CN104946746A - Folic acid heredity metabolism ability detection using mass spectrum - Google Patents

Abstract

The invention relates to folic acid heredity metabolism ability detection using mass spectrum, and discloses a primer system for detecting folic acid heredity metabolism ability-associated gene polymorphism sites (SNP). A product produced on the basis of the primer system can realize simultaneous detection of the folic acid heredity metabolism ability-associated gene polymorphism sites. The product is used to detect the folic acid heredity metabolism ability-associated gene polymorphism sites in order to provide reference basis for guidance of reasonable administration of women preparing for pregnancy and pregnant women. The system and the product allow three gene polymorphism sites on different genes to be simultaneously detected in a reaction system; and compared with sequencing, real-time fluorescent quantitative PCR and other technologies, a method adopting the system or the product has the advantages of low cost, simple operation, and increased accuracy and sensitivity.

Description

Utilize mass spectrum to carry out folic acid heredity metabolize ability to detect

Technical field

The invention belongs to biological technical field, relate to a kind of for determining detection method and the product of folic acid heredity metabolize ability related gene polymorphism site (SNP), specifically utilize multiple PCR technique, single-basic extension technology and mass-spectrometric technique, the method that detects and corresponding test kit are carried out in 3 gene polymorphic sites of folic acid heredity metabolize ability.

Background technology

Folic acid is the one of vitamin B group, participates in the synthesis of other important compound such as DNA, RNA, protein, plays an important role in organism metabolism process, is usually used in maternal weight gain and supplements, thus the diseases such as prevention neural tube defect.

China suffers from inborn defect and comes first 5 comprising: congenital heart disease, neural tube defects, harelip, Down's syndrome, refers to (toe) more.According to the statistics of 2003, the number of the infected of China's congenital heart disease reached 11-16 ten thousand people.According to the statistics of 2004, the morbidity incidence of China's neural tube defects was 9.44/ ten thousand.In addition, according to the statistics of 2003, sickness rate position 18000 people of Down's syndrome,

Neural tube defects refer to due to embryo be developed in parent 3-4 week time, neurocele fails to close caused birth defect, can cause spina bifida, Naoning tablet and anencephalia.

Congenital heart disease be organogenetic period cardiovascular systems grow a kind of disease caused.Research shows, HCY can affect the early stage cardiovascular development of embryo, and Supplement of folic acid obviously can alleviate homocysteine to cardiovascular development toxicity, reduces the onset risk of CHD.

Have research to think, the defect due to folic acid metabolism genes involved causes methylating that the metabolic disturbance of folic acid causes and causes ploidy level, may be the Hazard Factor that mongolism occurs.

Folic acid deficiency causes HCY, thus causes harelip, comprises harelip (being commonly called as: harelip) and cleft palate (being commonly called as: lycostoma).This disease with participate in the gene of folic acid metabolism and have much relations, if the elder brother of a baby or elder sister also have this birth defect, may there is this defect just than many 30 to 40 times of other babies in this baby.

Hyperhomocysteinemiainjury and pregnancy induced hypertension syndrome in close relations, can vascular endothelial cell damage be caused, and may be one of pathogenic factors of pregnancy induced hypertension syndrome.The light moderate of Hcy raises and the anticoagulating activity of endotheliocyte can be caused to decline, and endotheliocyte can be made to synthesize and reduce, affect the synthesis of prostacyclin (PGI2), and PGI2 has the hematoblastic adhesion of suppression and gathering, strengthens angiectatic effect.

In pregnant woman's body, folic acid deficiency is one of major reason causing premature labor or miscarriage.The miscarriage that folic acid deficiency causes or premature labor, adopt other any remedial measures to be all difficult to avoid.

A large amount of scientific researches shows, folic acid takes in absolute or relative shortage, is the immediate cause causing hyperhomocysteinemiainjury.Cause the major cause of folic acid deficiency, inherited genetic factors: the congenital deficiency of body folic acid Utilization ability, causes folic acid deficiency; Insufficiency of intake: meals Folic Acid is not enough or cooking refining losses; Requirement increases: pregnant woman, wet nurse are in special physiological status, and folic acid requirement increases, and causes relative deficiency; Other undesirable element: indulge in excessive drinking, take the shortage that some drugs (as anticonvulsion class medicine) etc. all can cause folic acid.

Methylene tetrahydrofolate reductase (MTHFR) is the key enzyme of folic acid metabolism, and catalysis 5,10-CH2-THFA is reduced to 5-methyltetrahydrofolate.Mankind's mthfr gene is positioned at karyomit(e) 1p36.3, wherein has multiple relevant SNP site active in MTHFR, such as G1965A, A1515C, C894T and 677C and 1298A etc.

MTHFR the 1298th bit base A>C suddenlys change (rs1801131), glutamine is caused to be replaced by L-Ala, generation creates three kinds of genotype: wild-type (A/A), heterozygous mutant (A/C) and homozygous mutant (C/C), cause MTHFR activity decrease, the ability that homocysteine is converted into methionine(Met) declines, and causes halfcystine in blood plasma (Hcy) to raise.Wherein wild-type, heterozygous mutant and homozygous mutant three kinds of genotype proportion that distributes in Chinese population is 66.8%, 29.3% and 3.9%.

MTHFR the 677th bit base C>T suddenlys change (rs1801133), the L-Ala of coding MTHFR albumen folic acid calmodulin binding domain CaM 222 is caused to be replaced by α-amino-isovaleric acid, create three kinds of genotype: wild-type (C/C), heterozygous mutant (C/T) and homozygous mutant (T/T), cause MTHFR enzymic activity to reduce, homocysteine accumulates in vivo.Wherein wild-type, heterozygous mutant and homozygous mutant three kinds of genotype proportion that distributes in Chinese population is 33%, 44% and 23%.

Methionine synthetase reductase enzyme (MTRR) can regenerate the methionine synthases with functionally active by reduced form methylation, is one of key enzyme of folic acid metabolism.Primary mutations type has more than ten to plant, and wherein A2756G is comparatively common in the crowd of west, also has 122M (A66G), S175L, some other fragment insertion and deletion and point mutation in addition, and wherein A66G is main and sudden change that is most study.

