CN105002184B - A kind of application of the germline SCN11A genes in diagnosing chip is prepared that make a variation - Google Patents

Abstract

The present invention provides a kind of SCN11A genes of variation, the i.e. ictal pain Disease-causing gene SCN11A of mankind's peripheral nerve, it is characterised in that the 673rd bit base of the SCN11A genes of the variation is T by the C variations of wild type；Or the 2423rd bit base of the SCN11A genes of the variation is G by the C variations of wild type.Present invention also offers a kind of detect to derive from the mutation method and detection kit that whether there is the gene in human-body biological sample.The mankind SCN11A genes of variation provided by the invention can be used for preparing the ictal pain genes diagnosing chip of mankind's peripheral nerve, and the protein of mankind's SCN11A coded by said gene of variation can be as the drug target of the treatment ictal pain of mankind's peripheral nerve.

Description

A kind of application of the germline SCN11A genes in diagnosing chip is prepared that make a variation

The application is the divisional application of 201310070553X patent applications.Original applying number is 201310070553X；It is former The applying date is on March 6th, 2013；The ictal pain Disease-causing gene of the entitled mankind's peripheral nerve of original and its encoding proteins. The application is to overcome that is pointed out in second of notification of examiner's opinion for 201310070553X patent applications not meet Monistic two division of opinion.

Technical field

The present invention relates to a kind of gene of human variation, the i.e. ictal pain Disease-causing gene SCN11A of mankind's peripheral nerve. The invention further relates to the albumen of this mutant gene and its coding to detect and be used as the treatment ictal pain of mankind's peripheral nerve Function and significance in the drug target of disease.

Background technology

Pain is the caused sensation when human body is subject to various noxious stimulations, be present in the warning of inside of human body with Protection system, it can cause body to produce passivity defense reaction to hide noxious stimulus, have protective effect to body.But Excessive noxious stimulation not only can cause strong sensation of pain but also also result in the disorder of body physiological function, or even stop Gram.Human painful is divided into Acute Pain and chronic ache, and acute pain is that human body escapes injury, and is the physiological early warning of tissue damage Signal.But chronic ache is a kind of pathological state, according to pain pathomechanism, chronic ache can be divided into nocuity or inflammatory Pain (to the appropriate reaction of pain stimulation) and neuropathic pain (the inappropriate reaction induced by nervous system damage).1994 states Border pain research association neuropathic pain (neurogenic pain) is defined as " surrounding or central nervous system primary or after Pain caused by the infringement of hair property or dysfunction or of short duration disorder ".Neuropathic pain is always to perplex the problem of medical field, morbidity Mechanism is not fully aware of.Peripheral neuropathic pain is often related to the signal transmission of minor diameter nerve fibre, have now been found that three kinds of sodium from Subchannel albumen Nav1.7, Nav1.8 and Nav1.9 great expression in peripheral nerve, 2004 years Chinese Academy of Medical Sciences Beijing The researchers such as Union Medical College Shen Yan academician are from genetically by the acquired function mutation of Nav1.7 sodium-ion channel albumen and people Class pain associates, other research groups of the subsequent world find that the patient of 30% minor diameter nerve fibre pain is by the albumen Caused by acquired function mutation.The research group that October 31, medical college of Yale Waxman was led in 2012 Team, the acquired function mutation of 7 Nav1.8 sodium-ion channel albumen is found in 104 congenital neuralgia patients, is accounted for 6.7%.But the pathogenesis of also many pain patients is unclear.

The content of the invention

The task of the present invention is the SCN11A genes and its protein of coding for providing a kind of variation.

Another task of the present invention is to provide the method and kit of detection mankind's SCN11A gene mutations.

The SCN11A genes that another task of the present invention is to provide this variation are ictal in preparation mankind's peripheral nerve Application in pain genes diagnosing chip.

Realize the technical scheme is that：

The SCN11A genes of variation provided by the invention are：

(1) the 673rd bit base of the SCN11A genes of the variation is T by the C variations of wild type, its nucleotides sequence is classified as SEQ ID NO：Shown in 3；

(2) the 2423rd bit base of the SCN11A genes of the variation is G by the C variations of wild type, its nucleotides sequence is classified as SEQ ID NO：Shown in 5.

