CN104988156B

CN104988156B - P53R175H specific nucleic acids aptamers and its screening technique and purposes

Info

Publication number: CN104988156B
Application number: CN201510454876.8A
Authority: CN
Inventors: 单革; 陈亮
Original assignee: University of Science and Technology of China USTC
Current assignee: University of Science and Technology of China USTC
Priority date: 2015-07-27
Filing date: 2015-07-27
Publication date: 2018-01-05
Anticipated expiration: 2035-07-27
Also published as: CN104988156A

Abstract

The invention discloses a kind of specific binding p53 mutant proteins p53R175H aptamer, the aptamer includes the sequence as shown in SEQ ID NO.1.The invention also discloses the screening technique and its purposes in oncotherapy of the derivative of the aptamer and the aptamer.

Description

P53R175H specific nucleic acids aptamers and its screening technique and purposes

Technical field

The present invention relates to biomedical sector, in particular it relates to a kind of screening and application of RNA aptamers, more particularly to The special RNA aptamers screening technique of mutain and application.

Background technology

P53 albumen is known important tumor suppressor protein.P53 albumen there are multiple functional domains, in p53 albumen Middle nucleus, about at 100-300 amino acids, there is DNA binding structural domains.This domain is according to sequence-specific It is in combination to be implemented in combination with DNA.This domain is considered as to realize the most important domain of p53 functions, because grinding afterwards Study carefully further confirmation, most tumours related to p53 mutation are due to that in this Core domain nonsense mutation occurs for p53 It is caused, and the human tumor for having more than half is relevant with the mutation of p53 albumen.With the development of sequencing technologies, all known Human cancer in p53 mutation species just exceeded 10000.Therein more than 95% mutation is occurred above-mentioned In DNA binding structural domains.75% mutation is Single locus nonsense mutation, without being missing from, inserting or shift.So I It is generally acknowledged that in most cancer, p53 exists mainly in Core domain in the form of Single locus is mutated.

P53 mutant p53R175H is known not to exercise p53 in mouse embryo fibroblast (MEF) cell and thymocyte The function of wild-type protein, and the acquisition sexual function of anti-apoptotic be present in lung carcinoma cell.Meanwhile p53R175H is than other The mutant of any p53 albumen has stronger population of cells's Forming ability, and finds the migration in prostatic cell Ability is also further strengthened.Among clinical research, caused by because p53R175H mutation in cancer patient, it is clinical Therapeutic effect is also least preferable.

Limited for the treatment means of p53 mutains at present, effect is poor.And drug dose is high, toxic side effect is big. And solving method in addition to developing new drug, targeted therapy becomes most important method.In addition, for the disease recurred after treatment People, lack effective targeting diagnosis measure at present, it is difficult to judge the position and position of tumor recurrence, make clinician's selection reasonable Therapeutic scheme it is extremely difficult.At present, lack the targeting medium of high special, be that restriction is examined for the targeting of p53 protein mutations Disconnected and treatment development bottleneck.

Aptamer, be the single strand oligonucleotide acid molecule similar with antibody function, can specific recognition include metal from A variety of targets such as son, organic molecule, polypeptide, protein, cell.It has affinity even more high suitable with antibody, molecule Measure small, non-immunogenicity, synthesize the advantages that convenient and batch wise differences are small, chemical property is stable.Therefore aptamer is in biology Had broad prospects in terms of monitoring, medical diagnosis on disease and targeted therapy.At present, there is no in the world can be specific for mutation egg The report of white special RNA aptamers.

The content of the invention

For overcome the deficiencies in the prior art, the problem to be solved in the present invention, which is to provide one kind, has high degree of specificity, point Son amount is small, and chemical property is stable, the aptamer and its derivative that can be used for identification mutain for being easy to preserve and marking. The present invention also correspondingly provides screening technique and the application of the aptamer.

In order to solve the above-mentioned technical problem, on the one hand, the invention provides a kind of aptamer (also to be claimed herein For p53R175H-APT), the nucleotide sequence of the aptamer includes following RNA sequence：

5’-GCAAUGGUACGGUACUUCCAUUAGCGCAUUUUAACAUAGGGUGCCAAAAGUGCACGCUACUUUG- 3’(SEQ ID NO.1)

In another aspect of the present invention, as the improvement to above-mentioned technical proposal, selectively, above-mentioned nucleic acid is fitted A certain position on the nucleotide sequence of part carries out phosphorylation, methylated, amination, sulfhydrylation or isotopologue.

In another aspect of the present invention, as the improvement to above-mentioned technical proposal, selectively, fitted in above-mentioned nucleic acid Fluorescent material, radioactive substance, therapeutic substance, biotin, digoxin, nano luminescent material are connected on the nucleotide sequence of part Material or enzyme mark.

The above-described nucleotide sequence through partly substituting or after modification, all with former aptamer base This same or similar molecular structure, physicochemical property and function, be all applied to identify p53R175H albumen and partial recovery its Wild type function.

The technical concept total as one, present invention also offers a kind of aptamer, the core of the aptamer Nucleotide sequence includes any one in following three kinds of sequences：

(1) homology with the nucleotide sequence of aptamer described in foregoing all technical schemes is more than 60% Sequence (such as aforementioned nucleic acid aptamers sequence can be deleted or increase the nucleotides of partial complementarity)；

(2) sequence that can be hybridized with the nucleotide sequence of aptamer described in foregoing all technical schemes；

(3) DNA sequence dna of the nucleotide sequence reverse transcription of aptamer described in foregoing all technical schemes.