MTRR gene the 66th bit base A>G suddenlys change (rs1801394), at amino acid chain residue 22 place, methionine(Met) is substituted by Isoleucine, the activity of MTRR enzyme can be caused to reduce, easily cause the disease such as plasma homocysteine, neural tube defect.Said gene Mutation, the folic acid Utilization ability of meeting remarkably influenced body, and then cause pregnant woman's onset risk and baby due defect.Wherein wild-type (A/A), heterozygous mutant (A/G) and homozygous mutant (G/G) three kinds of genotype proportion that distributes in Chinese population is 58%, 36% and 6%.

The congenital deficiency of body folic acid Utilization ability, when causing folic acid deficiency, needs supplementing suitable folic acid, to maintain normal biological metabolism in body machine.China recommends pregnancy period magnitude of recruitment to be 400 micro-grams/day, to can significantly reduce the inborn defect of infant, if reduce NTDs (41%-85%), but also have 15%-59% but DeGrain, NTDs can be reduced further by the folic acid increasing suitable dose.Personalized Supplement of folic acid, namely allows Supplement of folic acid have more specific aim.Expert advice: according to the genetic constitution of oneself, supplements the folic acid of suitable dose in the correct time.

To the detection of mthfr gene, MTRR gene and related locus thereof, the hereditary defect (i.e. the Utilization ability of folic acid) of detected person's folic acid metabolism aspect directly can be found, thus according to risk height (level of activity of associated metabolic enzyme).As detected by the pregnancy period folic acid Utilization ability of contriver and CDC mother and child care center complex tissue the supplement reference quantity that provides:

Table 1: pregnancy period folic acid Utilization ability detects the supplement reference scale provided

More than supplement the intake that dosage refers to synthesize folic acid supplement or reinforcer, do not comprise food; Comprise pregnant woman and wet nurse to all grownups, the highest intake (UL) tolerated of synthesis foliamin is set as 1000 micro-grams/day.Therefore the foliamin of 800 micro-grams/day is safe.

Not The more the better to the supplement dosage of folic acid.Large quantity research finds, excessive Supplement of folic acid can cause following adverse consequences: cause zn deficiencie in body.Zinc is the activator of multiple enzyme, and therefore, the excessive supplementary meeting of pregnant mother causes fetal growth slow, and baby weight is too low.

Utilize modern genetic typing method (fluorescent PCR, Sanger order-checking etc.) to detect the folic acid metabolism genes involved of pregnant woman, according to genotypic results, classification is carried out to person under inspection's folic acid Utilization ability, and then adjust folic acid supplement amount targetedly.In detection technique conventional at present, order-checking need detect one by one to multiple site, complicated operation, costly.Though chip method can detect multiple site, operating process is loaded down with trivial details, and testing cost is high.

Chinese utility model patent ZL 201420084983 and patent of invention ZL201410067910, title " test kit in single tube simultaneous determination aldehyde dehydrogenase 2 gene and Methylene tetrahydrofolate reductase gene mutational site and detection method " disclose a kind of method utilizing multiple PCR technique to detect Methylene tetrahydrofolate reductase gene mutational site, the method can the C677T mutational site of Accurate Determining MTHFR, thus be conducive to predicting the individual metabolic capacity to folic acid, instruct pregnant and lying-in women and children to supplement the folic acid supplement etc. of applicable dosage.But this technology can only detect single mutational site, and still there is the defect of conventional PCR amplification detection technique.

During new technology in the mutational site of applying detection mthfr gene and/or MTRR gene is come, mass-spectrometric technique demonstrates its advantage accurately and efficiently.Wherein, a filial piety equality (pancreatic cancer cell DPYD, mthfr gene single nucleotide polymorphism analysis, " Shandong medicine " the 45th phase in 2011, stomach cancer cell DPYD, the detection of mthfr gene single nucleotide polymorphism, " Jiangsu medicine " the 17th phase in 2011) and (the application mass-spectrometric technique detection colorectal carcinoma DPYD such as Chen Baoan, mthfr gene single nucleotide polymorphism, " canceration distortion sudden change " the 24th volume the 2nd phase) disclose three SNPs sites G1965A (rs2274976) utilizing MALDI-TOF mass-spectrometric technique to detect mthfr gene, A1515C (rs1801131) and C894T (rs1801133), found that this site mutation may cause MTHFR activity change, affect the internal metabolism of fluorouracil drug, and it is relevant to the curative effect of fluorouracil drug and toxic side effects.But, above technology is all sudden changes of joint-detection DPYD gene (dihydropyrimidine dehydrogenase gene) and mthfr gene, by curative effect and the toxic side effects of prediction dlinial prediction 5-FU class medicine, tumour patient is made to select optimal drug scheme, dosage and reduce in medicine toxic side effects benefited to greatest extent.Therefore, researchist is according to the instruction of above-mentioned technology, be easy to expect that the best therapeutic regimen of tumour patient is determined in above-mentioned three sites detecting MTHFR by mass-spectrometric technique, and be difficult to expect that carrying out adjustment to these three sites changes, and be difficult to expect that being used to guide folic acid takes the purposes that crowd rationally takes in folic acid.

Described in comprehensive, the technical problem of current existence is: lack method and the product that once can detect the gene polymorphic site that multiple folic acid is correlated with simultaneously, common detection technique, as order-checking, real-time fluorescence quantitative PCR etc., loci is all needed to detect one by one, the complicated operation when site is more, costly.And existing mass spectrum detection, full disclosure is not simultaneously for the detection technique in above multiple site, and these technology still rest on the related fields of lesion detection simultaneously.Therefore a kind of mass spectrum detection different from the past is needed at present, can detect by the multiple SNP for same individuality in same system, by the Detection Information of this technology, rationally take folic acid for instructing standby pregnant women and pregnant woman and reference frame is provided, thus fill up China to instruct the folic acid crowd that takes rationally to take in the field of folic acid blank.

