagagaagg cacttagcct 660

gggggtaact aaactggtcg agcgatggat ttccgtctct ggtgtagctg atgatccgaa 720

taactacctg ttttgccggg tcagaaaaaa tggtgttgcc gcgccatctg ccaccagcca 780

gctatcaact cgcgccctgg aagggatttt tgaagcaact catcgattga tttacggcgc 840

taaggatgac tctggtcaga gatacctggc ctggtctgga cacagtgccc gtgtcggagc 900

cgcgcgagat atggcccgcg ctggagtttc aataccggag atcatgcaag ctggtggctg 960

gaccaatgta aatattgtca tgaactatat ccgtaacctg gatagtgaaa caggggcaat 1020

ggtgcgcctg ctggaagatg gcgatctcga gccatctgct ggagacatga gagctgccaa 1080

cctttggcca agcccgctca tgatcaaacg ctctaagaag aacagcctgg ccttgtccct 1140

gacggccgac cagatggtca gtgccttgtt ggatgctgag ccccccatac tctattccga 1200

gtatgatcct accagaccct tcagtgaagc ttcgatgatg ggcttactga ccaacctggc 1260

agacagggag ctggttcaca tgatcaactg ggcgaagagg gtgccaggct ttgtggattt 1320

gaccctccat gatcaggtcc accttctaga atgtgcctgg ctagagatcc tgatgattgg 1380

tctcgtctgg cgctccatgg agcacccagt gaagctactg tttgctccta acttgctctt 1440

ggacaggaac cagggaaaat gtgtagaggg catggtggag atcttcgaca tgctgctggc 1500

tacatcatct cggttccgca tgatgaatct gcagggagag gagtttgtgt gcctcaaatc 1560

tattattttg cttaattctg gagtgtacac atttctgtcc agcaccctga agtctctgga 1620

agagaaggac catatccacc gagtcctgga caagatcaca gacactttga tccacctgat 1680

ggccaaggca ggcctgaccc tgcagcagca gcaccagcgg ctggcccagc tcctcctcat 1740

cctctcccac atcaggcaca tgagtaacaa aggcatggag catctgtaca gcatgaagtg 1800

caagaacgtg gtgcccctct atgacctgct gctggaggcg gcggacgccc accgcctaca 1860

tgcgcccact agccgtggag gggcatccgt ggaggagacg gaccaaagcc acttggccac 1920

tgcgggctct acttcatcgc attccttgca aaagtattac atcacggggg aggcagaggg 1980

tttccctgcc acagcttgag gcgcgcccct ctccctcccc cccccctaac gttactggcc 2040

gaagccgctt ggaataaggc cggtgtgcgt ttgtctatat gttattttcc accatattgc 2100

cgtcttttgg caatgtgagg gcccggaaac ctggccctgt cttcttgacg agcattccta 2160

ggggtctttc ccctctcgcc aaaggaatgc aaggtctgtt gaatgtcgtg aaggaagcag 2220

ttcctctgga agcttcttga agacaaacaa cgtctgtagc gaccctttgc aggcagcgga 2280

accccccacc tggcgacagg tgcctctgcg gccaaaagcc acgtgtataa gatacacctg 2340

caaaggcggc acaaccccag tgccacgttg tgagttggat agttgtggaa agagtcaaat 2400

ggctctcctc aagcgtattc aacaaggggc tgaaggatgc ccagaaggta ccccattgta 2460

tgggatctga tctggggcct cggtacacat gctttacatg tgtttagtcg aggttaaaaa 2520

aacgtctagg ccccccgaac cacggggacg tggttttcct ttgaaaaaca cgatgataat 2580

atggccacaa cccatggtga gcaagggcga ggagctgttc accggggtgg tgcccatcct 2640

ggtcgagctg gacggcgacg taaacggcca caagttcagc gtgtccggcg agggcgaggg 2700

cgatgccacc tacggcaagc tgaccctgaa gttcatctgc accaccggca agctgcccgt 2760

gccctggccc accctcgtga ccaccctgac ctacggcgtg cagtgcttca gccgctaccc 2820

cgaccacatg aagcagcacg acttcttcaa gtccgccatg cccgaaggct acgtccagga 2880

gcgcaccatc ttcttcaagg acgacggcaa ctacaagacc cgcgccgagg tgaagttcga 2940

gggcgacacc ctggtgaacc gcatcgagct gaagggcatc gacttcaagg aggacggcaa 3000

catcctgggg cacaagctgg agtacaacta caacagccac aacgtctata tcatggccga 3060

caagcagaag aacggcatca aggtgaactt caagatccgc cacaacatcg aggacggcag 3120

cgtgcagctc gccgaccact accagcagaa cacccccatc ggcgacggcc ccgtgctgct 3180

gcccgacaac cactacctga gcacccagtc cgccctgagc aaagacccca acgagaagcg 3240

cgatcacatg gtcctgctgg agttcgtgac cgccgccggg atcactctcg gcatggacga 3300