The technical concept total as one, present invention also offers a kind of aptamer derivative, the derivative is The phosphorothioate backbone that the skeleton of the nucleotide sequence of aptamer derives described in foregoing all technical schemes, or It is the corresponding peptide nucleic acid that aptamer is transformed into described in foregoing all technical schemes.

The aptamer whether derived above or other derivatives derived, all with former aptamer Essentially identical or similar molecular structure, physicochemical property and function, that is, it is all applied to identify p53R175H albumen and part is returned Its multiple wild type function.

On the other hand, present invention also offers a kind of screening technique such as aforementioned nucleic acid aptamers, including it is following rapid：

(1) random single-stranded DNA banks and primer shown in following sequence are synthesized：

Random single-stranded DNA banks：TAATACGACTCACTATAGCAATGGTACGGTACTTCC(N25) CAAAAGTGCACGCTACTTTG

5 ' end primers：5’-TAATACGACTCACTATAGCAATGGTACGGTACTTCC(SEQ ID NO.2)

3 ' end primers：5’-CAAAGTAGCGTGCACTTTTG(SEQ ID NO.3)

(2) in-vitro transcription：Using single-stranded DNA banks as template, enter performing PCR amplification and prepare in-vitro transcription template.By above PCR In product input in-vitro transcription system, through being incubated after a while, purification step, the RNA aptamers library for screening is obtained；

(3) solid phase coupling protein：P53 wild-type proteins are coupled on the agarose beads of NHS activation.By p53R175H Albumen coupling screens step on the magnetic bead that NHS is activated, for lower step Different Competition SELEX；

(4) Different Competition SELEX is screened：The pearl that the coupling obtained in step (3) has specific protein is added into step (2) In obtained RNA aptamers library, be incubated within 2 hours by 37 DEG C, magnetic bead only retained by Magnetic Isolation, and will still be incorporated in The purifying of RNA aptamers, reverse transcription on magnetic bead, prepare the library of next round Different Competition SELEX screenings；

(5) multi-turns screen：By the random library in the library alternative steps (1) obtained in step 4, and repeat the above steps (2) process of~(4)；Library molecule is detected to p53R175H binding abilities by ELISA method after each round screening, until going out After now there are the RNA aptamers of high-affinity with target molecules, gained RNA aptamers are put into downstream functional study.

The third aspect, present invention also offers a kind of aforementioned nucleic acid aptamers or aptamer derivative to prepare inspection The application surveyed in the kit, molecular probe or targeting medium of the tumour containing p53R175H.

Fourth aspect, present invention also offers a kind of aforementioned nucleic acid aptamers or aptamer derivative in design and Prepare the purposes in the medicine of tumour of the treatment containing p53R175H

Compared with prior art, the advantage of the invention is that：The screening technique of the present invention can be used for screening mutain Special aptamer.Wild type protein is coupled to different solid-phase medias from saltant type respectively, allows two kinds of protein competitions Property combined with aptamers in library, cause that the difference of wild type and saltant type is amplified in cohesive process, and then screen Go out the aptamer stronger with mutain affinity.Present method solves fine difference target specificity it is low the problem of, keep away The continuous accumulation for the non-specific binding that single screening technique is brought is exempted from, screening efficiency is higher；By screening obtained nucleic acid Aptamers have the affinity higher than protein antibodies with specific and can synthesize, and molecular weight is small, and different parts can be entered Row modification and substitution, and it is more stable, it is easy to preserve.

Using the present invention aptamer experiments verify that, its to the cell containing p53 wild types without affinity, it is right P53R175H has a higher affinity, and can by and target combination, partial recovery p53 wild type functions, reduce The growth rate of p53R175H cells, promote apoptosis, slow down migration rate, there is certain therapeutic effect.

More specifically, the present invention provides the following：

1. specifically binding p53 mutant proteins p53R175H aptamer, the aptamer includes such as SEQ Sequence shown in ID NO.1.

2. the aptamer according to 1, its a certain opening position in SEQ ID NO.1 is modified, such as phosphorylation, first Base, amination, sulfhydrylation or isotopologue.

3. the aptamer according to 1, it is also associated with fluorescent marker, radioactive substance, therapeutic substance, life Thing element, digoxin, nano luminescent material or enzyme mark.

4. aptamer, it includes any one in following three kinds of sequences：

(1) sequence with the sequence homology of the sequence of aptamer according to any one of 1-3 more than 60% Row；

(2) sequence that can be hybridized with the sequence of the aptamer according to any one of 1-3；Or

(3) as the sequence of the sequence reverse transcription according to the aptamer any one of 1-3.

5. the derivative of the aptamer according to any one of 1-3, the derivative has by appointing according in 1-3 The phosphorothioate backbone that the skeleton of the sequence of aptamer described in one derives, or by according to any in 1-3 The corresponding peptide nucleic acid that aptamer described in is transformed into.