The amino acid sequence of its encoded protein is respectively SEQ ID NO：Shown in 4 and 6 (p.R225C, p.A808G).The protein can be as the drug target of the treatment ictal pain of mankind's peripheral nerve.Variation provided by the invention Mankind SCN11A genes can be used for prepare the ictal pain genes diagnosing chip of mankind's peripheral nerve.

The kit of detection mankind's SCN11A gene mutations provided by the invention, containing a pair in following 21 pairs of primers or Several pairs or whole：

Mentioned reagent box can also contain Taq enzyme, PCR reaction buffers and/or dNTP.

The kit of the 673rd bit base of vitro detection SCN11A genes mutation provided by the invention, contains following primer thing：

F:5'CAAGCCCATGCCTTCCCTGT 3'

R:5'TTGCTTTCAAAGCTCTGAACACCC 3'

The kit can also contain Taq enzyme, PCR reaction buffers, dNTP, restriction enzyme Bcn I and/or Hind III。

The kit of the 2423rd bit base of vitro detection SCN11A genes mutation provided by the invention, contains following primer Thing：

F:5'ATCCCATTCTGCTTTACCCT 3'

R:5'CCGCCGTGAGCAAAGGAAC3'。

The kit can also contain Taq enzyme, PCR reaction buffers, dNTP, restriction enzyme Bcn I and/or Hind III。

The SCN11A genes of variation provided by the invention, are the ictal pain Disease-causing genes of mankind's peripheral nerve, that is, find The gene mutation site of the disease, the base that whether there is the mutation in human body is can detect using the gene mutation site of the disease Cause.The present invention provides nerve caused by the peripheral nerve protein sequence that ictal pain Disease-causing gene encodes and its mutation at the same time Metaaction Electric spike number increases, and provides the foundation to illustrate the sick mechanism of causing a disease, is provided further to treat the disease The target spot of design medicine.

The present invention collect and identify the big family of two peripheral nerves ictal pain China (one comes from Tonghua, Jilin Province, One comes from Hebei-Beijing), chain point of microsatellite marker full-length genome very is carried out to the big family of pain from Tonghua, Jilin Province Analysis, i.e. 3p22.3-22.1 sites are positioned on No. 3 the short arm of a chromosome by the Disease-causing gene of this family, about 8Mb physical maps away from Chromosome segment.To also interlocking in above-mentioned section from Hebei-Beijing family linkage analysis, the Disease-causing gene of the family.

Present invention selection Tonghua, Jilin Province pain family propositus's DNA sample, carries out sequencing of extron group, in positioning area to it (3p22.3-22.1) has found SCN11A one point mutation of gene in domain；Sanger sequencings are carried out to Hebei-Beijing family patient, It was found that another point mutation of the gene.Two above-mentioned mutation obtain in respective family in the DNA sample of all patients respectively To verification, above-mentioned mutation is not present in the normal member of family, 1021 Hans populations, it is polymorphic to eliminate single nucleotide acid The possibility of property.Find that the two mutation cause encoded amino acid change at the same time, thus,

The present invention provides 2 kinds such as SEQ ID NO：Mankind's SCN11A genes of variation, its feature exist respectively shown in 3 and 5 In described the 673rd cytimidine in SCN11A gene coding regions replaces (C by thymidine>T), 2423 cytosine bases are by bird Purine replaces (C>G).The nucleotide sequence such as SEQ ID NO of normal mankind's SCN11A genes：Shown in 1.

The present invention provides 2 kinds such as SEQ ID NO：The protein of mankind's SCN11A coded by said gene of variation shown in 4 and 6 Sequence, its feature are that the amino acid sequence of SCN11A albumen is that the 225th arginine is changed into cysteine respectively respectively (p.R225C), the alanine of the 808th is changed into glycine (p.A808G).The albumen of normal mankind's SCN11A coded by said gene The amino acid sequence of matter such as SEQ ID NO：Shown in 2.