Summary of the invention

Basis of the present invention is, contriver, by the detected result (see table 1) with CDC mother and child care center complex tissue, clearly finds that different crowd is taken requirement for folic acid and be there are differences.In view of human body takes in the side effect of too much folic acid existence, mislead in conjunction with the defect in existing research and technology, by optimal screening SNP detection site and correlation detection product, ultimately provide a kind of associating multiple PCR technique, single-basic extension technology and mass spectrum detection, detect the detection scheme of folic acid genes involved polymorphic site (SNP).Wherein: in multiplex PCR, increase 3 from different genes and containing the DNA fragmentation of SNP simultaneously; In single-basic extension process, multiple single-basic extension is carried out to the purified product of multiplex PCR, extend primer and extend a Nucleotide respectively at 3 SNP places, make extended nucleotide type, relevant to the genotype at SNP place respectively; Single-basic extension produces the mixture to be checked be made up of extension primer and extension products, with mass spectrum, mixture to be checked is detected, each molecular weight of material in mixture to be checked is determined by mass spectra peak, and compare with the theoretical molecular of precalculated each extension primer and extension products, thus determine whether mixture to be checked comprises specific material, and then determine the genotype at each SNP place.Wherein, the present invention is directed to multiple SNP site in MTHFR, MTRR gene, in conjunction with the content of prior art, be optimized screening, therefrom determine that 3 sites are as the target spot detected, i.e.: mthfr gene rs1801131 site (A1298C), mthfr gene rs1801133 site (C677T), and MTRR gene rs1801394 site (A66G).

Therefore, the present invention's first object is to provide a kind of Primer composition for detecting the SNP that folic acid heredity metabolize ability is correlated with, and its sequence is as shown in table 2.

Table 2

Wherein, described 3 SNP site respectively: mthfr gene rs1801133 site (C677T), mthfr gene rs1801131 site (A1298C), MTRR gene rs1801394 site (A66G).

Wherein, the extension primer that each site is corresponding and extension products molecular weight as shown in table 3.

Table 3

In one embodiment, above-mentioned PCR primer sequence is core sequence, and it can comprise protection base sequence, a preferred 5-15 base at 5' end.In a specific embodiment; protection base sequence is selected from the tag (ACGTTGGATG) adding 10bp at 5' end; the sequence of protection base makes the molecular weight of PCR primer (i.e. core primers) increase; can avoid reacting remaining PCR primer enters in mass spectrometric detection process, to avoid interference Detection results in the lump.In addition, in a specific embodiment, the 5' end extending primer also can increase base sequence (as above-mentioned protection base sequence) in right amount.Increase the object of base sequence be when extension primer corresponding to two gene polymorphic sites and product molecular weight close to time, all base is increased by extending primers to one of them extension primer or two, change the molecular weight of primer and product thereof, and widen gap between other molecular weight extending primer and product, improve Detection results.And the primer after increase and molecular weight of product, exceed detection window scarcely.

Such as, PCR primer SEQ ID NO:1 is 5'-ACGTTGGATGGTGCATGCCTTCACAAAGCG-3 '.In another embodiment, the 5' extending primer holds the base sequence that also can increase as joint.

The present invention's second object there is provided the testing product prepared by above-mentioned Primer composition.Wherein, this product is selected from detection kit, detection reagent, detection chip etc.

In one embodiment, this product is detection kit, comprising:

(1) for the reaction reagent of PCR, comprising: Specific PCR primers, resistant to elevated temperatures archaeal dna polymerase, dNTPs, PCR reaction buffer;

(2) for the reagent of PCR primer purifying;

(3) for the reagent of single base extension, comprising: extend primer, resistant to elevated temperatures single-basic extension enzyme, ddNTPs, extension damping fluid.

In a specific embodiment, this test kit also can comprise: negative quality control product, positive quality control product, purifying resin, and point sample and mass spectrometric detection target sheet, excision enzyme, human gene group DNA extracts the reagent such as reagent.

In another embodiment, the reagent for PCR primer purifying: alkaline phosphatase, or alkaline phosphatase and excision enzyme ExoI, or running gel reclaims reagent, or PCR primer purification column.Wherein when comprising the purified reagent of alkaline phosphatase and excision enzyme ExoI, the PCR primer used is without the need to comprising protection base.

The present invention's the 3rd object uses above-mentioned Primer composition, product or test kit to the method in the gene polymorphic site detected folic acid heredity metabolize ability and be correlated with, and comprises the steps:

(1) multiplex PCR: use specific PCR primer, in a reaction system, increasing in the gene polymorphic site place region of DNA territory relevant to folic acid heredity metabolize ability to 3 places simultaneously, obtains the PCR primer containing 3 region of DNA territories, place, gene polymorphic site, place;

(2) PCR primer purifying: carry out purifying to the PCR primer that step (1) obtains, to reduce the interference to subsequent reactions;

(3) single-basic extension: use 3 specific extension primers, in a reaction system, after the purifying obtain step (2), PCR primer carries out multiple single-basic extension, extend primer and extend a Nucleotide at the SNP site place of correspondence, the genotype complementary pairing at this Nucleotide and SNP site place;

(4) extension products purifying: carry out purifying to the extension products that step (3) obtains, to obtain high-purity extension products, avoids the impurity such as salt ion on the impact of subsequent detection;

(5) mass spectrograph detects: purified product point step (4) obtained, on the target sheet containing matrix, is put into mass spectrograph and carried out detecting;

Wherein, described 3 SNPs relevant to folic acid heredity metabolize ability are respectively: mthfr gene rs1801131 site (A1298C), mthfr gene rs1801133 site (C677T), and MTRR gene rs1801394 site (A66G).

In one embodiment, the purge process of step 2 can be selected from alkaline phosphatase enzymic digestion, alkaline phosphatase and excision enzyme ExoI digest, cut glue purification, PCR purification column crosses post etc.In a specific embodiment, after using alkaline phosphatase enzymic digestion or alkaline phosphatase and excision enzyme ExoI digestion to carry out purifying, the process of high temperature enzyme inactivation is carried out.

The present invention's the 4th object is to provide the purposes of the SNP that aforementioned agents box is correlated with in detection 3 folic acid heredity metabolize abilities.