6. the method for the aptamer for screening specific binding p53 mutant proteins p53R175H, methods described Comprise the following steps：

(1) random single-stranded DNA banks are provided, the DNA library includes the random single chain DNA being expressed from the next： During TAATACGACTCACTATA GCAATGGTACGGTACTTCC (N25) CAAAAGTGCACGCTACTTTG, wherein N25 are represented Between 25 amino acid random sequence, and provide pair of primers as shown in SEQ ID NO.2 and SEQ ID NO.3；

(2) using the DNA library as template, enter performing PCR using above-mentioned primer and expand, body is used as using the product of the PCR Outer transcription templates carry out in-vitro transcription, so as to obtain the RNA aptamers library for screening；

(3) wild-type p 53 protein is coupled on the agarose beads of NHS activation, and by mutant protein P53R175H is coupled on the magnetic bead of NHS activation；

(4) p53 pearl and coupling have p53R175H magnetic bead addition step (2) coupling obtained in step (3) In be incubated in obtained RNA aptamers library, Magnetic Isolation is carried out to magnetic bead after incubation, to being incorporated on the magnetic bead RNA aptamers carry out purifying and reverse transcription to prepare the DNA library for further screening；

(5) library in step (1) is replaced to be used as the template in step (2) with the DNA library obtained in step (4), And repeat step (2) to (4), compare screened RNA aptamers and p53 and p53R175H combination after each round screening Ability, until obtaining specific binding p53R175H RNA aptamers.

7. the method according to 6, wherein compared using ELISA method screened RNA aptamers to p53 and P53R175H binding ability.

8. the aptamer according to any one of 1-4, or the derivative of the aptamer according to 5, Prepare for the purposes in the reagent with reference to p53R175H albumen.

9. the aptamer according to any one of 1-4, or the derivative of the aptamer according to 5, The purposes in medicine is prepared, the medicine is used to treat the tumour as caused by p53 mutant p53R175H.

Brief description of the drawings

Fig. 1 shows the screening process figure of the embodiment of the present invention.

Fig. 2 shows the affinity screening process and detection case of the embodiment of the present invention

Fig. 3 shows that the embodiment of the present invention screens the affinity of obtained aptamer and p53 wild types.

Fig. 4 shows that the embodiment of the present invention screens obtained aptamer and p53R175H affinity and to cell Influence.

Fig. 5 shows that the aptamer that the embodiment of the present invention screens to obtain reduces tumor growth rate in nude mouse.

Embodiment

Following examples are provided to more fully understand the present invention, are not intended to limit the present invention.Experiment side in following instance Method is conventional method unless otherwise specified.Experiment material used is conventional life unless otherwise specified in following embodiments Change reagent shop purchase gained.

Used in following examples and arrive following cell：HEK293T(CRL-3216^TM), NCI-H1299 (CRL-5803^TM)。

The present invention utilizes the in-vitro screening technology SELEX technologies of aptamer, using p53R175H as target, adds simultaneously The competition screening of p53 wild-type proteins, is filtered out and the cell line specific bond from the random oligo rna library synthesized in vitro Aptamer.

In the present invention, described nucleic acid aptamer sequence may be selected from naturally occurring or artificial synthesized sequence, or it is any its The same sequence in his source.

In the present invention, described nucleic acid aptamer sequence contains all identicals with the nucleotides of the characteristic sequence Sequence.

In the present invention, aptamer can be modified or transformed, obtain the derivative of the aptamer, institute Stating the derivative of aptamer can be：

A) aptamer is deleted to the nucleotides of part or increase partial complementarity, what is obtained is adapted to the nucleic acid Body has the derivative of the aptamer of identical function；

B) aptamer progress nucleotides is substituted or part is modified, what is obtained has with the aptamer The aptamer derivative of identical function；

C) it transform the skeleton of the aptamer as phosphorothioate backbone, what is obtained has with the aptamer There is the aptamer derivative of identical function；

D) it transform aptamer as peptide nucleic acid, it is obtaining to be fitted with the aptamer has identical function nucleic acid The derivative of part；

E) above-mentioned aptamer is connected into upper fluorescent material, radioactive substance, therapeutic substance, biotin, enzyme to mark After material, what is obtained has the aptamer derivative of identical function with the aptamer.

The target of sequence of the present invention is not expressed in H1299 cells, and this example uses H1299-p53R175H steady Turn cell line.

Embodiment

The screening of embodiment 1, aptamer

1. the design and synthesis of random nucleic acid library

Design synthesizes single stranded DNA as follows, includes the random sequence of 25 nucleotides among it, and it forms nucleotide sequence Library

TAATACGACTCACTATA GCAATGGTACGGTACTTCC(N25)CAAAAGTGCACGCTACTTTG

2. albumen coupling solid phase carrier

2.1. it is p53R175H albumen (Cat.No.AZ-026Abzyme, amino acid sequence is as shown in SEQ ID NO.4) is even It is linked on the magnetic bead (28-9940-09 GE Healthcare) of NHS activation.