Present invention also offers a kind of detect to derive from the method that whether there is said gene mutation in human-body biological sample, Its step：

(1) DNA sample material is extracted from sample to be detected；

(2) corresponding primer (being shown in Table 1) is chosen, polymerase chain amplification (PCR) reaction is carried out to the DNA sample, obtains PCR Product；

(3) nucleotide sequencing is carried out to the PCR product, with SEQ ID NO：1 sequence alignment, to determine the life Whether contain SCN11A gene mutations in thing sample.

Preferably, the biological specimen is body fluid, which includes but not limited to：Blood, blood plasma, serum, amniotic fluid etc..

Preferably, the body fluid is blood.

Preferably, the primer pair that uses is in above-mentioned PCR reactions：SEQ ID NO：7 and 8；9 and 10；11 and 12；13 Hes 14；15 and 16；17 and 18；19 and 20；21 and 22；23 and 24；25 and 26；27 and 28；29 and 30；31 and 32；33 and 34；35 Hes 36；37 and 38；39 and 40；41 and 42；43 and 44；45 and 46；47 and 48 primer pair amplifies corresponding nucleotide sequence.

Present invention also offers the method in the biological specimen of detection source human body with the presence or absence of above two mutation, it is walked Suddenly include：

(1) DNA is extracted from the sample；

(2) polymerase chain amplification (PCR) reaction is carried out to the DNA, obtains PCR product；

(3) digestion with restriction enzyme is carried out to the PCR product；

(4) to the digestion products into row agarose gel electrophoresis, electrophoretogram of observing and take pictures in the UV lamp, with table 2 Related digestion primer size compares, and determines whether be mutated in the biological specimen containing SCN11A genes above two.

Preferably, the body fluid is blood or amniotic fluid.

Preferably, the primer pair that uses is in above-mentioned PCR reactions：SEQ ID NO：49 and 50；51 and 52

Preferably, 2 kinds of restriction enzyme Bcn I and the Hind III used in above-mentioned PCR product.

Present invention also offers the mankind SCN11A gene functions change of variation, as shown in Figure 5, the egg of the gene code It is white to be distributed across sodium-ion channel α subunit 11s on cell membrane, maintain the generation of cell follow current to play an important role, SCN11A bases Because mutation causes the sodium-ion channel increased activity, so as to cause cell to increase (see embodiment 4) to the sensitiveness of stimulation, cause Related sensory neuron action potential is quickly provided and induced pain.Therefore mankind SCN11A mutant genes can be as the target of medicine Point, exploitation associated medication therapies human pain provide scientific basis.

The site of the SCN11A gene orders variation provided according to the present invention, people is derived from using detection provided by the invention It whether there is the mutation method of the gene in the biological specimen of body, to the ictal all individuals of pain family of two peripheral nerves Carry out abrupt climatic change.It turns out that two missense mutation, and there is no upper in the normal member of family, 1021 normal Han nationality individuals State mutation.Prove that method provided by the invention being capable of Precise Diagnosis ictal chronic ache disease as caused by SCN11A gene mutations Disease.At the same time to the encoded protein of the gene mutation carry out functional analysis, find SCN11A mutation can cause cell membrane sodium from Subchannel increased activity, so as to cause cell to increase the sensitiveness of stimulation, causes the fast of related sensory neuron action potential Speed is provided and induced pain.On the one hand whether it is offer etiological diagnosis foundation caused by the gene mutation for pain patients；On the other hand Drug target is provided to treat such pain disease.

The present invention have collected two big ictal pain familys of Chinese peripheral nerve, pass through linkage analysis, extron group The 3rd paravoltage dependent sodium channel gene SCN11A mutation of the scientific discoveries such as sequencing, restriction endonuclease analysis is to cause peripheral nerve to be sent out The reason for property made pain, gene code Nav1.9 albumen, genetic diagnosis, medicine of its discovery to the ictal pain of peripheral nerve The research and development and treatment of thing have particularly significant theory and practice meaning.

Brief description of the drawings

Below will the present invention is further illustrated by embodiment and attached drawing.

The pedigree of Fig. 1 Tonghua, Jilin Provinces (a) and the ictal pain family of Hebei-Beijing (b) peripheral nerve, arrow are represented and first demonstrate,proved Person.