gctgtacaag taa 3313

<210> 3

<211> 5427

<212> DNA

<213> artificial sequence

<400> 3

gacggatcgg gagatctccc gatcccctat ggtgcactct cagtacaatc tgctctgatg 60

ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120

cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180

ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240

gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300

tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360

cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420

attgacgtca atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt 480

atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540

atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600

tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660

actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720

aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780

gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840

ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900

gtttaaacgg gccctctaga ctcgagcggc cgccactgtg ctggatatct gcagaattcc 960

accacactgg actagtggat ccgagctcgg taccaagctt aagtttaaac cgctgatcag 1020

cctcgactgt gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct 1080

tgaccctgga aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc 1140

attgtctgag taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg 1200

aggattggga agacaatagc aggcatgctg gggatgcggt gggctctatg gcttctgagg 1260

cggaaagaac cagctggggc tctagggggt atccccacgc gccctgtagc ggcgcattaa 1320

gcgcggcggg tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc 1380

ccgctccttt cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag 1440

ctctaaatcg ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca 1500

aaaaacttga ttagggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc 1560

gccctttgac gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa 1620

cactcaaccc tatctcggtc tattcttttg atttataagg gattttgccg atttcggcct 1680

attggttaaa aaatgagctg atttaacaaa aatttaacgc gaattaattc tgtggaatgt 1740

gtgtcagtta gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat 1800

gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag 1860

tatgcaaagc atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat 1920

cccgccccta actccgccca gttccgccca ttctccgccc catggctgac taattttttt 1980

tatttatgca gaggccgagg ccgcctctgc ctctgagcta ttccagaagt agtgaggagg 2040

cttttttgga ggcctaggct tttgcaaaaa gctcccggga gcttgtatat ccattttcgg 2100

atctgatcaa gagacaggat gaggatcgtt tcgcatgatt gaacaagatg gattgcacgc 2160

aggttctccg gccgcttggg tggagaggct attcggctat gactgggcac aacagacaat 2220

cggctgctct gatgccgccg tgttccggct gtcagcgcag gggcgcccgg ttctttttgt 2280

caagaccgac ctgtccggtg ccctgaatga actgcaggac gaggcagcgc ggctatcgtg 2340

gctggccacg acgggcgttc cttgcgcagc tgtgctcgac gttgtcactg aagcgggaag 2400

ggactggctg ctattgggcg aagtgccggg gcaggatctc ctgtcatctc accttgctcc 2460

tgccgagaaa gtatccatca tggctgatgc aatgcggcgg ctgcatacgc ttgatccggc 2520

tacctgccca ttcgaccacc aagcgaaaca tcgcatcgag cgagcacgta ctcggatgga 2580

agccggtctt gtcgatcagg atgatctgga cgaagagcat caggggctcg cgccagccga 2640

