CN104946766A - Primers and method for identifying true or false shark fins by LAMP (loop-mediated isothermal amplification) technique - Google Patents
Primers and method for identifying true or false shark fins by LAMP (loop-mediated isothermal amplification) technique Download PDFInfo
- Publication number
- CN104946766A CN104946766A CN201510363949.2A CN201510363949A CN104946766A CN 104946766 A CN104946766 A CN 104946766A CN 201510363949 A CN201510363949 A CN 201510363949A CN 104946766 A CN104946766 A CN 104946766A
- Authority
- CN
- China
- Prior art keywords
- shark
- fin
- lamp
- dna
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses primers and a method for identifying true or false shark fins by an LAMP (loop-mediated isothermal amplification) technique. The primers comprise a forward outer primer F3: 5'-CAGGATTTCCTGATCAATG-3', a reverse outer primer B3: 5'-GTGTGAACTCAGATCACGT-3', a forward inner primer FIP: 5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3', and a reverse inner primer BIP: 5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3'. The method comprises the following steps: extracting shark fin DNA (deoxyribonucleic acid); establishing an LAMP reaction system; respectively adding a pre-reaction solution and detected sample DNA into a Loopamp reaction test tube; mixing; reacting the mixture in an LAMP turbidimeter; and detecting the inspection result by a LAMP turbidimeter process or a fluorescent visual measurement process. The invention aims to provide the primers and method for identifying true or false shark fins by the LAMP technique. The method has the characteristics of high speed, high detection sensitivity and the like, is simple to operate, and can directly read the result.
Description
Technical field
The present invention relates to the primer that a kind of LAMP technology differentiates the shark's fin true and false, the invention still further relates to a kind of method adopting above-mentioned primer to differentiate the shark's fin true and false, belong to biological technical field.
Background technology
Shark's fin is as the traditional marine products treasure of China, be described as one of " seafood delights eight delicacies ", belong to high tonic, normal and bird's nest, abalone, sea cucumber etc. are mentioned in the same breath, the fin of its to be shark's fin be shark, ray, shark or aft end portion, form through the course of processing of series of complex is refining, mainly originate in Japan, Mexico, Brazil, Africa, the Middle East, India, South America and Australia, the East Sea, the South Sea of China also produce, but China is main importer, annual import about 3500 tons of various forms of shark's fins.
Shark is under the jurisdiction of Chondrichthyes Chondrichthyes, Elasmobranchii Elasmobranchii, shark order Selachoidei, Mustelus Mustelus, top important fish in marine organisms chain, the whole world has shark about 370 kinds, can be used to extract shark's fin about 20 plant, because it is precious and rare, add the growth that market continues its demand, all kinds of imitative shark, ginseng artificial fish wing etc. is caused to spread unchecked popular, greatly upset China market order, greatly encroach on the rights and interests of human consumer, even compromise the healthy of human consumer.The method being badly in need of studying highly sensitive and easy to operate applicable laboratories detection hits fake and forged shark fin product, with the legitimate rights and interests of Protection of consumer.
Existing people reports the kind identifying shark's fin by PCR and FINS method both at home and abroad at present, but exist pcr amplified fragment excessive be difficult to amplification out, also have design primer scope not wide, there is undetected possibility, and PCR method needs expensive plant and instrument, complicated operation.The main shark kind preparing shark's fin at present includes the husky KJ170949.1:Sphyrna lewini of colter, JX827259.1, Sphyrna lewini, HM239662.1 Sphyrna lewini, level and smooth tup shark KM489157.1 Sphyrna zygaena, bull shark KF646785.1 Carcharhinus leucas, grey true shark KC470543.1 Carcharhinus obscurus, black wing shark KJ720818.1 Carcharhinus melanopterus, hickie gummy shark AB015962.1 Mustelus manazo, Euclidean point kiss shark EU528659.1 Mitsukurina owstoni, White Marine fin shark AY820736.1 Carcharhinus longimanus, brown gummy shark EU099503.1 Mustelus henlei, KJ010763.1 Mustelus henlei, husky bullhead shark KF569943.1 Carcharias taurus, blue shark GU324148.1 Prionace glauca, tiger shark KF111728.1 Galeocerdo cuvier, grand-mother shark KF597303.1 Cetorhinus maximus, the sharks such as Smoothhound KF889325.1 Mustelus griseus.