Fig. 2 is the ictal pain family Disease-causing gene of peripheral nerve in the localization region of No. 3 chromosome.

Fig. 3 is 2 mutant nucleotide sequence SEQ ID NO of SCN11A genes：3 and 5 and normal sequence SEQ ID NO：1 in mutation position The contrast schematic diagram of point, arrow represent that starting position or mutated site occur for mutation：A, mutation occur in the 673rd cytimidine quilt Thymidine replaces (C>T)；B, mutation occur to replace (C by guanine in the 2423rd cytosine base>G).

Fig. 4 is Tonghua, Jilin Province family (figure a) and Hebei-Beijing family (figure b) mutation proof diagram.Show related mutation and the family It is that disease isolates.

Fig. 5 inventor's discovery SCN11A genes wild type and two mutation transfected dorsal nerve roots cells produce dynamic Make potential change.Represent under the same conditions, it is more than wild type that two mutant action potentials provide number.

Embodiment

Embodiment 1：The positioning of the ictal pain pathogenic sites of peripheral nerve

1st, family is collected and identified：Inventor is divided by carrying out medical inspection and clinical diagnosis to levy person and its family The ictal pain family of peripheral nerve of two autosomal dominant inheritances is not acquired in Tonghua, Jilin Province and Hebei-Beijing.It is lucky Woods Tonghua family five generations, 19 patients such as Fig. 1 a, gather 16 parts of peripheral blood samples of the family；Five generation of Hebei-Beijing family, 10 trouble Person such as Fig. 1 b, gather 13 parts of peripheral blood samples of the family.

2nd, extracting genome DNA：Extracted using the Wizard Genomic DNA extraction kits of Promega companies of the U.S. Peripheral blood sample genomic dna.

3rd, the ictal pain pathogenic sites linkage analysis of peripheral nerve：Propositus is chosen to 2 pain correlations having reported Paravoltage dependent sodium channel gene SCN9A and SCN10A by direct Sequencing, do not find the two gene mutations.Choose Tonghua, Jilin Province man System carries out full genome microsatellite marker linkage analysis, this family Disease-causing gene is positioned on No. 3 the short arm of a chromosome i.e. 3p22.3-22.1 sites, about 8Mb physical maps away from chromosome segment, to Hebei-Beijing family linkage analysis, also caused Ospc gene is positioned in above-mentioned section.The two familys are chain such as Fig. 2 on No. 3 chromosomes.

The chromosome mapping technology of gene is known for researcher in this field in molecular genetics field Technology, the present invention are the mutant genes that may cause human diseases using the scientific discovery.

Embodiment 2：The identification of the ictal pain Disease-causing gene of peripheral nerve

1st, extracting genome DNA：With embodiment 1

2nd, the sequencing of extron group of candidate gene

Choose Tonghua, Jilin Province family propositus sequencing of extron group is carried out to it, found in above-mentioned section another sodium from (c.673C mono- mutation of subchannel protein gene SCN11A, the mutation of Sanger sequence verifications occur in the 5th exons coding district >T/p.R225C) (Fig. 3 a).Gene great expression in peripheral nerve, some zooperies show that the gene and pain have Close, thus it is speculated that the gene is probably the Disease-causing gene of the ictal pain of peripheral nerve.Therefore the gene is implemented to Hebei-Beijing family All extron and exon: intron intersections carry out Sanger sequencings.

Inventor according to the special PCR amplification primer of extron with Primer5 Software for Design (as shown in table 1), and by upper The handsome biological Co., Ltd in sea synthesizes these primers, carries out PCR amplification in vitros to sample object fragment, amplified fragments contain All extrons in SCN11A gene coding regions, exon: intron intersection sequence, sequence source are Ensemble Genome Browser, amplified fragments size are as shown in table 1.Sequencing selection family levy person and a normal individual are carried out at the same time, and are used The kit of ABI companies commercialization, is completed on full-automatic sequenator, and all amplified fragments will carry out bidirectional sequencing, survey Sequence result and the normal sequence of SCN11A genes in Ensemble Genome Browser databases compare analysis, in Hebei-north In the family of capital, (c.2423C mutation occurs in the 15th exons coding district>G/p.A808G) (Fig. 3 b).Successfully identify week The ictal pain Disease-causing gene SCN11A of nerve is enclosed, there occurs mutation result in ictal chronic ache disease just because of the gene The generation of disease.2 mutant nucleotide sequences and the sequence alignment schematic diagram of normal person are as shown in Figure 3.