Appropriate magnetic bead is put into new EP pipes from former pipe, is placed on magnetic frame, removes original storing liquid；

Plus the equilibrium liquid (1mM HCl (ice-cold)) of 500 μ l ice precoolings, mix, remove equilibrium liquid；

10 μ g albumen are added after balance at once, in combination buffer (0.2M NaHCO₃, 0.5M NaCl, pH 8.3) and environment Middle resuspension magnetic bead, it is incubated 15 minutes on vertical mixed instrument；

It is placed on magnetic frame, removes supernatant, enters cleaning closing step；

Add 500 μ l Block buffers A (0.5M monoethanolamines, 0.5M NaCl, pH 8.3), remove supernatant；

Add 500 μ l Block buffers B (0.1M sodium acetates, 0.5M NaCl, pH 4.0), remove supernatant；

Add 500 μ l Block buffer A, vertical mixing is incubated 15 minutes；

Add 500 μ l Block buffer B, remove supernatant；

Add 500 μ l Block buffer A, remove supernatant；

Add 500 μ l Block buffer B, remove supernatant；

Add 500 μ l combination buffers (50mM Tris, 150mM NaCl, pH 7.5), and be put in 4 DEG C of preservations.

2.2.p53 wild-type protein (Cat.No.AZ-025, its amino acid sequence is as shown in SEQ ID NO.5) is coupled to On the agarose beads (Cat.No.SF024-NHS, Sangon) of NHS activation.

Appropriate magnetic bead is transferred in new EP pipes from former pipe, 1000g is centrifuged 1 minute, removes original storing liquid；

Add 500 μ l pure water, 1000g is centrifuged 1 minute, removes supernatant；

Add 500 μ l combinations/lavation buffer solution (0.1M Sodium Phosphate, 0.15M NaCl, pH7.2 (PBS)), 1000g is centrifuged 1 minute, removes supernatant；

Add protein solution (10ug), 1h is incubated at room temperature on vertical mixed instrument；

1000g is centrifuged 1 minute, removes supernatant；

1ml combinations/lavation buffer solution cleaning, 1000g are centrifuged 1 minute, remove supernatant；

Repeat f；

Add 500 μ l Block buffers (1M monoethanolamines, pH7.4), 15-20 minutes are incubated on vertical mixed instrument；

1000g is centrifuged 1 minute, removes supernatant；

The above-mentioned combinations of 1ml/lavation buffer solution cleaning, 1000g are centrifuged 1 minute, remove supernatant；

Albumen is finally resuspended in 500 μ l SHMCK buffer solutions (20mM HEPES pH7.35,120mM NaCl, 5mM KCl,1mM CaCl₂,1mM MgCl₂) inner, it is put in 4 DEG C of preservations.

3. in-vitro transcription RNA

A. using the initial DNA library of synthesis as template, it is added in following PCR system：

Response procedures are：

98 DEG C of pre-degenerations 5 minutes, 98 DEG C of denaturation 30s, 55 DEG C of 3s that anneal, 72 DEG C of extension 10s, totally 25 circulations, 72 DEG C 10 Minute, 4 DEG C of terminating reactions.

B. glue checking product purity is run

Configure 12%Native PAGE glues

5ul PCR primers are taken out, plus 6 × sample-loading buffers of 1ul, loading, glue is run in 200V voltage stabilizings.

C. using PCR primer as template, following in-vitro transcription system is entered：

37 DEG C of 8h are incubated.

D. toward adding 2 μ l DNaseI to remove DNA profiling in in-vitro transcription system.

E. toward 15 μ l 3M NaAc pH5.2,115 μ l in in-vitro transcription system, are added without RNase pure water, mix.

F. the phenol chloroformic solution of equivalent volumes, fully shaking mixing are added, 12000rpm is centrifuged 1 minute, is taken supernatant and is turned Move on in another clean EP pipe.

G. isometric chloroform, fully shaking mixing are added, 12000rpm is centrifuged 1 minute, taken supernatant and be transferred to another In clean EP pipes.

H. 2 times of volume ice ethanol are added, -80 DEG C stand at least 30 minutes.

I.4 DEG C 12000rpm is centrifuged 15 minutes, abandons supernatant.

J. the cleaning of the ethanol of 1ml 75% is added, 4 DEG C of 12000rpm are centrifuged 10 minutes, abandon supernatant.

K. room temperature is fully dried, and 50 μ l dissolve without RNase pure water, determines concentration, -80 DEG C of preservations.

4. competitiveness screening

To be coupled has the agarose beads of p53 wild types and coupling to have p53R175H magnetic bead is each to take out 1 μ g, uses SHMCK Buffer solution (20mM HEPES pH7.35,120mM NaCl, 5mM KCl, 1mM CaCl₂,1mM MgCl₂) clean once, afterwards Put into the RNA storehouses (1 μ g) of above-mentioned in-vitro transcription and be incubated simultaneously, total μ l of incubation system 500,37 DEG C of concussions are incubated.When After the concussion incubation that have passed through 2 hours, individually remained, added by the magnetic bead for having p53R175H is coupled by magnetic frame 1ml TRIzol RNA extraction agents (Ambion) carry out RNA extractings on magnetic bead.

5.TRIzol methods RNA is extracted

A. 1ml TRIzol are added into obtained magnetic bead, are stored at room temperature 5 minutes so that medium uniforms；

B. 200 μ l chloroforms are added, 15s is acutely shaken in hand, is stored at room temperature 2-3 minutes afterwards；

C.4 DEG C 12000g is centrifuged 15 minutes；

D. upper strata aqueous phase is transferred in another clean blank pipe, adds 500 μ l 100% isopropanol, room temperature is placed 10 minutes；

E.4 DEG C 12000g is centrifuged 10 minutes；

F. supernatant is abandoned, is washed with 75% ethanol, 4 DEG C of 7500g are centrifuged 5 minutes；

G. supernatant is abandoned, is dried at room temperature, water dissolving treated 20 μ l DEPC, into reverse transcription program.