Beneficial effect

Advantage of the present invention and effect as follows:

1, responsive: the present invention combines the technology such as multiplex PCR, single-basic extension, mass spectrometric detection and is integrated, both by round pcr amplification detection template, trace sample is detected again by mass-spectrometric technique, combine the advantage of two kinds of technology, be far superior to be used alone PCR and detect polymorphism SNP, therefore its detection sensitivity is very high.

2, special: single-basic extension is also called " micrometering sequence ", use specific probe DNA molecular to be identified to have the high accuracy of sequencing technologies, the features such as specificity is good, false positive is low; Especially, be different from sequencing technologies and extend hundreds of bases, this technology only extends single base, and error probability is lower;

3, handy and safe: simple to operate, safety, level of automation are high, anti-pollution;

4. quick: speed is fast, high-throughput, can complete the detection of hundreds of samples in 5-6 hour.

5, the present invention can detect multiple known patient, obtains the detected result with different SNP site respectively, and wherein patient can be that single SNP site is undergone mutation, and also can be that multiple SNP site is undergone mutation.This represents that patient can carry one or more SNP and suddenly change, thus for selecting suitable dose to provide reference information.

6, instant invention overcomes the defect that conventional art one-time detection SNP site is very few, with low cost.

Principle and definition

The invention provides the technology such as a kind of associating multiplex PCR, single-basic extension and mass spectrometric detection, detect the detection scheme with folic acid heredity metabolize ability genes involved polymorphic site (SNP).Its principle is:

In multiplexed PCR procedures, by designing and use suitable primer thus nearly 3 the SNP site place DNA fragmentations that can increase simultaneously.

In single-basic extension step, purifying and multiple single-basic extension are carried out successively to the product of previous step multiplex PCR.Wherein, extend primer totally 3, corresponding with 3 SNP site respectively, and extend a Nucleotide at the SNP site place of correspondence, the genotype complementary pairing (if certain SNP site place is A genotype, extending T Nucleotide by the extension primer of correspondence) at this Nucleotide and SNP site place.In single-basic extension step, adopt ddNTP to replace dNTP, therefore, after extension base, extend primer and termination is extended.

In mass spectrometric detection process, single base extension product is after desalting and purifying, and point extremely contains the target sheet of matrix, and by laser excitation in vacuum environment, by tof tube to detector.Different substances is negative correlation by time of tof tube with their molecular weight, and namely molecular weight is larger, and flight velocity is slower, and the time of arrival detector is more late.

Term " testing product ", refers to, for detecting the genotypic any conventional products of SNP site, comprising: detection reagent, detection chip, detection carrier, and detection kit etc.Furthermore, this product rationally can also take the product of folic acid as auxiliary direction or reference guide patient, wherein said patient is pregnant woman, puerpera, treat pregnant woman, lactating female, children etc., but does not comprise the various tumour relevant to folic acid metabolism or cancer (as colorectal carcinoma, carcinoma of the pancreas, cancer of the stomach etc.) patient.It should be noted that, the present invention relates to and how to detect the relevant detection method of folic acid heredity metabolize ability, do not relate to the method how instructing patient how to take folic acid, use this programme only as the reference method instructing patient to take folic acid, and some non-genetic factors (food habits as patient), even random occurrence (as taken other drug once in a while), all likely affects drug effect and dosage.In addition, due to the present invention be known needs take or Supplement of folic acid patient in detect its related SNP, and according to other clinical indices of association, judge dose or carry out retrospective study to it, therefore this detection method does not belong to the diagnostic method of disease.And after learning the SNP somatotype of patient, roughly can only predict the taking dose of needs of patients adjustment folic acid, and concrete dosage needs to design a model according to this intermediate information or study further, just can obtain dosage accurately.Described in comprehensive, the method of detection SNP involved in the present invention, it is neither the diagnostic method of disease, the intermediate information obtained can not be directly used in determines dosage, namely can not be directly that therapeutic process is used, therefore it does not also belong to methods for the treatment of, should be considered as identical with common SNP detection method.

Terms " rs1801133 " etc. are all folic acid SNP site Unified numbers at ncbi database.Term " C677T " etc. is then the popular call in site, and show that MTHFR the 677th bit base is mutated into T by C, " A1298C " shows that MTHFR the 1298th bit base is mutated into C by A, and " A66G " MTRR gene the 66th gene is mutated into G. by A

Term " protection base ", refers to the extra base increased of 5' end in PCR primer.Owing to protecting the sequence of base to make the molecular weight of PCR primer (i.e. core primers) increase, can avoid reacting remaining PCR primer and enter mass spectrometric detection window, to avoid interference Detection results.In addition; the 5' end extending primer also can increase base sequence in right amount, but its effect is not as the protection base of PCR primer, makes it exceed detection window; but suitably adjustment extends the molecular weight of primer, makes extension primer and product thereof be in a rational position in detection window.Such as, when extension primer corresponding to two gene polymorphic sites and product molecular weight close to time, base is increased by extending primer to one of them, change the molecular weight of primer and product thereof, and widen gap between other molecular weight extending primer and product, produce interference to avoid regional area mass spectra peak too to concentrate and differentiate unclear, thus improving Detection results.Therefore, increase the molecular weight of the extension primer after base and product, can detection window be exceeded scarcely.The Extra bases of above-mentioned extension primer can be described as primer joint.

Term " alkaline phosphatase enzymic digestion ", its effect is remaining dNTP in the rear system of degraded PCR reaction, its principle makes the 5'-P end of dNTP convert 5'-OH end to, thus lose the ability being combined with primer and making primer extension, avoids the impact on next step single-basic extension.

Term " excision enzyme ExoI digests ", its effect be from one end of single stranded DNA according to the order of sequence catalytic hydrolysis composition DNA dNTP between 3,5-phosphodiester bonds, make single stranded DNA finally be hydrolyzed to dNTP.For PCR primer remaining after PCR reaction of degrading in the technical program.Because the PCR primer of strand can be excised by excision enzyme, can't occur in detection window, when therefore using this excision enzyme, the PCR primer used is without the need to comprising protection base.