All extron sequencing primers in the ictal chronic ache family SCN11A gene coding regions of table 1

Inventor by the methods of PCR amplification, product purification, sequencing obtain all extrons in SCN11A gene coding regions and Extron and introne intersection sequence, specific method are as follows：

(1) PCR reaction systems component：DNTPs, Taq archaeal dna polymerase and PCR buffer are by Beijing Tiangeng biochemical technology Co., Ltd provides；Primer is synthesized by Shanghai Sani biology Co., Ltd.

(2) it is 40 μ l that PCR, which reacts total system,：10 × PCR buffer 4.0 μ l, dNTPs 1.0 μ l, 31.1 μ l of ultra-pure water, 0.4 μ l of Taq archaeal dna polymerases, 1.0 μ l+1.0 μ l, DNA1.5 μ l of primer.

(3) PCR amplification program is -57.4 DEG C of -94 DEG C of 94 DEG C (5min) (30s) (30s) -72 DEG C (72s), and 33 circulate, Subsequent 72 DEG C (5min), 15 DEG C of terminations.

(4) PCR product electrophoresis detection

PCR after reaction, takes 6 × Loading buffer that 3 μ lPCR products add 1 μ l to mix, with 1.5% agar Carbohydrate gum checks to be observed under ultraviolet lamp, and electrophoresis result is gathered with Canon's camera (Canon PowerShot A490).

(5) recycling of pcr amplification product

PCR product recycling, mistake are carried out using the plastic recovery kit of Shanghai Sangon Biological Engineering Technology And Service Co., Ltd Journey is operated by kit specification.

(6) BigDye end marks reaction (single stranded amplification PCR) 10 μ l systems：PCR glue reclaims product 2.0 μ l, BigDye 0.25 μ l, BigDye buffer 1.875 μ l, 0.2 μ l of primer, 5.675 μ l of ultra-pure water.

- 50 DEG C of -96 DEG C of 96 DEG C of the response procedures (1min) (10s) (5s) -60 DEG C (4min) of single stranded amplification PCR, 25 are followed Ring, subsequent 15 DEG C of terminations.

(7) purifying of BigDye reaction products

1. centrifuging, BigDye reaction products are collected to tube bottom.

2. BigDye reaction products are transferred in 1.5ml EP pipes.

3. adding the EDTA and 75 μ l absolute ethyl alcohols of 15 μ l 42mM, vibration mixes.

4. room temperature lucifuge stands 30-60min.

5. 132,000rpm centrifuges 30min at 4 DEG C.

After 6. suction filtration sops up supernatant, add the ethanol solution cleaning of 500 μ l 70%.

7. 132,000rpm centrifuges 15min at 4 DEG C.

After 8. suction filtration removes supernatant, 5301 rotatory vacuum drying instruments of Eppendorf Concentrator are used at 42 DEG C Dry 2min.

9. adding 10 μ l Hi-Di formamide, fully vibration promotes dissolving.

(8) it is sequenced

The sample that Hi-Di formamide are dissolved, 95 DEG C of denaturation 5min, are subsequently placed on mixture of ice and water rapid cold But, single-chain state is kept.Capillary Electrophoresis is carried out using ABI 3730Genetic Analyzer, uses ABI 3730Data Collection Version 2.0 collect data, with Sequence Analysis V5.1.1 to sequencing result Analyzed.

Embodiment 3：The ictal pain Disease-causing gene mutation verification of peripheral nerve

In order to verify the mutation of the present invention, the ictal pain family member of our peripheral nerves to collection carries out clinical inspection Look into, determine patient and normal personnel in family, while have collected the outer normal person of 1021 familys.It is all to participate in investigation and be collected The family member of blood sample knows about object of this investigation and meaning and informed consent.

1st, extracting genome DNA, as described above.