6. reverse transcription

A. pre-degeneration system and pre-degeneration

RNA 500ng-1μg

GSP (gene specific primer) (0.5 μ g/ reactions) 1 μ l

The water of nuclease free adds to 10 μ l

70 DEG C 5 minutes, after the completion of be placed at once on ice.

B. reverse transcription system and reverse transcription

25 DEG C 5 minutes；42 DEG C 60 minutes；70 DEG C 15 minutes；4℃∞.

The masterplate in 7.PCR amplification next round RNA storehouses

Using cDNA obtained above as template, it is added in following PCR system：

Response procedures are：

8. multi-turns screen

By DNA library in the single-stranded library alternative steps 3 of specific nucleic acid aptamers obtained by step 7, it is above-mentioned to continue repetition The operating process of step 2~7.Screened by 5 wheels, after every wheel screening, be used to examine by well-known to those skilled in the art Surveying the assay method of aptamer and target protein binding ability, (such as the affinity based on ELISA described in embodiment 2 is surveyed Determine method) affinity measure is carried out to the sequence randomly selected in epicycle, final screening obtains having as shown in SEQ ID NO.1 Sequence aptamer.Relative to p53 wild types, the aptamer of the sequence for p53R175H affinity more High (nearly an order of magnitude difference).

In the screening technique, screening pressure can be increased by wheel, to promote the enrichment degree for screening aptamer.It is described Increasing screening pressure includes linear reduction input RNA amounts, the dosage of target and both incubation times.

Embodiment 2, the affinity screening technique based on ELISA

It will be appreciated by those skilled in the art that the binding ability of aptamer and target protein can be by different from ELISA side The other method detection of method.

1.T vector constructions screen with blue hickie

A. following system configurations carrier T linked system is pressed：

B. connection product is transformed into competent cell；

C. in the LB plates with ammonia benzyl resistance, 100ul IPTG and 200ul X-Gal are coated in advance, are put in 37 DEG C of cultures Case dries.The competent cell of low speed culture is uniformly applied on plate again, 37 DEG C of culture 12-16 hours；

D. next day picking white colonies, cultivate bacterium and send sequencing；

E. to successful sampling plasmid is sequenced, as next step in-vitro transcription template.

2. in-vitro transcription carries the RNA of biotin labeling

A. AmpliScribe is used^TMT7-Flash^TMBiotin-RNA Transcription kits (Epicentre) in-vitro transcription, is carried out according to the following formulation；

37 DEG C 1 hour

B. add 1 μ l (1MBU) DNaseI digestion DNA profiling, 37 DEG C 30 minutes.

3. phenol chloroform RNA

A. 80 μ l are added without RNase pure water to above in-vitro transcription system；

B. the phenol chloroformic solution of equal volume is added, is vibrated 15 seconds, 4 DEG C of 12000rpm are centrifuged 5 minutes, and supernatant is got separately One by all means in；

C. the chloroformic solution of equal volume is added, is vibrated 15 seconds, 4 DEG C of 12000rpm are centrifuged 5 minutes, supernatant are got another In by all means；

D. two volumes ice ethanol and the 3M sodium acetates of 10% volume are added, -80 DEG C stand more than 30 minutes；

E.4 DEG C 12000rpm is centrifuged 15 minutes, abandons supernatant, retains precipitation；

F. the cleaning of the ethanol of 1ml 75% is added, 4 DEG C of 12000rpm are centrifuged 5 minutes, abandoned supernatant, be placed in room temperature and dry；

G. 50 μ l are added and dissolve RNA precipitate without RNase pure water, measure concentration, are tested for lower step affinity.

4.ELISA affinity tests (Fig. 2 a)

A. p53 and p53R175H protein solutions (1-10 μ g/ml, according to egg are prepared in 0.05M sodium carbonate liquor Bai Xingzhi)；

B. the 0.1 above-mentioned protein solutions of μ g are added in each aperture, with ParafilmTM lid, room temperature concussion is incubated 2h or 4 DEG C overnight；

C. wash aperture 3 times with PBST solution, 96 orifice plates are upside down on blotting paper for the last time, to drain liquid；

D. 200 μ l confining liquids (0.5%BSA, PBST dissolve) are added, are incubated at room temperature 1h or 4 DEG C overnight；

E. aperture is cleaned three times with PBST again；

F. the RNA with biotin labeling of in-vitro transcription is added, room temperature concussion is incubated 1 hour；

G.PBST (NaCl 8g, KCl 0.2g, KH₂PO4 0.24g, Na₂HPO₄.12H₂O 2.9g, add water to 1L systems, PH7.4) aperture is cleaned three times；

H. plus the μ l of Streptavidin 100 of the AP marks diluted.Closed with covers, room temperature are shaken into 1h with sealed membrane；

I. non-specific background is washed with lavation buffer solution again；

J. 100 μ l substrates (1mg/ml 4-NPPs) are added at once, and lucifuge is incubated 30 minutes；

K. 100 μ l 3M NaOH are added into each hole with terminating reaction.Light when 405nm is read in ELIASA is inhaled Receive.