actgttcgcc aggctcaagg cgcgcatgcc cgacggcgag gatctcgtcg tgacccatgg 2700

cgatgcctgc ttgccgaata tcatggtgga aaatggccgc ttttctggat tcatcgactg 2760

tggccggctg ggtgtggcgg accgctatca ggacatagcg ttggctaccc gtgatattgc 2820

tgaagagctt ggcggcgaat gggctgaccg cttcctcgtg ctttacggta tcgccgctcc 2880

cgattcgcag cgcatcgcct tctatcgcct tcttgacgag ttcttctgag cgggactctg 2940

gggttcgaaa tgaccgacca agcgacgccc aacctgccat cacgagattt cgattccacc 3000

gccgccttct atgaaaggtt gggcttcgga atcgttttcc gggacgccgg ctggatgatc 3060

ctccagcgcg gggatctcat gctggagttc ttcgcccacc ccaacttgtt tattgcagct 3120

tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc atttttttca 3180

ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt ctgtataccg 3240

tcgacctcta gctagagctt ggcgtaatca tggtcatagc tgtttcctgt gtgaaattgt 3300

tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa agcctggggt 3360

gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc tttccagtcg 3420

ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag aggcggtttg 3480

cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt cgttcggctg 3540

cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga atcaggggat 3600

aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc 3660

gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa aaatcgacgc 3720

tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt tccccctgga 3780

agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct gtccgccttt 3840

ctcccttcgg gaagcgtggc gctttctcat agctcacgct gtaggtatct cagttcggtg 3900

taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc 3960

gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt atcgccactg 4020

gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc tacagagttc 4080

ttgaagtggt ggcctaacta cggctacact agaagaacag tatttggtat ctgcgctctg 4140

ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa acaaaccacc 4200

gctggtagcg gtttttttgt ttgcaagcag cagattacgc gcagaaaaaa aggatctcaa 4260

gaagatcctt tgatcttttc tacggggtct gacgctcagt ggaacgaaaa ctcacgttaa 4320

gggattttgg tcatgagatt atcaaaaagg atcttcacct agatcctttt aaattaaaaa 4380

tgaagtttta aatcaatcta aagtatatat gagtaaactt ggtctgacag ttaccaatgc 4440

ttaatcagtg aggcacctat ctcagcgatc tgtctatttc gttcatccat agttgcctga 4500

ctccccgtcg tgtagataac tacgatacgg gagggcttac catctggccc cagtgctgca 4560

atgataccgc gagacccacg ctcaccggct ccagatttat cagcaataaa ccagccagcc 4620

ggaagggccg agcgcagaag tggtcctgca actttatccg cctccatcca gtctattaat 4680

tgttgccggg aagctagagt aagtagttcg ccagttaata gtttgcgcaa cgttgttgcc 4740

attgctacag gcatcgtggt gtcacgctcg tcgtttggta tggcttcatt cagctccggt 4800

tcccaacgat caaggcgagt tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc 4860

ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag tgttatcact catggttatg 4920

gcagcactgc ataattctct tactgtcatg ccatccgtaa gatgcttttc tgtgactggt 4980

gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg 5040

gcgtcaatac gggataatac cgcgccacat agcagaactt taaaagtgct catcattgga 5100

aaacgttctt cggggcgaaa actctcaagg atcttaccgc tgttgagatc cagttcgatg 5160

taacccactc gtgcacccaa ctgatcttca gcatctttta ctttcaccag cgtttctggg 5220

tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa taagggcgac acggaaatgt 5280