2nd, SCN11A gene mutations are detected using mismatched primers Created Restriction Site method

Inventor has found 2 mistakes of SCN11A genes in the ictal pain family of autosomal dominant inheritance peripheral nerve Justice mutation, cannot change restriction endonuclease sites or produce new restriction endonuclease sites, inventor utilizes mispairing alkali The method that base (CRS) produces restriction enzyme site carries out patient and normal control corresponding extron PCR amplification digestion again, finds just The corresponding extron pcr amplification product size of sample and digestion post-fragment size often compareed is as shown in table 2, and small fragment is (such as 21bp and 24bp) run out of in agarose electrophoresis outside glue, therefore 1 is only seen in the amplified production of normal control sample respectively Band, and patient amplification's product can see two bands (as shown in Figure 4).

Tri- pieces of 114bp, 90bp and 24bp are cut into the 5th extron pcr amplification product of Tonghua, Jilin Province family patient Section, 24bp is run out of outside glue, therefore sees two fragments (Fig. 4 a) of 114bp and 90bp in Jiao Tushang.Hebei-Beijing family patient's 15th extron pcr amplification product is cut into tri- fragments of 119bp, 98bp and 21bp, and 21bp is run out of outside glue, therefore in glue figure On see two fragments of 117bp and 96bp (see Fig. 4 b).1021 normal person's samples are verified using enzymatic cleavage methods, are not found State two mutation.

2 mutation of SCN11A genes of the present invention are detected using mismatched primers Created Restriction Site method, it is as follows in detail：

(1) form：Mismatched primers sequence (table 2), Taq enzyme, buffer buffer solutions, dNTP, DNA sample (25ng/ μ l) and 2 Kind restriction enzyme Bcn1 and Hind III.

(2) method：

A. PCR expansions are first carried out using above-mentioned PCR primer, Taq enzyme, sample genomic dna, buffer buffer solutions, dNTP etc. Increase reaction (program is same as above)；

B. above-mentioned 10 μ l of PCR product are taken, detection is c.673C>T mutation add 0.3 μ l of Bcn1 restriction enzymes or detection c.2423C>G mutation add 0.3 μ l of Hind III restriction enzymes, and 7.7 μ l, buffer buffer solution of distilled water, 2.0 μ l are 37 Digestion 7-12hr under the conditions of DEG C；

C. configuration 4% Ago-Gel, to above-mentioned digestion products carry out electrophoresis, as a result see on glue figure 114bp and Two fragments of 90bp (24bp is run out of outside glue), it was demonstrated that be c.673C>T is mutated；Two fragments of 119bp and 98bp are seen on glue figure (21bp is run out of outside glue) illustrates it is c.2423C>G is mutated.(referring to table 2).

Mismatched primers, restriction enzyme, PCR product and the digestion products size of 22 SCN11A gene mutations of table

4 SCN11A gene mutation bodies vector construction of embodiment and its functional analysis

1st, SCN11A gene mutation bodies vector construction

The cDNA of the normal gene is carried out rite-directed mutagenesis and obtains 2 mutant by inventor：Design primer, enzyme enzyme site And protection base, by the cDNA clone of the normal gene in pcDNA 3.1 (+) carrier.Rite-directed mutagenesis primer is redesigned afterwards, According to pcDNA 3.1-hSCN11A-WT carriers bypass method structure R225C and A808G mutant vector pcDNA 3.1- HSCN11A-R225C and pcDNA 3.1-hSCN11A-A808G, prepare for follow-up function research.

2nd, transfecting the electro physiology of C57 mouse dorsal nerve roots (DRG) cell and DRG cells influences respectively by wild type (WT) The DRG cells of electrotransfection mouse are distinguished with two class mutant plasmids, 36-48 hour are cultivated at 37 DEG C, to the DRG cells of transfection Carry out the granting of its action potential of Patch-clamp techniques.

Embodiment 5：The kit of the ictal pain patients SCN11A gene mutations of vitro detection peripheral nerve

In order to detect the pathogenic mutation of other peripheral nerve pain familys gene, inventor devises the gene coding region The primer sequence of all extrons and extron and introne intersection, as shown in table 1.Sequencing condition is expanded as being embodied 2 It is shown.