As illustrated, in the affinity test to third round and fourth round progress, relative to the affine of p53 wild types Power, temporarily find no candidate's aptamers (Fig. 2 b) that affinity is had more to p53R175H albumen.But carried out after the 5th wheel terminates Affinity test in, No. 3 candidate's aptamers are nearly 10 times (Fig. 2 c) to p53 wild types to p53R175H affinity. Therefore select it and carry out follow-up study, the nucleotide sequence of No. 3 candidate's aptamers is SEQ ID NO.1.

The aptamer that embodiment 3, screening obtain is to p53 wild-type proteins without affinity

1.p53 co-immunoprecipitation experiments

A. HEK293T cells are layered in 10cm Tissue Culture Plates, the lower 37 DEG C of cultures 12-18h of 5%CO2 environment, until carefully Transfect the sequence screened by embodiment 1 when born of the same parents' density reaches 60-70% respectively using the systems of LipofectAmine 2000 (it is random negative control sequence for aptamer (p53R175H-APT) and scramble as shown in SEQ ID NO.1 GCAATGGTACGGTACTTCCGCCTGGCTGGTCTTTGAACTCTTTTCAAAAGTGCACG CTACTTTG), continue to cultivate, directly Start subsequent experimental after 48 hours after to transfection；

B. cell cross-linking reaction：Final concentration of 0.75% methanol is added dropwise into Tissue Culture Dish, room temperature gently shakes 10 Minute；

C. final concentration of 125mM glycine solution is added, is gently shaken 5 minutes under room temperature condition, it is anti-to terminate crosslinking Should；

D. 60% volume that whole lysate (ice precooling) is added into cell plates washes down cell, adds remaining 40% volume washs cell plates from back to front, is allowed to fully collect cell.With rifle piping and druming it is several under, lysate and cell is fully connect Touch, lysis buffer RIPA：50mM Tris-Cl [pH 8.0], 150mM NaCl, 5mM EDTA, 1%NP-40,0.1%SDS (EDTA is dissolved with NaOH)；

E.4 DEG C cracked 10 minutes in vertical mixed instrument, EP pipes are put on ice, cell is carried out using Ultrasonic Cell Disruptor Ultrasonication, ultrasound procedures are：Ultrasonic 3s, stop 6s, power 30%, 5 minutes time, 4 DEG C centrifuge 15 minutes, by clasmatosis It is transferred to clearly in another EP pipe；

F. magnetic bead is prepared：A certain amount of Dynabeads Protein G (Invitrogen) are taken out in EP pipes.It is placed in magnetic force On support, preservation liquid is sucked, antibody and Protein G magnetic beads are coupled, by 3 μ g or so p53 antibody (cat#2524S, Cell Signaling Technology) it is diluted in the PBS that 200 μ l contain 0.02%Tween-20, it is added to ready magnetic bead In, 1h or so is incubated at ambient temperature, is placed in afterwards on magnetic bracket, draws supernatant, 3 are washed with lysis buffer (RIPA) Secondary (1ml/ times)；

G. the supernatant that step e is obtained is rotated at ambient temperature with Protein G magnetic beads of the step f covered with antibody and incubated 2h is educated, abandons supernatant, 3 RIPA buffer solution for cleaning with raising salt ionic concentration to 250mM NaCl are rinsed with lysis buffer, Collect beads；

H. 1ml TRIzol RNA extracts reagents are added and carry out RNA extracting and purifyings.

2.TRIzol methods RNA is extracted

C.4 DEG C 12000g is centrifuged 15 minutes；

E.4 DEG C 12000g is centrifuged 10 minutes；

3. reverse transcription

A. pre-degeneration system and pre-degeneration

RNA 500ng-1μg

GSP (gene specific primer) (0.5 μ g/ reactions) 1 μ l

The water of nuclease free adds to 10 μ l

70 DEG C 5 minutes, after the completion of be placed at once on ice.

B. reverse transcription system and reverse transcription

25 DEG C 5 minutes；42 DEG C 60 minutes；70 DEG C 15 minutes；4℃∞.

Obtain cDNA products

4. real-time fluorescence quantitative PCR

Added according to following system

Above system solution is added in three holes by every hole 15ul amount.Whole reaction plate is put in PikoReal realities When quantitative PCR detection system (Thermo Scientific) in.Real-time fluorescence quantitative PCR is carried out by following procedure

Wherein, this two step carries out 40 circulations altogether with annealing/extend for denaturation.

PCR data is analyzed.

Test result indicates that (see Fig. 3), in the cell line HEK293T cells containing p53 wild types, p53R175H-APT For the affinity of p53 wild types marked difference is had no compared to scramble RNA.7SL is control group.

The aptamer that embodiment 4, screening obtain has affinity to p53R175H

1. plasmid construction

Two restriction enzyme sites of EcoRI and BamHI p53R175H coded sequences being cloned into pIRES2-ZsGreen1 In, using following primer,

Forward primer：GGGAATTCCACTGCCATGGAGGAGCCGCA

Reverse primer：GGGGATCCGAGAATGTCAGTCTGAGTCAG

The plasmid built is named as pIRES2-ZsGreen1-p53R175H

By by aptamer of the sequence that embodiment 1 screens as shown in SEQ ID NO.1, (nucleic acid of the invention is fitted Part, p53R175H-APT) and scramble sequences be cloned into pLKO.1 in two restriction enzyme sites of AgeI and EcoRI, use Following primer,

Forward primer：GCACCGGTGCAATGGTACGGTACTTC

Reverse primer：CCTTAAGGTTTTTTCAAAGTAGCG

The plasmid of structure is named as pLKO-p53R175H-APT and pLKO-scramble respectively.