Current existing detection method, its detecting step is loaded down with trivial details, adopts expensive equipment, can not realize fast, easily differentiating the shark's fin true and false.So the detection method of the existing discriminating shark's fin true and false needs to be further improved.
Summary of the invention
The object of the invention is to overcome weak point of the prior art, providing a kind of LAMP technology to differentiate the primer of the shark's fin true and false;
Another object of the present invention is to provide a kind of method adopting above-mentioned primer to differentiate the shark's fin true and false, and the method has fast, detection sensitivity is high, simple to operate, result directly can the feature such as interpretation.
In order to achieve the above object, the present invention adopts following scheme:
LAMP technology differentiates a primer for the shark's fin true and false, it is characterized in that comprising:
Forward outer primer F3:5'-CAGGATTTCCTGATCAATG-3 ';
Reverse outer primer B3:5'-GTGTGAACTCAGATCACGT-3 ';
Forward inner primer FIP:
5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3’;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c:AACCCTTTCTTCGATAGGGACTC;
F2:AACCAAGTTACCCTAGGGATA
Reverse inner primer BIP:
5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c:TACGGCCTCGATGTTGGATC;
B2:AGGACTGTTAATCGTTGAACAA。
LAMP technology differentiates a method for the shark's fin true and false, it is characterized in that comprising the following steps:
The extraction of A, shark's fin DNA
Nanometer magnetic bead is adopted to extract shark's fin DNA;
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-CAGGATTTCCTGATCAATG-3 ';
Reverse outer primer B3:5'-GTGTGAACTCAGATCACGT-3 ';
Forward inner primer FIP:
5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3’;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c:AACCCTTTCTTCGATAGGGACTC;
F2:AACCAAGTTACCCTAGGGATA
Reverse inner primer BIP:
5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c:TACGGCCTCGATGTTGGATC;
B2:AGGACTGTTAATCGTTGAACAA。
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses common carp DNA 5 μ L, and blank reaction uses deionized water 5 μ L, the DNA 5 μ L that positive control uses shark's fin itself to extract;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, at 60-70 DEG C of isothermal reaction 90min, last 60-80 DEG C, is incubated 5min to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
A kind of LAMP technology as above differentiates the method for the shark's fin true and false, it is characterized in that described (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:2-1:10.
A kind of LAMP technology as above differentiates the method for the shark's fin true and false, it is characterized in that each 1.6 μMs of described FIP and BIP, each 40pmol; Each 0.2 μM of F3 and B3, each 5pmol.
A kind of LAMP technology as above differentiates the method for the shark's fin true and false, it is characterized in that the nanometer magnetic bead described in steps A extracts shark's fin DNA concrete steps:
1) sample preparation: ground by different shark's fin sample file, gets the shark's fin tissue grinding sample 0.1-0.5g and adds 1mL extraction buffer and carry out grinding and make sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, suck ddH
2o;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH
2o in PCR pipe, with liquid-transfering gun compressing mixing nanometer magnetic bead after, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is shark's fin DNA.
A kind of LAMP technology as above differentiates the method for the shark's fin true and false, it is characterized in that described LAMP turbidimeter method includes real-time Turbidity measurement and/or terminal degree detects.
A kind of LAMP technology as above differentiates the method for the shark's fin true and false, it is characterized in that the method that described fluorescence is estimated:
Use UV irradiation equipment upwards to irradiate bottom test tube, wear ultraviolet protection glasses and carry out sight from test tube side and look into; Send green glow if the same with positive control, be then judged to be the positive, do not send fluorescence if the same with negative control, and be judged to be feminine gender.
The present invention adopts ring mediated isothermal amplification loop-mediated isothermal amplification, being called for short LAMP is a kind of new nucleic acid detection method, its principle utilizes the primer of 4 particular design and have the archaeal dna polymerase of strand-displacement activity, special under constant temperature, efficiently, the new technology of DNA amplification rapidly.This technology can amplify 10 in l hour
9target sequence copies, and shows the staged collection of illustrative plates be made up of the zone of different size after amplified production electrophoresis on gel.Traditional round pcr, after PCR terminates, need PCR primer to be carried out to the methods such as agarose gel electrophoresis and detect, complex operation step, wastes time and energy, and there is the harm to human body and environment of ethidium bromide or isotropic substance.And the LAMP technology that this institute sets up detect shark's fin save time, economical and susceptibility is high.Whether detected result only need utilize the green fluorescence of LAMP turbidimeter or SYBG or whether be produced white precipitate occurred with regard to knowing reaction by range estimation, and does not need loaded down with trivial details detected through gel electrophoresis process.