tgaatactca tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc 5340

atgagcggat acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca 5400

tttccccgaa aagtgccacc tgacgtc 5427

<210> 4

<211> 182

<212> DNA

<213> artificial sequence

<400> 4

cctaactccg cccatcccgc ccctaactcc gcccagttcc gcccattctc cgccccatgg 60

ctgactaatt ttttttattt atgcagaggc cgaggccgcc tctgcctctg agctattcca 120

gaagtagtga ggaggctttt ttggaggcct aggcttttgc aaaaagctcc cgggagcttg 180

ta 182

<210> 5

<211> 2476

<212> DNA

<213> artificial sequence

<400> 5

aattgaaccg gtgcctagag aaggtggcgc ggggtaaact gggaaagtga tgtcgtgtac 60

tggctccgcc tttttcccga gggtggggga gaaccgtata taagtgcagt agtcgccgtg 120

aacgttcttt ttcgcaacgg gtttgccgcc agaacacagg taagtgccgt gtgtggttcc 180

cgcgggcctg gcctctttac gggttatggc ccttgcgtgc cttgaattac ttccacctgg 240

ctccagtacg tgattcttga tcccgagctg gagccagggg cgggccttgc gctttaggag 300

ccccttcgcc tcgtgcttga gttgaggcct ggcctgggcg ctggggccgc cgcgtgcgaa 360

tctggtggca ccttcgcgcc tgtctcgctg ctttcgataa gtctctagcc atttaaaatt 420

tttgatgacc tgctgcgacg ctttttttct ggcaagatag tcttgtaaat gcgggccagg 480

atctgcacac tggtatttcg gtttttgggc ccgcggccgg cgacggggcc cgtgcgtccc 540

agcgcacatg ttcggcgagg cggggcctgc gagcgcggcc accgagaatc ggacgggggt 600

agtctcaagc tggccggcct gctctggtgc ctggcctcgc gccgccgtgt atcgccccgc 660

cctgggcggc aaggctggcc cggtcggcac cagttgcgtg agcggaaaga tggccgcttc 720

ccggccctgc tccagggggc tcaaaatgga ggacgcggcg ctcgggagag cgggcgggtg 780

agtcacccac acaaaggaaa agggcctttc cgtcctcagc cgtcgcttca tgtgactcca 840

cggagtaccg ggcgccgtcc aggcacctcg attagttctg gagcttttgg agtacgtcgt 900

ctttaggttg gggggagggg ttttatgcga tggagtttcc ccacactgag tgggtggaga 960

ctgaagttag gccagcttgg cacttgatgt aattctcgtt ggaatttgcc ctttttgagt 1020

ttggatcttg gttcattctc aagcctcaga cagtggttca aagttttttt cttccatttc 1080

aggtgtcgtg aacacgtggt cgcggccaat tctgcagtcg agctcaagct tcctgcaggc 1140

cgccaccatg tccaatttac tgaccgtaca ccaaaatttg cctgcattac cggtcgatgc 1200

aacgagtgat gaggttcgca agaacctgat ggacatgttc agggatcgcc aggcgttttc 1260

tgagcatacc tggaaaatgc ttctgtccgt ttgccggtcg tgggcggcat ggtgcaagtt 1320

gaataaccgg aaatggtttc ccgcagaacc tgaagatgtt cgcgattatc ttctatatct 1380

tcaggcgcgc ggtctggcag taaaaactat ccagcaacat ttgggccagc taaacatgct 1440

tcatcgtcgg tccgggctgc cacgaccaag tgacagcaat gctgtttcac tggttatgcg 1500

gcggatccga aaagaaaacg ttgatgccgg tgaacgtgca aaacaggctc tagcgttcga 1560

acgcactgat ttcgaccagg ttcgttcact catggaaaat agcgatcgct gccaggatat 1620

acgtaatctg gcatttctgg ggattgctta taacaccctg ttacgtatag ccgaaattgc 1680

caggatcagg gttaaagata tctcacgtac tgacggtggg agaatgttaa tccatattgg 1740

cagaacgaaa acgctggtta gcaccgcagg tgtagagaag gcacttagcc tgggggtaac 1800

taaactggtc gagcgatgga tttccgtctc tggtgtagct gatgatccga ataactacct 1860

gttttgccgg gtcagaaaaa atggtgttgc cgcgccatct gccaccagcc agctatcaac 1920

tcgcgccctg gaagggattt ttgaagcaac tcatcgattg atttacggcg ctaaggatga 1980

ctctggtcag agatacctgg cctggtctgg acacagtgcc cgtgtcggag ccgcgcgaga 2040

tatggcccgc gctggagttt caataccgga gatcatgcaa gctggtggct ggaccaatgt 2100

aaatattgtc atgaactata tccgtaacct ggatagtgaa acaggggcaa tggtgcgcct 2160

gctggaagat ggcgatctcg agccatctgc tggagacatg agagctgcca acctttggcc 2220

aagcccgctc atgatcaaac gctctaagaa gaacagcctg gccttgtccc tgacggccga 2280

ccagatggtc agtgccttgt tggatgctga gccccccata ctctattccg agtatgatcc 2340

taccagaccc ttcagtgaag cttcgatgat gggcttactg accaacctgg cagacaggga 2400