Term " single-basic extension ", be referred to as again micrometering sequence (mini sequence), refer to add in system and extend primer and ddNTP, ddNTP with extend the 3' of primer and hold and be connected to form extension products (i.e. primer extension a base), according to base pair complementarity principle, determine concrete which kind of ddNTP of connection by SNP site genotype, this process is similar to dNTP in PCR process and, according to the based composition of complementary strand, adds to one by one in PCR primer.Due to " ddNTP " and common dNTP unlike, a hydroxyl is lacked in the 3' position of ribodesose, phosphodiester bond can not be formed with follow-up ddNTP, thus, extend primer and only connect a ddNTP at SNP site place, and as PCR, constantly toward downward-extension, therefore can not be referred to as single-basic extension.Single-basic extension and sequencing procedure closely similar, what add in order-checking system is the mixture of dNTP and ddNTP, and continuations extends after connecting dNTP by sequencing primer, after only having connection ddNTP, side stops extending, the mixture of what therefore order-checking produced is nucleotide fragments different in size; Add in single-basic extension system and only have ddNTP, extend primer and can only connect a ddNTP, and stop extending, what therefore single-basic extension produced is extend the nucleotide fragments that primer only extends a base.

Term " ddNTP " is a kind of special Nucleotide, the technical program adopts four kinds altogether, there is molecular weight difference between them, the molecular weight as ddATP, ddCTP, ddGTP, ddTTP is 271.2Da, 247.2Da, 287.2Da, 327.1Da (wherein ddTTP is the molecular weight after modifying) respectively.When extension primer extends different Nucleotide according to the genotype of SNP site, molecular weight difference will be formed.By mass spectrometric detection, distinguishable go out this species diversity.Such as, if certain SNP site C/T is polymorphic, corresponding extension primer length is 17 bases (molecular weight 5019.3Da), when this SNP site place is C genotype, extend primer by extension G Nucleotide and stop extend, form the extension products of 18 bases length, molecular weight 5306.5Da, when this SNP site place is T genotype, extend primer by extension A Nucleotide and stop extend, form the extension products of 18 bases length, molecular weight 5290.5Da, between two kinds of products, there is the molecular weight difference of 16Da.Namely to this experimental program of this SNP site, the mass spectra peak of the corresponding 5306.5Da of C genotype, the mass spectra peak of the corresponding 5290.5Da of T genotype.In actual testing process, user by software to 5019.3Da, 5306.5Da, 5290.5Da tri-place observe: if mass spectra peak appears in 5019.3Da place, be then have partly or entirely to extend primer and be not combined with ddNTP; No matter whether 5019.3Da place there is mass spectra peak, if 5306.5Da and 5290.5Da locates appearance one place mass spectra peak, then the genotype of this SNP site is homozygous, and it is corresponding with the position of mass spectra peak, as previously mentioned, the corresponding C genotype of mass spectra peak of 5306.5Da, the corresponding T genotype of mass spectra peak of 5290.5Da; If 5306.5Da and 5290.5Da two place mass spectra peak all occurs, then the genotype of this SNP site is heterozygous; If 5306.5Da and 5290.5Da two place mass spectra peak does not all occur, then the failure of an experiment.

Term " purifying ", refers to for reducing in system to be checked other materials to the treatment step of the impact of subsequent reactions.PCR primer purifying of the present invention has two kinds of modes: one is separating impurity and abandons, and two is that impurity is lost activity.Wherein, cutting glue purification, crossing purification column etc. is all by the separating impurity such as electrophoresis, purification column, and reclaims relatively pure PCR primer, and can think the first way of purification, which is generally consuming time, complicated operation, when particularly sample size is large; The effect of alkaline phosphatase is degraded (also known as " digestion ") dNTP, make it the substrate that can not continue as archaeal dna polymerase or single-basic extension enzyme and participate in PCR or single base extension, thus not interfere with subsequent reaction, the second way of purification can be thought.It should be noted that, independent excision enzyme ExoI does not play purification, when it and alkaline phosphatase is used in combination time, its effect is in advance by single stranded DNA (in PCR primer system after completion of the reaction, mainly remaining PCR primer) be degraded into dNTP, then make dNTP continue degraded by alkaline phosphatase.Because PCR primer is degraded, last mass spectroscopy detection step can not be entered, therefore, if increase the process of ExoI excision enzyme in plan purification step, so without the need to using the PCR primer with protection base.In addition, before single-basic extension step, because excision enzyme and alkaline phosphatase all pass through high temperature deactivation, the extension primer, ddNTP etc. of its non-degradable strand added in single-basic extension step, therefore avoid having an impact to subsequent experimental.

Term " detection window ", refers to the scope that can be used for mass spectrometric detection nucleic acid molecule amount, is usually directed to the design reference scope of primer.Wherein, when design extension primer, for different SNP site, according to the sequence characteristic in these region of DNA territories, place, site, and the genotype of SNP site, the different extension primer of molecular weight and extension products can be designed, different extension between primer and product is avoided to there is interference because molecular weight is close, thus at a relatively broad detection window, as 4000-9000Da, the detection to multiple SNP site can be realized.

Term " SNP " genotype, refers to the type representing single nucleotide polymorphism in human genome.Wherein, in actual inspection, both can come from contrast human genome for the genotype detected in contrast, also can control oneself and be cloned into the carrier tool of plasmid, and the latter has reproducible and preserves convenient, steady sources and be subject to the welcome of actual user.

Term " SNP mutation frequency ", refers to the probability that SNP site is undergone mutation.In theory, the present invention can detect in single individuality simultaneously and there are 3 SNP sudden changes simultaneously.But investigator finds in practice, there is certain mutation frequency in different SNP sudden change in individuality.HapMap project is the project that international organization is detected in different crowd SNP site in human genome, there is the detailed frequency information of each site in different crowd in ncbi database, with the data of HCB sample in this project (Chinese Han descendants sample), the distribution frequency of following site in Chinese population is described.Such as:

(1) rs1801133, detects 45 samples, MTHFR (C677T) gene, wherein wild-type, and heterozygous mutant and homozygous mutant three kinds of genotype proportion that distributes in Chinese population is 33%, 44% and 23%.

(2) rs1801131, MTHFR (A1298C), wherein wild-type, heterozygous mutant and homozygous mutant three kinds of genotype proportion that distributes in Chinese population is 66.8%, 29.3% and 3.9%.