In sum, beneficial effect of the present invention:
The present invention adopts paramagnetic particle method to extract the DNA of shark's fin and the versatility Auele Specific Primer that shark's fin LAMP detects according to the mitochondrial COI gene sequences Design of shark's fin shark, by to different shark class specific detection, establish the method that LAMP method differentiates the shark's fin true and false, its absolute sense is limited to 10fg/ μ L.In the present invention, primer specificity and versatility are better, highly sensitive; The inventive method successfully can detect true and false discriminating in commercially available shark's fin goods and provide a kind of effective technique means.By body series can in one hour the highly sensitive true and false identifying shark's fin, detection sensitivity reaches 10fg.The inventive method does not need expensive instrument and equipment in addition, only need an insulation can, simple to operate, result directly can interpretation, be applicable to very much the use of basic unit one line, have broad application prospects and extraordinary practical value in food adulteration, illegal context of detection of adding.
Accompanying drawing explanation
Fig. 1 is LAMP specific test result of the present invention;
Fig. 2 is the result of LAMP sensitivity evaluation of the present invention.
Embodiment
Below in conjunction with embodiment, the present invention is described further:
In following examples of the present invention adopt material:
1, various shark's fin laboratory sample is all purchased from food company and market.
2, main agents
DNA amplification reaction test kit Loopamp DNA Amplification kit,
fluorescence visual detection test kit,
fluorescence Detection Reagent,
reaction tube is all purchased in Beijing Lanpu Biological Technology Co., Ltd..
3, key instrument equipment
(1)-80 DEG C of deep freezer;
(2) the freezing desk centrifuge of Labofuge400R high speed;
(3 micropipets, 1000 μ L, 200 μ L, 100 μ L, 10 μ L, 2.5 μ L;
(4 ultrapure water system, Milli-Q Academic, Millipore company;
(5 Bechtopes;
(6 eddy mixers;
(the real-time turbidimeter of 7LAMP, LA-320C, Japanese Rong Yan biotech firm.
Embodiment 1
LAMP technology of the present invention differentiates the method for the shark's fin true and false, comprises the following steps:
The extraction of A, shark's fin DNA
Nanometer magnetic bead is adopted to extract shark's fin DNA;
1) sample preparation: ground by different shark's fin sample file, gets the shark's fin tissue grinding sample 0.1g and adds 1mL extraction buffer and carry out grinding and make sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, suck ddH
2o;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH
2o in PCR pipe, with liquid-transfering gun compressing mixing nanometer magnetic bead after, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is shark's fin DNA.
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-CAGGATTTCCTGATCAATG-3 ';
Reverse outer primer B3:5'-GTGTGAACTCAGATCACGT-3 ';
Forward inner primer FIP:
5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3’;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c:AACCCTTTCTTCGATAGGGACTC;
F2:AACCAAGTTACCCTAGGGATA
Reverse inner primer BIP:
5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c:TACGGCCTCGATGTTGGATC;
B2:AGGACTGTTAATCGTTGAACAA。
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses common carp DNA 5 μ L, and blank reaction uses deionized water 5 μ L, the DNA 5 μ L that positive control uses shark's fin itself to extract;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, in 60 DEG C of isothermal reaction 90min, is incubated 5min at last 60 DEG C to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
Embodiment 2
LAMP technology of the present invention differentiates the method for the shark's fin true and false, comprises the following steps:
The extraction of A, shark's fin DNA
Nanometer magnetic bead is adopted to extract shark's fin DNA;
1) sample preparation: ground by different shark's fin sample file, gets the shark's fin tissue grinding sample 0.1g and adds 1mL extraction buffer and carry out grinding and make sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, suck ddH
2o;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH
2o in PCR pipe, with liquid-transfering gun compressing mixing nanometer magnetic bead after, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is shark's fin DNA.