1st, kit forms：

Primer：The primer of SCN11A genes shown in table 1 totally 21 pairs 42, two OD values of every primer；Taq enzyme

Buffer solution

dNTP

2nd, application method：

(1) extracting genome DNA：As described in Example 1.

(2) first using above-mentioned PCR primer, Taq enzyme, sample genomic dna (from organism sample to be detected extraction and Purify DNA sample), buffer buffer solutions, dNTP etc. carry out pcr amplification reaction；

(3) pcr amplification product of each pair primer is purified；

(4) BigDye reactions are carried out to the PCR product of purifying；

(5) BiyDye reaction products are purified；

(6) BiyDye reaction products are sequenced, sequencing sequence is compared with normal sequence.

Embodiment 6：2 mutant of SCN11A bases provided by the invention in the ictal pain patients of vitro detection peripheral nerve Kit

1st, kit forms：

Primer：It is as shown in table 2 to detect 2 mutant mismatched primers sequences

Taq enzyme

PCR reaction buffers

dNTP

2 kinds of restriction enzyme Bcn I and Hind III.

2nd, application method：

(1) extracting genome DNA：As described in Example 1.

(2) first using above-mentioned PCR primer, Taq enzyme, extraction and purified genes material from organism sample to be detected (DNA sample), buffer solution, dNTP etc. carry out pcr amplification reaction；

(3) above-mentioned 10 μ l of PCR product are taken, add relevant 0.3 μ l of restriction enzyme, distilled water 7.7 μ l, buffer solution H 2.0 μ l are when digestion 7-12 is small under the conditions of 37 DEG C；

(4) above-mentioned digestion products carry out electrophoresis by the Ago-Gel of configuration 4%, as a result with reference to 2 related mutation of table Endonuclease bamhi size compares.

Embodiment 7：SCN11A gene mutations in gene chips detection peripheral nerve pain patients

Implementation process is as follows：

1st, gene Co., Ltd prepares the oligonucleotide DNA micro-array chip of SCN11A genes；

2nd, normal control and the peripheral blood genomic DNA of peripheral neuralgia patient are extracted, method is as described above；

3rd, SCN11A gene sequencing primers in embodiment 2, difference PCR amplification normal control and peripheral neuralgia patient are utilized The corresponding exon sequence of SCN11A genes；

4th, with the above-mentioned amplified production of Cy3 fluorescent marker normal control SCN11A genes -- normal control SCN11A genes are visited Pin；

5th, with the above-mentioned amplified production of FITC fluorescent marker peripheral neuralgia patient's SCN11A genes-peripheral neuralgia patient SCN11A gene probes；

6th, by above-mentioned two classes probe and the oligonucleotide DNA microarray hybridization of SCN11A genes；

7th, diagnosing chip is scanned with Fluorescence Scanner, scanning result shows fluorescence signal in Inspection and monitoring system, judges Whether SCN11A genes have mutation in the detection ictal pain patient of peripheral nerve.

The nucleotide and amino acid sequence table being related to below for present patent application, each sequence is followed successively by table：

No.1：Wild type SCN11A gene orders；

No.2：The albumen Nav1.9 sequences of wild type SCN11A gene codes；

No.3：SCN11A genic mutation types are c.673C>T-sequence；

No.4：SCN11A genic mutation types are c.673C>The mutein sequence of T codings；

No.5：SCN11A genic mutation types are c.2423C>G sequence；

No.6：SCN11A genic mutation types are c.2423C>The mutein sequence of G codings；

No.7 to 48：The ictal all extron sequencing primer sequences in chronic ache family SCN11A gene coding regions；

No.49 to 50：SCN11A genes are c.673C>The mismatched primers sequence of T mutation；

No.51 to 52：SCN11A genes are c.2423C>The mismatched primers sequence of G mutation.

Claims (1)

1. A kind of 1. germline SCN11A genes of variation answering in the ictal pain genes diagnosing chip of mankind's peripheral nerve is prepared With it is T that the 673rd bit base of the germline SCN11A genes of the variation is made a variation by the C of wild type, its nucleotides sequence is classified as SEQ ID NO：Shown in 3.