(3) rs1801394, MTRR (A66G), wherein wild-type (A/A), heterozygous mutant (A/G) and homozygous mutant (G/G) three kinds of genotype proportion that distributes in Chinese population is 58%, 36% and 6%.

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi？searchType＝adhoc_search&type＝rs& rs＝rs1801133

http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi？searchType＝adhoc_search&type＝rs& rs＝rs1801394

Accompanying drawing explanation

Fig. 1 is in embodiment four, to the detected result in C1 sample mthfr gene A1298C site.

Fig. 2 is in embodiment four, to the detected result in C1 sample mthfr gene C677T site.

Fig. 3 is in embodiment four, to the detected result in C1 sample MTRR Gene A 66G site.

Fig. 4 is in embodiment four, to the detected result in C2 sample mthfr gene A1298C site.

Fig. 5 is in embodiment four, to the detected result in C2 sample mthfr gene C677T site.

Fig. 6 is in embodiment four, to the detected result in C2 sample MTRR Gene A 66G site.

Fig. 7 is in embodiment four, to the detected result in C3 sample mthfr gene A1298C site.

Fig. 8 is in embodiment four, to the detected result in C3 sample mthfr gene C677T site.

Fig. 9 is in embodiment four, to the detected result in C3 sample MTRR Gene A 66G site.

Figure 10 is the detected result of the plasmid A1-A3 3 sites being to wild-type, wherein:

Peak 1 (4824) represents rs1801394 site wild-type (A),

Peak 2 (4936.2) represents rs1801133 site wild-type (C),

Peak 3 (5284.5) represents the extension primer SEQ ID No:7 that rs1801131 site unreacted is complete,

Peak 4 (5555.7) represents rs1801131 site wild-type (A),

Figure 11 is the detected result of the plasmid B1-B3 3 sites being to saltant type, wherein:

Peak 1 (4744.1) represents rs1801394 site wild-type (G),

Peak 2 (5016.1) represents rs1801133 site wild-type (T),

Peak 3 (5284.5) represents the extension primer SEQ ID No:7 that rs1801131 site unreacted is complete,

Peak 4 (5531.6) represents rs1801131 site wild-type (C),

Figure 12 is comparative examples one, rs1801131 sequencing result.

Figure 13 is comparative examples one, rs1801133 sequencing result figure.

Figure 14 is comparative examples one, rs1801394 sequencing result figure.

Embodiment

Below in conjunction with specific embodiment, the present invention is described in further detail.

Embodiment one: design of primers and synthesis.

For the relevant SNP of folic acid respectively: mthfr gene rs1801131 site (A1298C), mthfr gene rs1801133 site (C677T) and MTRR gene rs1801394 site (A66G), design corresponding Specific PCR primers core sequence (SEQ ID No:1 to SEQ ID No:6) and specificity extends primer core sequence (SEQ ID No:7 to SEQ ID No:9).

Wherein, in order to avoid PCR primer enters mass spectrograph detection window and Interference Detection effect, the 5' end of every bar PCR primer can increase the base of certain number on the basis of core sequence (SEQ ID No:1 to SEQ ID No:6), the common tag as 10bp (ACGTTGGATG), to make the molecular weight of PCR primer increase, thus exceed mass spectrograph detection window.

Relevant primer synthesizes in Sangon Biotech (Shanghai) Co., Ltd..

Following testing process operates with reference to " folic acid heredity metabolize gene mutation detection kit (time-of-flight mass spectrometry (TOFMS)) specification sheets " (hereinafter referred to as " specification sheets ") of YiXin Industry (Beijing) Science and Technology Ltd..

Embodiment two: blood sheet DNA extraction.

Blood sheet used is the circular filter paper of diameter 2cm, gets 50ul whole blood, drops in the centre of circular filter paper, then dries for subsequent use.The concrete concrete steps of blood sheet DNA extraction are as follows:

(1) prepare scissors, use 75% ethanol postincubation in advance.Then will the circular paper of blood cake be had to cut, and be cut into very little fragment, put into 1.5ml centrifuge tube, add 20ul Proteinase K, 20ulDTT and 500ul Lysis Buffer 1, fully mixing (vortex), place 2h (period puts upside down mixing 3-4 time) in 56 DEG C.

(2) centrifuge tube is taken out, of short duration centrifugal, completely supernatant is moved on in new 1.5ml centrifuge tube, to remove the interference that filter paper is tested lower step with pipettor as far as possible.

(3) in supernatant, add 850ul Binding Buffer 2 and 150ul magnetic bead (magnetic bead will fully suspend before using), fully mixing (slight vortex), room temperature places 5min.

(4) centrifuge tube is placed in 1min on magnetic frame, magnetic bead in pipe is adsorbed, removes liquid in pipe with pipettor.

(5) in centrifuge tube, add 200ul Wash Buffer 3, put upside down mixing for several times (also can slightly vortex), magnetic bead group is broken up, is placed in magnetic frame and adsorbs magnetic bead 1min, then remove liquid in pipe.

(6) in centrifuge tube, add 200ul Wash Buffer 4, put upside down mixing for several times (also can slightly vortex), magnetic bead group is broken up, is placed in magnetic frame and adsorbs magnetic bead 1min, then remove liquid in pipe.

(7) in centrifuge tube, add 200ul Wash Buffer 5, put upside down mixing for several times (also can slightly vortex), magnetic bead group is broken up, is placed in magnetic frame and adsorbs magnetic bead 1min, then remove liquid in pipe.

(8) in centrifuge tube, add 200ul Wash Buffer 6, put upside down mixing for several times (also can slightly vortex), magnetic bead group is broken up, is placed in magnetic frame and adsorbs magnetic bead 1min, then remove liquid in pipe.

(9) centrifuge tube leaving magnetic bead uncapped, place 10min in 56 degree, fully dry.(note: before adding elutriant, magnetic bead must be fully dry)

(10) add 50ul Elution Buffer 7 (can experimentally require to determine elution volume), use pipettor piping and druming, make magnetic bead Eddy diffusion, room temperature places 5min.

(11) centrifuge tube is placed in 1min on magnetic frame, magnetic bead is adsorbed, be transferred to by DNA in new 1.5ml centrifuge tube ,-20 DEG C save backup.