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-CAGGATTTCCTGATCAATG-3 ';
Reverse outer primer B3:5'-GTGTGAACTCAGATCACGT-3 ';
Forward inner primer FIP:
5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3’;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c:AACCCTTTCTTCGATAGGGACTC;
F2:AACCAAGTTACCCTAGGGATA
Reverse inner primer BIP:
5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c:TACGGCCTCGATGTTGGATC;
B2:AGGACTGTTAATCGTTGAACAA。
Wherein said (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:2.
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses common carp DNA 5 μ L, and blank reaction uses deionized water 5 μ L, the DNA 5 μ L that positive control uses shark's fin itself to extract;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, at 60 DEG C of isothermal reaction 90min, last 60-80 DEG C, is incubated 5min to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
Wherein said LAMP turbidimeter method includes real-time Turbidity measurement and/or terminal degree detects.
Embodiment 3
LAMP technology of the present invention differentiates the method for the shark's fin true and false, comprises the following steps:
The extraction of A, shark's fin DNA
Nanometer magnetic bead is adopted to extract shark's fin DNA;
1) sample preparation: ground by different shark's fin sample file, gets the shark's fin tissue grinding sample 0.5g and adds 1mL extraction buffer and carry out grinding and make sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, suck ddH
2o;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH
2o in PCR pipe, with liquid-transfering gun compressing mixing nanometer magnetic bead after, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is shark's fin DNA.
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-CAGGATTTCCTGATCAATG-3 ';
Reverse outer primer B3:5'-GTGTGAACTCAGATCACGT-3 ';
Forward inner primer FIP:
5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3’;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c:AACCCTTTCTTCGATAGGGACTC;
F2:AACCAAGTTACCCTAGGGATA
Reverse inner primer BIP:
5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c:TACGGCCTCGATGTTGGATC;
B2:AGGACTGTTAATCGTTGAACAA。
Wherein said (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:10.
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses common carp DNA 5 μ L, and blank reaction uses deionized water 5 μ L, the DNA 5 μ L that positive control uses shark's fin itself to extract;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, in 70 DEG C of isothermal reaction 90min, is incubated 5min at last 80 DEG C to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
Wherein said LAMP turbidimeter method includes real-time Turbidity measurement and/or terminal degree detects.
Embodiment 4
LAMP technology of the present invention differentiates the method for the shark's fin true and false, comprises the following steps:
The extraction of A, shark's fin DNA
Nanometer magnetic bead is adopted to extract shark's fin DNA;
1) sample preparation: ground by different shark's fin sample file, gets the shark's fin tissue grinding sample 0.2g and adds 1mL extraction buffer and carry out grinding and make sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, suck ddH
2o;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH
2o in PCR pipe, with liquid-transfering gun compressing mixing nanometer magnetic bead after, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is shark's fin DNA.
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-CAGGATTTCCTGATCAATG-3 ';
Reverse outer primer B3:5'-GTGTGAACTCAGATCACGT-3 ';
Forward inner primer FIP:
5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3’;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c:AACCCTTTCTTCGATAGGGACTC;
F2:AACCAAGTTACCCTAGGGATA
Reverse inner primer BIP:
5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c:TACGGCCTCGATGTTGGATC;
B2:AGGACTGTTAATCGTTGAACAA。
Wherein said (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:5.
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses common carp DNA 5 μ L, and blank reaction uses deionized water 5 μ L, the DNA 5 μ L that positive control uses shark's fin itself to extract;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, in 65 DEG C of isothermal reaction 90min, is incubated 5min at last 70 DEG C to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
Wherein said LAMP turbidimeter method includes real-time Turbidity measurement and/or terminal degree detects.
Embodiment 5
LAMP technology of the present invention differentiates the method for the shark's fin true and false, comprises the following steps:
The extraction of A, shark's fin DNA
Nanometer magnetic bead is adopted to extract shark's fin DNA;
1) sample preparation: ground by different shark's fin sample file, gets the shark's fin tissue grinding sample 0.3g and adds 1mL extraction buffer and carry out grinding and make sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, suck ddH
2o;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH
2o in PCR pipe, with liquid-transfering gun compressing mixing nanometer magnetic bead after, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is shark's fin DNA.