2.p53R175H surely turn the foundation of cell line

The pIRES2-ZsGreen1-p53R175H matter built to H1299 cells (p53 excalations cell line) transfection Grain.It is screened with G418 (400 μ g/ml).Cell (group) with green fluorescence is selected out in 24 orifice plates Individually culture.Then it is enlarged culture.What is obtained after screening steady turn cell line and is named as H1299-p53R175H.

3.MTT cells propagation test experience (Fig. 4 a)

MTT kits used in this method are triumphant base MTT cells propagation and citotoxicity detection kit (Cat.No.KGA312), detailed process is as follows：

A. the μ L/ holes (about 1 × 10 of H1299-p53R175H cells 100 are added in 96 orifice plates⁴), put 37 DEG C of 5%CO₂Cell is trained Support case culture 24 hours；

B. pLKO-p53R175H-APT and pLKO-scramble plasmids are transfected enter in aperture respectively, at 37 DEG C, containing 5% 48h is incubated in CO2 air and the cell culture incubator of 100% humidity；

C. 5 × MTT is diluted to 1 × MTT with Dilution Buffer.Add 50 μ 1 × MTT of L per hole, 4 are incubated at 37 DEG C Hour, make MTT be reduced to praise the first moon；

D. supernatant is suctioned out, adds 150 μ L DMSO the first moon is praised dissolving per hole, is shaken up with plate shaker；

E. ELIASA detects the optical density per hole at 550nm wavelength.

Pass through the detection to survivaling cell quantity, the results showed that, the aptamer of the invention filtered out can be notable Reduce the cell growth rate containing p53R175H.

4.Annexin V-FITC_PI Apoptosis test experiences (Fig. 4 b)

This method used kit is the Annexin V-FITC cell apoptosis detection kits of Vazyme companies (Cat.No.A211-02)。

A. by the cell treated (H1299-p53R175H) with without EDTA pancreatin digestion after 300g, 4 DEG C from The heart collects cell in 5 minutes.Pancreatin digestion time is unsuitable long, to prevent causing false positive.

B. cell is washed twice with the PBS of precooling, every time in 300g, 4 DEG C centrifuge 5 minutes.Collect 1~5 × 10⁵Carefully Born of the same parents.

C. 100 μ 1 × Binding of l Buffer are added cell is resuspended.

D. 5 μ l Annexin V-FITC and 5 μ l PI Staining Solution are added, are gently mixed.

E. lucifuge, room temperature reaction 10 minutes.

F. 200 μ 1 × Binding of l Buffer (kit carries) are added, are gently mixed.Sample is in 1 hour with stream Formula cell instrument or fluorescence microscope detection.

Pass through the detection to apoptotic cell quantity, the results showed that, the aptamer filtered out can remarkably promote containing P53R175H Apoptosis.

4.p53 co-immunoprecipitation experiments

A. H1299-p53R175H cells (being obtained in the step 2 of embodiment 4) are layered in 10cm Tissue Culture Plates, 5% CO₂The lower 37 DEG C of cultures 12-18h of environment, until cell density utilizes the systems point of LipofectAmine 2000 when reaching 60-70% Not Zhuan Ran p53R175H-APT and scramble, continue to cultivate, start subsequent experimental after 48 hours after transfection

B. final concentration of 0.75% methanol is added dropwise into Tissue Culture Dish for cell cross-linking reaction, and room temperature gently shakes 10 points Clock

C. final concentration of 125mM glycine solution is added, is gently shaken 5 minutes under room temperature condition, it is anti-to terminate crosslinking Should

E.4 DEG C cracked 10 minutes in vertical mixed instrument,

EP pipes are put on ice, ultrasonication are carried out to cell using Ultrasonic Cell Disruptor, ultrasound procedures are：Ultrasonic 3s, stops 6s, power 30%, 5 minutes time, 4 DEG C are centrifuged 15 minutes, and clasmatosis supernatant is transferred in another EP pipe；

F. magnetic bead is prepared.A certain amount of Dynabeads Protein G (Invitrogen) are taken out in EP pipes.It is placed in magnetic force On support, preservation liquid is sucked,

Antibody is coupled 3 μ g or so p53 antibody (cat#2524S, Cell Signaling with Protein G magnetic beads Technology) it is diluted in the PBS that 200 μ l contain 0.02%Tween-20, is added to ready magnetic bead in step 6, 1h or so is incubated under room temperature condition, is placed in afterwards on magnetic bracket, supernatant is drawn, is washed 3 times with lysis buffer (RIPA) (1ml/ times),

G. the supernatant that step 5 obtains and Protein G magnetic bead of this step 7 covered with antibody are rotated at ambient temperature 2h is incubated, abandons supernatant, it is clear to rinse 3 RIPA buffer solutions with raising salt ionic concentration to 250mM NaCl with lysis buffer Wash, collect magnetic bead