Embodiment three: Bioexperiment.

Using ABI 9700 type PCR instrument, tests in the gene polymorphic site of by specification to 3 and folic acid heredity metabolize gene-correlation.

In test kit for the component of PCR, PCR primer purifying and single-basic extension as table 5:

Table 5

Sequence number	Ingredient names	Main component	Specification
				1	PCR mixture	DNTPs, MgCl2, PCR primer	360ul/ pipe x 1 manages
2	PCR enzyme	Taq enzyme	24ul/ pipe x 1 manages
				3	SAP enzyme mixture	SAP enzyme	24ul/ pipe x 1 manages
4	Extend primer mixed solution	Extend primer	24ul/ pipe x 1 manages
				5	Extend enzyme mixture	IPLEX enzyme, ddNTPs	24ul/ pipe x 1 manages
6	Positive quality control product	Human gene group DNA (30ng/ul)	40ul/ pipe x1 manages

By specification, concrete operation method is as follows:

1. pcr amplification

1.1 in PCR dosing district, prepares 200ul PCR reaction tubes, and mark sample number according to measuring samples number (containing positive quality control product, negative control, blank) on pipe;

1.2 take out PCR mixture, PCR enzyme from test kit, and make it naturally thaw, vortex oscillation makes it fully mix, at the bottom of brief centrifugation to pipe;

1.3 according to number of samples, and the ratio of according to the form below takes out PCR primer mixed solution and PCR reaction solution, is placed in a centrifuge tube and mixes, add 16ul mixture carry out packing by every PCR reaction tubes.Due in point process of assembling, suction pipette head the factor such as to remain and may cause and be not enough to point take on required number, the dose volume of the suitable amplification mixture of suggestion.Such as, when having 10 parts of testing samples, can by 10.5-11 increment product preparating mixture.

Ingredient names	Single reaction volume
		PCR mixture	15ul
PCR enzyme	1ul

Add up to

16ul

1.4 add 4ul testing sample in pcr amplification district in every pipe mixture, make every part of PCR reaction system cumulative volume be 20ul.Wherein, negative control is purified water, and blank is not for add template.

PCR reaction tubes is placed in PCR amplification instrument by 1.5, and the program of according to the form below carries out pcr amplification reaction.

2. SAP enzymic digestion

After PCR, get 5ul PCR primer successively to new pipe, often pipe adds SAP enzyme mixture 1ul, then PCR reaction tubes is placed in PCR amplification instrument, performs lower list procedure.

Temperature	Time (dividing)	Cycle number
			37	45	1
85	15	1

3. extend

3.1 in PCR dosing district, and according to number of samples, the ratio of according to the form below is taken out and extended primer mixed solution and extend enzyme mixture, is placed in a centrifuge tube and mixes.Due in point process of assembling, suction pipette head the factor such as to remain and may cause and be not enough to point take on required number, the dose volume of the suitable amplification mixture of suggestion.Such as, when having 10 parts of digestion products, can by 10.5-11 increment product preparating mixture.

Ingredient names	Single reaction volume
		Extend primer mixed solution	1ul
Extend enzyme mixture	1ul
		Add up to	2ul

3.2 in pcr amplification district, adds 2ul mixture carry out packing by every pipe digestion products.

PCR reaction tubes is placed in PCR amplification instrument by 3.3, and the program of according to the form below carries out extension.

4. purifying

In every pipe extension products, add 16ul purified water, 6mg resin in pcr amplification district, put upside down mixing 30 minutes.

5. point sample

Use micropipet, draw 1ul purified product, point sample is to target sheet.

Embodiment four: upper machine testing and result interpretation.

The Clin-TOF type time-of-flight mass spectrometer using YiXin Industry (Beijing) Science and Technology Ltd. to produce detects the target sheet after point sample and result judges.

In addition, the wild type control A1-A3 in above site, saltant type contrast B1-B3 are set respectively.Wherein, wild type control A1-A3, saltant type contrast B1-B3 are respectively from artificial plasmid that is commercially available or Laboratories Accession.Wild type control plasmid A1-A3 used in the present invention and saltant type control plasmid B1-B3, for on the basis of commercialization plasmid pMD18-T Vector (Takara company), according to the ordinary method that " molecular cloning " is recorded, after carrying out PCR with primer and normal people DNA, PCR primer is inserted pMD18-T Vector, namely build wild plasmid A1-A3, then distinguish rite-directed mutagenesis, namely build 3 mutant plasmids B1-B3.Described plasmid A1-A3 and B1-B3 can be stored in-20 DEG C of glycerine for a long time, and the used time activates and extracts plasmid DNA.

As shown in Table 2 above, article 3, extend primer and their extension products of producing according to respective genotype on 3 gene polymorphic sites have different molecular weight, the mass spectra peak that these molecular weight are corresponding respective, if there is mass spectra peak at certain molecular weight place, be then judged as there is the material (extend primer or product) corresponding with this molecular weight:

Judging criterion:

(1) if wild-type and mass spectra peak corresponding to saltant type all do not occur, no matter extend the mass spectra peak that primer pair answers and whether exist, be all judged as the failure of an experiment;

(2) if wild-type or mass spectra peak corresponding to saltant type only occur one, then corresponding genotypic homozygous of occurred mass spectra peak is judged as;

(3) if wild-type or mass spectra peak corresponding to saltant type all occur, then heterozygous is judged as.

As shown in figs 1-9, extend the mass spectral results (Fig. 1-9) of the molecular weight inspection sample C1-C3 of primer and extension products with site each shown in aforementioned table 2, determine the genotype of each SNP site, result is as shown in table 3 for mass spectral results:

	C1	C2	C3
				rs1801131	C，T	C，T	C，T
rs1801133	A	A	A,C
				rs1801394	A	A	A

Table 3

Namely in 3 routine patients, rs1801131 site CT heterozygous 3 example is detected altogether, rs1801133 site AC heterozygous 1 example, pure and mild type 2 example of AA, pure and mild type 3 example of rs1801394 site AA.