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-CAGGATTTCCTGATCAATG-3 ';
Reverse outer primer B3:5'-GTGTGAACTCAGATCACGT-3 ';
Forward inner primer FIP:
5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3’;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c:AACCCTTTCTTCGATAGGGACTC;
F2:AACCAAGTTACCCTAGGGATA
Reverse inner primer BIP:
5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c:TACGGCCTCGATGTTGGATC;
B2:AGGACTGTTAATCGTTGAACAA。
Wherein said (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:8.
Each 1.6 μMs of described FIP and BIP, each 40pmol, the i.e. each 0.64 μ L of FIP and BIP, namely; Each 0.2 μM of F3 and B3, each 5pmol, the i.e. each 0.01 μ L of F3 and B3.
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses common carp DNA 5 μ L, and blank reaction uses deionized water 5 μ L, the DNA 5 μ L that positive control uses shark's fin itself to extract;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, in 60 DEG C of isothermal reaction 90min, is incubated 5min at last 60 DEG C to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
LAMP turbidimeter method described in the present invention includes real-time Turbidity measurement and/or terminal degree detects.
1. real-time Turbidity measurement
Use the real-time turbidity measurement device of Loopamp, can detect in real time;
2. terminal turbidity measurement:
Use Loopamp terminal turbidity measurement device, the turbidity at the end of detection can be detected;
3. fluorescence range estimation detects
Use
fluorescence visual detection test kit, can be judged result by range estimation.After amplified reaction terminates, use UV irradiation equipment (wavelength 240 ~ 260nm, 350 ~ 370nm) upwards to carry out uviolizing bottom reaction tube, observe from reaction tube side after the safety appliances such as wearing spectacles.Send green fluorescence if the same with positive control, be then judged to be the positive, do not send fluorescence if the same with negative control, be then judged to be feminine gender.
Can fluoresced green after SYBR Green I dyestuff is combined with double-stranded DNA, if dye colour orangely becomes green from what start, then illustrate that detected result is positive.
In order to verify specificity and the susceptibility of primer of the present invention, the present invention has done following test:
One, LAMP specific test
The template of reacting using shark's fin DNA as LAMP, carp DNA is as negative control, by the LAMP primer of this experimental design, LAMP reaction is carried out according to the LAMP reaction conditions optimized, to verify the specificity of each primer, utilize LAMP turbidimeter and SYBR Green observation method of naked eye Synchronous reaction result.
Result as shown in Figure 1, CH1-7: different shark's fin DNA sample (husky, the level and smooth tup shark of colter, bull shark, the true shark of grey, black wing shark, hickie gummy shark, brown gummy shark), CH8: negative control (carp).
As seen from Figure 1, primer only detects shark's fin specificity, and appearance time is all between 39-42 minute.
Two, LAMP sensitivity evaluation
By shark's fin DNA according to 10
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6doubly be diluted to concentration gradient, each extent of dilution is got 2 μ l respectively and is carried out LAMP experiment, with ddH
2o replaces DNA profiling as blank, increases, to determine the sensitivity that LAMP reacts, get 2 μ l respectively for MNP-PCR amplified reaction simultaneously according to the LAMP reaction conditions optimized.
Shark's fin (hickie gummy shark) DNA aforementioned proportion is diluted to a series of concentration gradient, is respectively used to carry out LAMP reaction result as shown in Figure 2, in the detected result of LAMP turbidimeter, can find out that the detection limit that LAMP reacts can reach 10
-5extent of dilution (10fg/ μ L).Wherein CH1 in Fig. 2: negative control (carp); CH 2-7 is respectively extent of dilution: 10
-1, 10
-2, 10
-3, 10
-4, 10
-5, 10
-6.