gctggttcac atgatcaact gggcgaagag ggtgccaggc tttgtggatt tgaccctcca 2460

tgatcaggtc cacctt 2476

<210> 6

<211> 1983

<212> DNA

<213> artificial sequence

<400> 6

agatctaaat aaacttataa attgtgagag aaattaatga atgtctaagt taatgcagaa 60

acggagagac atactatatt catgaactaa aagacttaat attgtgaagg tatactttct 120

ttccacataa atttgtagtc aatatgttca ccccaaaaaa gctgtttgtt aacttgccaa 180

cctcattcta aaatgtatat agaagcccaa aagacaataa caaaaatatt cttgtagaac 240

aaaatgggaa agaatgttcc actaaatatc aagatttaga gcaaagcatg agatgtgtgg 300

ggatagacag tgaggctgat aaaatagagt agagctcaga aacagaccca ttgatatatg 360

taagtgacct atgaaaaaaa tatggcattt tacaatggga aaatgatgat ctttttcttt 420

tttagaaaaa cagggaaata tatttatatg taaaaaataa aagggaaccc atatgtcata 480

ccatacacac aaaaaaattc cagtgaatta taagtctaaa tggagaaggc aaaactttaa 540

atcctttaga aaataatata gaagcatgcc atcatgactt cagtgtagag aaaaatttct 600

tatgactcaa agtcctaacc acaaagaaaa gattgttaat tagattgcat gaatattaag 660

acttattttt aaaattaaaa aaccattaag aaaagtcagg ccatagaatg acagaaaata 720

tttgcaacac cccagtaaag agaattgtaa tatgcagatt ataaaaagaa gtcttacaaa 780

tcagtaaaaa ataaaactag acaaaaattt gaacagatga aagagaaact ctaaataatc 840

attacacatg agaaactcaa tctcagaaat cagagaacta tcattgcata tacactaaat 900

tagagaaata ttaaaaggct aagtaacatc tgtggcaata ttgatggtat ataaccttga 960

tatgatgtga tgagaacagt actttacccc atgggcttcc tccccaaacc cttaccccag 1020

tataaatcat gacaaatata ctttaaaaac cattacccta tatctaacca gtactcctca 1080

aaactgtcaa ggtcatcaaa aataagaaaa gtctgaggaa ctgtcaaaac taagaggaac 1140

ccaaggagac atgagaatta tatgtaatgt ggcattctga atgagatccc agaacagaaa 1200

aagaacagta gctaaaaaac taatgaaata taaataaagt ttgaacttta gtttttttta 1260

aaaaagagta gcattaacac ggcaaagcca ttttcatatt tttcttgaac attaagtaca 1320

agtctataat taaaaatttt ttaaatgtag tctggaacat tgccagaaac agaagtacag 1380

cagctatctg tgctgtcgcc taactatcca tagctgattg gtctaaaatg agatacatca 1440

acgctcctcc atgttttttg ttttcttttt aaatgaaaaa ctttattttt taagaggagt 1500

ttcaggttca tagcaaaatt gagaggaagg tacattcaag ctgaggaagt tttcctctat 1560

tcctagttta ctgagagatt gcatcatgaa tgggtgttaa attttgtcaa atgctttttc 1620

tgtgtctatc aatatgacca tgtgattttc ttctttaacc tgttgatggg acaaattacg 1680

ttaattgatt ttcaaacgct gaaccaccct tacatatctg gaataaattc tacttggttg 1740

tggtgtatat tttttgatac attcttggat tctttttgct aatattttgt tgaaaatgtt 1800

tgtatctttg ttcatgagag atattggtct gttgttttct tttcttgtaa tgtcattttc 1860

tagttccggt attaaggtaa tgctggccta gttgaatgat ttaggaagta ttccctctgc 1920

ttctgtcttc tgaaagagat tgtagaaagt tgatacaatt tttttttctt taaatatttg 1980

ata 1983

<210> 7

<211> 1110

<212> DNA

<213> artificial sequence

<400> 7

ttaagataac ttcgtatagc atacattata cgaagttatt ttaaaccgct gatcagcctc 60

gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc cttccttgac 120

cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg catcgcattg 180

tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca agggggagga 240

ttgggaagac aatagcaggc atgctgggga tgcggtgggc tctatggctt ctgaggcgga 300

aagaaccagc tggggctcta gggggtatcc ccacgcgccc tgtagcggcg cattaagcgc 360

ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc tagcgcccgc 420

tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc gtcaagctct 480

aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg accccaaaaa 540

acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg tttttcgccc 600

tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg gaacaacact 660

caaccctatc tcggtctatt cttttgattt ataagggatt ttgccgattt cggcctattg 720

gttaaaaaat gagctgattt aacaaaaatt taacgcgaat taattctgtg gaatgtgtgt 780

cagttagggt gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat 840

ctcaattagt cagcaaccag gtgtggaaag tccccaggct ccccagcagg cagaagtatg 900

caaagcatgc atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg 960

cccctaactc cgcccagttc cgcccattct ccgccccatg gctgactaat tttttttatt 1020

tatgcagagg ccgaggccgc ctctgcctct gagctattcc agaagtagtg aggaggcttt 1080

tttggaggcc taggcttttg caaaaagctc 1110

<210> 8

<211> 34

<212> DNA

<213> artificial sequence

<400> 8

ataacttcgt atagcataca ttatacgaag ttat 34

<210> 9

<211> 1171

<212> DNA

<213> artificial sequence

<400> 9

aattgataac ttcgtatagc atacattata cgaagttata accggtgcct agagaaggtg 60

gcgcggggta aactgggaaa gtgatgtcgt gtactggctc cgcctttttc ccgagggtgg 120

gggagaaccg tatataagtg cagtagtcgc cgtgaacgtt ctttttcgca acgggtttgc 180

cgccagaaca caggtaagtg ccgtgtgtgg ttcccgcggg cctggcctct ttacgggtta 240

tggcccttgc gtgccttgaa ttacttccac ctggctccag tacgtgattc ttgatcccga 300

gctggagcca ggggcgggcc ttgcgcttta ggagcccctt cgcctcgtgc ttgagttgag 360

gcctggcctg ggcgctgggg ccgccgcgtg cgaatctggt ggcaccttcg cgcctgtctc 420

gctgctttcg ataagtctct agccatttaa aatttttgat gacctgctgc gacgcttttt 480

ttctggcaag atagtcttgt aaatgcgggc caggatctgc acactggtat ttcggttttt 540

gggcccgcgg ccggcgacgg ggcccgtgcg tcccagcgca catgttcggc gaggcggggc 600

ctgcgagcgc ggccaccgag aatcggacgg gggtagtctc aagctggccg gcctgctctg 660

gtgcctggcc tcgcgccgcc gtgtatcgcc ccgccctggg cggcaaggct ggcccggtcg 720

gcaccagttg cgtgagcgga aagatggccg cttcccggcc ctgctccagg gggctcaaaa 780

tggaggacgc ggcgctcggg agagcgggcg ggtgagtcac ccacacaaag gaaaagggcc 840

tttccgtcct cagccgtcgc ttcatgtgac tccacggagt accgggcgcc gtccaggcac 900

ctcgattagt tctggagctt ttggagtacg tcgtctttag gttgggggga ggggttttat 960

gcgatggagt ttccccacac tgagtgggtg gagactgaag ttaggccagc ttggcacttg 1020

atgtaattct cgttggaatt tgcccttttt gagtttggat cttggttcat tctcaagcct 1080

cagacagtgg ttcaaagttt ttttcttcca tttcaggtgt cgtgaacacg tggtcgcggc 1140

caattctgca gtcgagctca agcttcctgc a 1171

<210> 10

<211> 52

<212> DNA

<213> artificial sequence

<400> 10

gcttagaagc ttcctgcagg ccgccaccat gtccaattta ctgaccgtac ac 52

<210> 11

<211> 38

<212> DNA

<213> artificial sequence

<400> 11

gcttagggcg cgcctcaagc tgtggcaggg aaaccctc 38

<210> 12

<211> 27

<212> DNA

<213> artificial sequence

<400> 12

gcttagggcg cgcccctctc cctcccc 27

<210> 13

<211> 32

<212> DNA

<213> artificial sequence

<400> 13

gcttagggat ccgtcgactt acttgtacag ct 32

<210> 14

<211> 26

<212> DNA

<213> artificial sequence

<400> 14

gctagccctg caggccgcca ccatgt 26

<210> 15

<211> 28

<212> DNA

<213> artificial sequence

<400> 15

gcggccgctt acttgtacag ctcgtcca 28

<210> 16

<211> 20

<212> DNA

<213> artificial sequence

<400> 16

aacaggaagc acaatgccca 20

<210> 17

<211> 37

<212> DNA

<213> artificial sequence

<400> 17

aaggaaaaaa gcggccgcag atctaaataa acttata 37

<210> 18

<211> 66

<212> DNA

<213> artificial sequence

<400> 18

gcggcccaat tgataacttc gtatagcata cattatacga agttatcatg aagaatctgc 60

ttaggg 66

<210> 19

<211> 20

<212> DNA

<213> artificial sequence

<400> 19

gagcacagct gcgcaaggaa 20

 

Claims (10)