Comparative examples one

1., according to embodiment 1, use following primer as shown in table 4, checked order in each site:

Site information according to providing finds out SNP site, in NCBI, find gene order, and software Primer Premier 5.0 designs primer, carries out pcr amplification (seeing the following form).

Primer	Sequence 5 '-3 '	Length	GC
				1131-NF	TGCCCTCTGTCAGGAGTGTG	365	59.2
1131-NR	CTTCTCCCTTTGCCATGTCC
				1133-NF	CTGTGCTGTGCTGTTGGAAG	337	56.7
1133-NR	CTCACCTGGATGGGAAAGAT
				1394-NF	TTATGTGTGGGTATTGTTGC	370	37.8
1394-NR	AACAAAGACTATGTGGTGGT

2. DNA Concentration Testing

To the DNA Concentration Testing that client provides, report sees the following form.

Sample ID	Nucleic Acid Conc.	Unit	A260	A280	260/280	260/230
							1	6.5	ng/μl	0.131	0.05	2.6	0.68
2	7.3	ng/μl	0.146	0.05	2.9	0.65
							3	23.4	ng/μl	0.469	0.23	2.04	1.57
4	39.4	ng/μl	0.787	0.322	2.45	0.37
							5	39	ng/μl	0.779	0.269	2.9	0.62
6	46.7	ng/μl	0.934	0.399	2.34	0.08

3. pcr amplification

The above-mentioned primer determined is used to carry out pcr amplification, reaction system:

Reaction system	Application of sample amount
		10×PCR Buffer	2.0μL
25mM dNTP	0.2μL
		Primer(10μmol/L)	Each 0.5 μ L
Template DNA	1.0μL
		Taq DNA polymerase	0.2μL
ddH2O	Supply 20 μ L

Use ABI9700PCR instrument to carry out PCR reaction, response procedures is:

95 DEG C of warm start 5min, 94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C extend 40s, altogether 35cycles, and last 72 DEG C extend 10min.

4. PCR primer sequence

Reclaim pcr amplification object band with test kit (OMEGA D2500-01), check order quantitatively.Sequencing reaction system is: 2 μ L Mix (Bigdye3.1,5X sequencing buffer, H ₂o), the PCR primer after 2 μ L purifying, 1 μ L primer (5 μm of ol/L); ABI9700PCR amplification instrument is used to carry out sequencing reaction.

Cycling condition is: 96 DEG C of 2min → (95 DEG C of 10s → 50 DEG C 5s → 60 DEG C 4min) × 30cycles → termination reactions;

Check order after carrying out purifying with test kit (OMEGA 1320-01) after sequencing reaction.

5. interpretation of result

The PCR primer obtaining PCR primer amplification is cut after glue reclaims, upper 3730 order-checkings, and the sequence obtained, first carries out BLAST, determines institute's extension increasing sequence for the purpose of certain after sequence, compares with SeqMan, examination SNP site (as shown in the table):

Sample ID	1131	1133	1394
				1	A	C/T heterozygosis	A
2	A	C/T heterozygosis	A
				3	A/C heterozygosis	C/T heterozygosis	A

Claims (10)

1., for detecting the Primer composition of the SNP that folic acid heredity metabolize ability is correlated with, its sequence is:

。

2. the Primer composition of claim 1, wherein PCR primer sequence is core sequence, and it can comprise protection 5-15 base sequence at 5' end, is preferably the tag:ACGTTGGATG of 10bp.

3. the Primer composition of claim 1, wherein extends primer 5' and holds the base sequence that can increase as joint, be wherein preferably 1-15 base, more preferably 1-3 base.

4. the testing product for detecting folic acid heredity metabolize ability genes involved polymorphic site prepared by the Primer composition of claims 1 to 3.

5. the testing product of claim 4, wherein product is detection kit, comprising:

(1) for the reaction reagent of PCR, comprising: Specific PCR primers, resistant to elevated temperatures archaeal dna polymerase, dNTPs, PCR reaction buffer;

(2) for the reagent of PCR primer purifying;

(3) for the reagent of single base extension, comprising: extend primer, resistant to elevated temperatures single-basic extension enzyme, ddNTPs, extension damping fluid.

6. the testing product of claim 5, wherein test kit also can comprise: negative quality control product, positive quality control product, purifying resin, point sample and mass spectrometric detection target sheet, excision enzyme, the reagent such as dried blood spot DNA extraction reagent.

7. the testing product of claim 5, the reagent wherein for PCR primer purifying is selected from alkaline phosphatase, or alkaline phosphatase and excision enzyme ExoI, or running gel reclaims reagent, or PCR primer purification column.

8. the product of claim 7, wherein when comprising the purified reagent of alkaline phosphatase and excision enzyme ExoI, the PCR primer used is without the need to comprising protection base.

9. use the Primer composition of claim 1-3, or the product of claim 4-8 detects the method for folic acid heredity metabolize ability genes involved polymorphic site, comprising:

(1) multiplex PCR: use specific PCR primer, in a reaction system, increasing in the gene polymorphic site place region of DNA territory relevant to folic acid heredity metabolize ability to 3 places simultaneously, obtains the PCR primer containing 3 region of DNA territories, place, gene polymorphic site, place;

(2) PCR primer purifying: carry out purifying to the PCR primer that step (1) obtains, to reduce the interference to subsequent reactions;

(3) single-basic extension: use 3 specific extension primers, in a reaction system, after the purifying obtain step (2), PCR primer carries out multiple single-basic extension, extend primer and extend a Nucleotide at the SNP site place of correspondence, the genotype complementary pairing at this Nucleotide and SNP site place;

(4) extension products purifying: carry out purifying to the extension products that step (3) obtains, to obtain high-purity extension products, avoids the impurity such as salt ion on the impact of subsequent detection;

(5) mass spectrograph detects: purified product point step (4) obtained, on the target sheet containing matrix, is put into mass spectrograph and carried out detecting;

Wherein, described 3 SNPs relevant to folic acid heredity metabolize ability are respectively: mthfr gene rs1801133 site (C677T), mthfr gene rs1801131 site (A1298C), and MTRR gene rs1801394 site (A66G).

10. the purposes of the SNP that the test kit described in claim 4-9 is correlated with in detection 3 folic acid heredity metabolize abilities.