Claims (7)
1. differentiate a primer for the shark's fin true and false for LAMP technology, it is characterized in that comprising:
Forward outer primer F3:5'-CAGGATTTCCTGATCAATG-3 ';
Reverse outer primer B3:5'-GTGTGAACTCAGATCACGT-3 ';
Forward inner primer FIP:
5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3’;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c:AACCCTTTCTTCGATAGGGACTC;
F2:AACCAAGTTACCCTAGGGATA
Reverse inner primer BIP:
5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c:TACGGCCTCGATGTTGGATC;
B2:AGGACTGTTAATCGTTGAACAA。
2. differentiate a method for the shark's fin true and false by LAMP technology, it is characterized in that comprising the following steps:
The extraction of A, shark's fin DNA
Nanometer magnetic bead is adopted to extract shark's fin DNA;
B, set up LAMP reaction system
The LAMP reaction system of 25 μ L comprises 20 μ L pre-reaction solution and 5 μ L DNA profilings, wherein 20 μ L pre-reaction solution, composed of the following components:
The sequence of described primer comprises:
Forward outer primer F3:5'-CAGGATTTCCTGATCAATG-3 ';
Reverse outer primer B3:5'-GTGTGAACTCAGATCACGT-3 ';
Forward inner primer FIP:
5'-AACCCTTTCTTCGATAGGGACTC-AACCAAGTTACCCTAGGGATA-3’;
Wherein said forward inner primer FIP comprises F1c and F2 sequence:
F1c:AACCCTTTCTTCGATAGGGACTC;
F2:AACCAAGTTACCCTAGGGATA
Reverse inner primer BIP:
5'-TACGGCCTCGATGTTGGATC-AGGACTGTTAATCGTTGAACAA-3’
Described reverse inner primer BIP comprises containing B1c and B2 sequence:
B1c:TACGGCCTCGATGTTGGATC;
B2:AGGACTGTTAATCGTTGAACAA;
C, in Loopamp reaction tube, add each 20 μ L of above-mentioned pre-reaction solution respectively;
D, in pre-reaction solution, add detected sample DNA 5 μ L to be detected, make total amount reach 25 μ L;
In E, control reaction, negative control reaction uses common carp DNA 5 μ L, and blank reaction uses deionized water 5 μ L, the DNA 5 μ L that positive control uses shark's fin itself to extract;
F, with the mixing of pipettor liquid sucking-discharging method, or close the cover touches and makes solution fully mix rear brief centrifugation;
G, mixture is placed in the reacting hole of LAMP turbidimeter, at 60-70 DEG C of isothermal reaction 90min, last 60-80 DEG C, is incubated 5min to terminate reaction;
H, the method Check and Inspection result adopting LAMP turbidimeter method or fluorescence to estimate.
3. a kind of LAMP technology according to claim 2 differentiates the method for the shark's fin true and false, it is characterized in that described (forward outer primer F3+ reverse outer primer B3): the concentration ratio of (the reverse inner primer BIP of forward inner primer FIP+) is 1:2-1:10.
4. a kind of LAMP technology according to claim 3 differentiates the method for the shark's fin true and false, it is characterized in that each 1.6 μMs of described FIP and BIP, each 40pmol; Each 0.2 μM of F3 and B3, each 5pmol.
5. a kind of LAMP technology according to claim 2 differentiates the method for the shark's fin true and false, it is characterized in that the nanometer magnetic bead described in steps A extracts shark's fin DNA concrete steps:
1) sample preparation: ground by different shark's fin sample file, gets the shark's fin tissue grinding sample 0.1-0.5g and adds 1mL extraction buffer and carry out grinding and make sample;
2) nanometer magnetic bead is cleaned: take out nanometer magnetic bead in PCR pipe, use ddH
2o cleans nanometer magnetic bead 3 times repeatedly, under the effect of magnet, suck ddH
2o;
3) combine: the sample adding 100 μ L, in PCR pipe, mixes sample and nanometer magnetic bead by liquid-transfering gun compressing, absorption at room temperature;
4) clean: under the effect of magnet, remove supernatant, nanometer magnetic bead cleans 3 times;
5) cracking: add 50 μ L ddH
2o in PCR pipe, with liquid-transfering gun compressing mixing nanometer magnetic bead after, 95 DEG C, 10min;
6) sample: use magnet adsorption nanometer magnetic bead, after solution clarification in PCR pipe, supernatant is shark's fin DNA.
6. a kind of LAMP technology according to claim 2 differentiates the method for the shark's fin true and false, it is characterized in that described LAMP turbidimeter method includes real-time Turbidity measurement and/or terminal degree detects.