1. a unconformability non-virus carrier, it is characterized in that, described non-virus carrier comprises S/MAR sequence, SV40 replication origin and Cre-ERT2 expressed sequence, the upstream and downstream of described S/MAR sequence has a loxP sequence respectively, two loxP directions are identical, and one of them loxP sequence is between S/MAR sequence and SV40 replication origin.

2. non-virus carrier according to claim 1, is characterized in that, described non-virus carrier also comprises external source goal gene, preferably EGFP.

3. non-virus carrier according to claim 2, is characterized in that, described S/MAR sequence, Cre-ERT2 expressed sequence and external source goal gene share promotor and terminator, and described promotor is preferably the promotor of eukaryotic expression.

4. non-virus carrier according to claim 3, is characterized in that, described Cre-ERT2 expressed sequence is connected with external source goal gene IRES sequence.

5. non-virus carrier according to claim 3, is characterized in that, a LoxP sequence connects in described promotor upstream, and another loxP sequence connects in the downstream of S/MAR sequence.

6. non-virus carrier according to claim 1, it is characterized in that, described S/MAR sequence is as shown in SEQ ID NO.6, the sequence of described SV40 replication origin is as shown in SEQ ID NO.4, described Cre-ERT2 expressed sequence is as shown in SEQ ID NO.2, described loxP sequence and SEQ ID NO.8 have 85%-100% similarity, and preferred LoxP sequence is as shown in SEQ ID NO.8.

7. non-virus carrier according to claim 1, is characterized in that, it builds by the following method:

A) from the pEP4-Cre-EGFP plasmid of sequence as shown in SEQ ID NO.1, Cre-ERT2-IRES-EGFP fragment is cloned,

B) Cre-ERT2-IRES-EGFP fragment is inserted the CMV Promoter downstream of pcDNA3.1 (-) plasmid, obtains pcDNA-Cre-EGFP plasmid,

C) pECG plasmid is obtained with the CMV Promoter that EF1 α Promoter replaces in pcDNA-Cre-EGFP,

D) S/MAR fragment is inserted in pECG carrier, obtains pECG-S/MAR plasmid,

E) primer shown in SEQ ID NO.18 and SEQ ID NO.19 is utilized with pECG-S/MAR plasmid for template clones Afl II-LoxP fragment,

F) by pECG-S/MAR plasmid and Afl II-LoxP fragment Afl II and Xma I double digestion, pECG-S/MAR carrier and Afl II-LoxP-XmaI fragment is obtained respectively,

G) Afl II-LoxP-Xma I fragment is inserted in pECG-S/MAR carrier, obtains pECG-S/MAR-Afl IILoxP plasmid,

H) hold with the EF1 α promoter 5 ' that another loxP to be inserted into pECG-S/MAR-Afl IILoxP plasmid by the method same with step g), obtain pECG-S/MAR-LoxP.

8. non-virus carrier according to claim 1, is characterized in that, described non-virus carrier also has drug selectable marker gene and/or real-time riddled basins.

9. the construction process of a non-virus carrier according to claim 1, it is characterized in that, comprise the following steps: S/MAR sequence, SV40 replication origin, Cre-ERT2 expressed sequence are implemented in skeleton carrier, and respectively insert a loxP sequence in the upstream and downstream of described S/MAR sequence, ensure that one of them loxP sequence is between S/MAR sequence and SV40 replication origin simultaneously.

10. the purposes of the arbitrary described non-virus carrier of claim 1-9, is characterized in that, enter host cell for mediating external source goal gene and express in host cell.