H. 1ml TRIzol RNA extracts reagents are added and carry out RNA extracting and purifyings

5.TRIzol methods RNA is extracted

C.4 DEG C 12000g is centrifuged 15 minutes；

E.4 DEG C 12000g is centrifuged 10 minutes；

6. reverse transcription

A. pre-degeneration system and pre-degeneration

RNA 500ng-1μg

GSP (gene specific primer) (0.5 μ g/ reactions) 1 μ l

The water of nuclease free adds to 10 μ l

70 DEG C 5 minutes, after the completion of be placed at once on ice.

B. reverse transcription system and reverse transcription

25 DEG C 5 minutes；42 DEG C 60 minutes；70 DEG C 15 minutes；4℃∞.

7. real-time fluorescence quantitative PCR (Fig. 4 c)

Added according to following system

PCR data is analyzed.

In this experimental result, either control is used as using IgG as control (Fig. 4 c are left) or using scramble sequences (Fig. 4 c are right), p53R175H-APT shows the high-affinity to p53R175H.

The aptamer that embodiment 5, screening obtain reduces tumor growth rate in nude mouse

1. experimental animal buys and raising

13 5 week old Female nude mices are purchased from Shanghai Si Laike (SLAC) experimental animals Co., Ltd, are arrived at by air transport Hefei, then raised with every 3 for a cage in Experimental Animal Center II areas of China Science ＆ Technology University.All experimental animal behaviour Make flow according to National Institutes of Health Guide for the Care and Use of Laboratory animals are carried out, and are ratified through experimental animal Ethics Committee of China Science ＆ Technology University, approval number No.USTCACUC1401008 (solid tumor injection treatment), No.USTCACUC1401010 (intravenous medical treatment).

2. tumor inoculation

In every nude mice dorsal sc inoculated tumour.Ready H1299-p53R175H cells pancreatin is digested and counted Number, cell is suspended and adds the Matrigel (BD Biosciences) of equivalent to mix so that final concentration of 5X10⁶Individual/100 μ l.A tumour is respectively inoculated with left and right back.

3. administering mode and measurement of tumor

Experimental animal arrives at inoculated tumour after one week between raising, is administered after 5 days when tumour can be touched by sense of touch.It is real The injection of body knurl injects 10 μ g p53R175H-APT for each tumor locus.Intravenous medical treatment is every by tail vein injection The μ g p53R175H-APT of nude mice direct injection 20.

Vernier caliper measurement is used for tumour twice weekly, and calculation formula is V (in mm³)=a × b²/ 2, wherein, a is Major diameter, b are minor axis.

Experimental result either injects (Fig. 5 a) or intravenous injection (Fig. 5 b), p53R175H- through analysis by solid tumor APT can significantly reduce tumor growth rate, play good therapeutic effect.

Claims

1. specifically bind p53 mutant proteins p53R175H aptamer, the sequence such as SEQ of the aptamer Shown in ID NO.1.

2. the aptamer described in claim 1, its a certain opening position in SEQ ID NO.1 is modified.

3. the aptamer described in claim 1, it is phosphorylated in SEQ ID NO.1 a certain opening position, methylated, ammonia Base, sulfhydrylation or isotopologue.

4. the aptamer described in claim 1, it is also associated with fluorescent marker, radioactive substance, therapeutic substance, life Thing element, digoxin, nano luminescent material or enzyme mark.

5. the derivative of the aptamer any one of claim 1-3, the derivative has by claim 1-3 Any one of aptamer sequence the phosphorothioate backbone that derives of skeleton, or by claim 1- The corresponding peptide nucleic acid that aptamer any one of 3 is transformed into.

6. the method for the aptamer for screening specific binding p53 mutant proteins p53R175H, methods described include Following steps：

(2) using the DNA library as template, enter performing PCR using above-mentioned primer and expand, turn using the product of the PCR as external Record template and carry out in-vitro transcription, so as to obtain the RNA aptamers library for screening；

(3) wild-type p 53 protein is coupled on the agarose beads of NHS activation, and mutant protein p53R175H is even It is associated on the magnetic bead of NHS activation；

(4) magnetic bead that the coupling obtained in step (3) has a p53 pearl and coupling has p53R175H is added in step (2) To RNA aptamers library in be incubated, after incubation to magnetic bead carry out Magnetic Isolation, to the RNA being incorporated on the magnetic bead Aptamers carry out purifying and reverse transcription to prepare the DNA library for further screening；

(5) replace the library in step (1) to be used as the template in step (2) with the DNA library obtained in step (4), lay equal stress on Multiple step (2) to (4), compare screened RNA aptamers and p53 and p53R175H combination energy after each round screening Power, until obtaining specific binding p53R175H RNA aptamers.

7. the method described in claim 6, wherein compared using ELISA method screened RNA aptamers to p53 and P53R175H binding ability.

8. the aptamer any one of claim 1-4, or the derivative of the aptamer described in claim 5 Thing, preparing for the purposes in the reagent with reference to p53R175H albumen.

9. the aptamer any one of claim 1-4, or the derivative of the aptamer described in claim 5 Thing, the purposes in medicine is prepared, the medicine are used to treat the tumour as caused by p53 mutant p53R175H.