7. a kind of LAMP technology according to claim 2 differentiates the method for the shark's fin true and false, it is characterized in that the method that described fluorescence is estimated:
Use UV irradiation equipment upwards to irradiate bottom test tube, wear ultraviolet protection glasses and carry out sight from test tube side and look into; Send green glow if the same with positive control, be then judged to be the positive, do not send fluorescence if the same with negative control, and be judged to be feminine gender.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510363949.2A CN104946766B (en) | 2015-06-25 | 2015-06-25 | LAMP technology differentiates the primer and method of the shark's fin true and false |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510363949.2A CN104946766B (en) | 2015-06-25 | 2015-06-25 | LAMP technology differentiates the primer and method of the shark's fin true and false |
Publications (2)
Publication Number | Publication Date |
---|---|
CN104946766A true CN104946766A (en) | 2015-09-30 |
CN104946766B CN104946766B (en) | 2017-12-22 |
Family
ID=54161828
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510363949.2A Active CN104946766B (en) | 2015-06-25 | 2015-06-25 | LAMP technology differentiates the primer and method of the shark's fin true and false |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104946766B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN117196657A (en) * | 2023-09-28 | 2023-12-08 | 辽宁嘉玉科技有限公司 | Product rapid identification method based on magnetic nanoparticle harmonic signal coding mode |
-
2015
- 2015-06-25 CN CN201510363949.2A patent/CN104946766B/en active Active
Non-Patent Citations (1)
Title |
---|
覃芳芳等: "鱼翅类食品中鲨鱼成分PCR鉴定方法研究", 《现代食品科技》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN117196657A (en) * | 2023-09-28 | 2023-12-08 | 辽宁嘉玉科技有限公司 | Product rapid identification method based on magnetic nanoparticle harmonic signal coding mode |
CN117196657B (en) * | 2023-09-28 | 2024-04-02 | 辽宁嘉玉科技有限公司 | Product rapid identification method based on magnetic nanoparticle harmonic signal coding mode |
Also Published As
Publication number | Publication date |
---|---|
CN104946766B (en) | 2017-12-22 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104673900B (en) | A method of differentiating animal derived materials in meat or meat products | |
CN103122386B (en) | Molecular identification method for Atlantic salmon | |
CN103361422B (en) | Multiplex-PCR rapid detection method for identification of adulterated meat and products thereof | |
CN104004836B (en) | The real-time fluorescence PCR detection method of gadidae cod composition | |
CN104372104B (en) | A kind of LAMP detection primer composition of camphor tree phytophthora and LAMP detection kit thereof and LAMP detection method | |
CN102776297A (en) | Reagent kit for distinguishing and detecting dengue virus/yellow fever virus/west nile virus/chikungunya virus | |
CN103525913B (en) | Phytophthora capsici LAMP (Loop-mediated isothermal Amplification) primer and rapid detection method thereof | |
CN103710433A (en) | Babesiidae protozoon detection primer and real-time fluorescent quantitative PCR (polymerase chain reaction) kit | |
CN102559928A (en) | Specific primer group, kit comprising the primer group, use method and detection method | |
CN105506069A (en) | Kit for identifying authenticity of shark's fin by adopting LAMP technology | |
CN102643919B (en) | Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food | |
CN104946798B (en) | The primer and method of tobacco mosaic virus (TMV) LAMP detections | |
CN102899416A (en) | Cucumber phytophthora LAMP (Loop-mediated Isothermal Amplification) primer and rapid detection method thereof | |
CN104513857A (en) | Loop-mediated isothermal amplification detection primer group, detection method and kit of vibrio parahaemolyticus | |
CN103773865A (en) | LAMP (Loop-Mediated Isothermal Amplification) primer of phytophthora nicotianae and fast detection method thereof | |
CN104946766B (en) | LAMP technology differentiates the primer and method of the shark's fin true and false | |
CN103451315A (en) | Loop-mediated isothermal amplification detection primer set and kit for rotaviruses as well as detection method | |
CN103451316A (en) | Primer and kit as well as method for detecting cymbidium mosaic virus | |
CN105177178A (en) | Tobacco mosaic virus LAMP detection kit | |
CN104232755A (en) | Tobacco phytophthora LAMP detection primer and rapid detection method thereof | |
CN103173530A (en) | Detection method of LAMP (Loop-Mediated Isothermal Amplification) specificity of pine wood nematodes | |
CN103131759A (en) | Molecular biological method of identifying sparus latus | |
CN105039560B (en) | A kind of lichee anthrax-bacilus LAMP primer and its quick determination method and application | |
CN101550458A (en) | Hepatitis a virus detecting method in food | |
CN105838788A (en) | Real-time fluorescence PCR specific detection system and applications of Micromesistius poutassou |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |