CN104946671B - A kind of Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 and application thereof - Google Patents
A kind of Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 and application thereof Download PDFInfo
- Publication number
- CN104946671B CN104946671B CN201510351880.1A CN201510351880A CN104946671B CN 104946671 B CN104946671 B CN 104946671B CN 201510351880 A CN201510351880 A CN 201510351880A CN 104946671 B CN104946671 B CN 104946671B
- Authority
- CN
- China
- Prior art keywords
- cyp81a6
- seq
- oryza sativa
- gene mutation
- mutation body
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention provides a kind of Oryza sativa L. CYP81A6 gene mutation body CYP81A6 m2 and application thereof, belongs to gene engineering technology field.The present invention is by rice variety 93 11 23 base pair deletion in co-60 radiation mutation causes second exon of Oryza sativa L. CYP81A6 gene, by this CYP81A6 gene mutation body named CYP81A6 m2, its nucleotide sequence is as shown in SEQ ID No.1, it is further characterized by CYP81A6 m2 extremely sensitive to Bentazon herbicide, can be used for preparing the transgenic paddy rice sensitive to bentazone, act on great in the genetic improvement breeding of Rice Germplasm Resources.Present invention also offers the molecular marker identification method of this mutant and the application in the breeding production of hybrid seeds thereof.
Description
Technical field
The invention belongs to genetic engineering field, specifically, relate to a kind of Oryza sativa L. CYP81A6
Gene mutation body CYP81A6-m2 and application thereof.
Background technology
Oryza sativa L. is the core cereal crops of China, and hybrid rice plays improving China's grain yield
Important function.Hybrid rice has obvious hybrid vigor phenomenon, current China hybrid rice
Accumulative cultivated area is more than 4,500,000,000 mu, and hybrid rice cultivated area has accounted for whole nation rice seed
Plant about the 55% of area.Hybrid rice can be divided into Three-line Hybrid rice and two-line hybrid rice.
China's breeding of hybrid rice is inefficient, is mainly manifested in labor intensity big, seed production and matter
The aspects such as amount is unstable.Therefore realizing breeding of hybrid rice entire mechanization is to promote me further
The only way that state hybrid rice produces.At present, following method has been had attempted to: 1) machinery
Adopt powder-storage-pollination technique.Machinery is utilized to gather paternal pollen, direct or the most right through storage
Maternal pollination.2) male parent is female sterile, it is achieved Parent mixed seeding is mixed receives mechanization.3) plant
Sub-color mark method.Make Parent seed color different by selection-breeding, after mixture population results,
By color selector, maternal cenospecies is separated with the selfed seed of male parent.4) herbicide is utilized
Remove accessory seed.This includes again two approach, and one is that anti-herbicide gene is passed through transgenic
Import maternal sterile line so that it is herbicide is produced resistance.By female parent with male parent mixed seeding to produce
Hybrid seed, the herbicide that can resist with female parent after pollination carries out field and sprays process, male parent is selected
Selecting property is killed, and the seed of results is i.e. filial generation.This method by transgenic constraints and regulations,
Therefore not yet realize commercialization.Another approach is that herbicide sensitive mutant gene is imported male parent, makes
Paternal rice is to certain herbicide sensitive.By female parent with male parent mixed seeding to produce hybrid seed, award
Carry out field process with the herbicide that male parent is sensitive after powder, paternal rice selectivity is killed.This
One method, not by transgenic constraints and regulations, has preferable application prospect.
Wild type CYP81A6 gene (GenBank:DQ 341412.1) total length 3914bp,
Its structure includes the promoter sequence of 1321bp, the 5 ' untranslated regions (5 '-UTR) of 53bp,
The coding region of 2268bp and the 3 '-UTR of 272bp.It is (long that coding region comprises two exons
Degree is respectively 924bp and 618bp) and an intron (a length of 726bp), encode 513
Individual aminoacid, belongs to cytochrome P450 gene family.Although the dozens of having now been found that is thin
Sequence difference between born of the same parents' cytochrome p 450 crystal structure display different genera is relatively big, but its three-dimensional knot
Structure high conservative (structure of Wang Bin, Li Deyuan (2009) Cytochrome P450 and catalytic mechanism.
Organic chemistry 29:658-662).The primary structure functional domain of Cytochrome P450 includes: the end
Thing binding structural domain and heme (HEM) combine and catalyst structure domain.Wherein, by
It is to combine haemachrome with mercaptides to be catalyzed Oxygen atom transfer for active center in Cytochrome P450
Oxidoreductase, therefore heme combine and catalyst structure domain exercise its active function
Time, the iron ion side of HEM and the sulfur complexation of the cysteine of absolute conservation, form mercaptan
Salt ion key, becomes a part of ferrum；Opposite side can be formed with the oxygen molecule complexation in water
Ferrous P450-dioxy complex (P-Fe (II)-O2).P-Fe (II)-O2 is through second single electron
Reduction and protonation, form Fe (III)-hydroperoxidation complex (P-Fe (III)-O-OH), enter
One step self-catalysis forms high price ferrum oxygen intermediate (P Fe (IV)=O), this oxygen iron porphyrin cation
Free radical, is i.e. provided that single electron, again containing positive charge, it is provided that active oxygen atom, at aqueous solution
In be capable of shift oxygen atom, be inserted in inert c h bond, it is achieved under temperate condition
The hydroxylating of hydrocarbon, this is single oxygenation mode；Another mode is high price ferrum oxygen intermediate
P Fe (IV)=O directly to substrate oxidation dehydrogenation rather than on c h bond insert oxygen, the party
Formula is oxidative dehydrogenation mode.The most that mode all relies on heme (HEM) and combines
And substrate is aoxidized by catalyst structure domain, black box in this domain nucleus such as Fig. 4
Shown (FGMGRRRCPG) (Zhang Jiwen, 2010, Oryza sativa L. bentazone sensitizing mutation is studied
Progress. rice in China science 24:551-558).
Bentazone is diazosulfide class herbicide, can kill most wealthy class leaf weeds and Cyperaceae
Weeds, and fool proof to the grass family including Oryza sativa L. and leguminous plant.Its mechanism of action
It it is the Hill reaction of suppression photosynthesis of plant.Its selectivity is because variety classes plant and decomposes
The ability of bentazone there are differences.Bentazone tachymetabolism can be hydroxylating by normal water rice varieties
Non-toxic products.Mutation via radiation, at rice varieties agricultural No. 8 (N8) and W6154S
On obtain the mutant that two bentazones are sensitive, No. 8 m (N8m) of agricultural and 8077S.
The lethasl concentration that lethasl concentration is 5mg/L, 8077S of No. 8 m of agricultural is 313mg/L,
The former is sensitive 60 times of ratio the latter, and normal water rice varieties 2500mg/L bentazone processes not
Performance substantially injury.Genetic research shows No. 8 m mutational sites of agricultural and 8077S sudden change position
Point is allele, and its sensitive lethality phenotype is by same bsl Gene Handling.The bsl of wild type
Being a P450 gene (CYP81A6), a length of 2268bp in its coding region, containing two
Exon and an intron, encode an enzyme being made up of 513 aminoacid.It is in agricultural
In No. 8 m, the 507th site after translation initiation password ATG, lack a C, this
One sudden change occurs on First Exon, causes its albumen Most amino-acids encoded to lack,
Thus completely lose biochemical function.In 8077S, sudden change occurs at translation initiation password ATG
Rear 2058th site, has lacked a G, and this sudden change occurs close at second exon
3 ' ends.Cause its pheron encoded to lack 49 aminoacid, and make its 441st～450
The key structure territory sudden change of position, therefore make it substantially lose biochemical function (Zhang Jiwen (2010) water
Rice bentazone sensitizing mutation progress. rice in China science 24:551-558).But above-mentioned two
Individual mutant all only has the disappearance of 1bp, it is impossible to the sepharose electrophoresis conventional with laboratory detects,
It is difficult to use in molecular mark, needs the technical method of special detection single base mutation.
It addition, in two mutants, the 8077S in long-grained nonglutinous rice source is the highest to bentazone sensitivity.Therefore,
In the actual application of the paddy rice cross breeding production of hybrid seeds, need new extremely sensitive to bentazone, it is easy to enter
Row Molecular Detection and the long-grained nonglutinous rice mutant carrying out molecular mark.
Summary of the invention
It is an object of the present invention to provide Oryza sativa L. CYP81A6 gene mutation extremely sensitive to bentazone
Body CYP81A6-m2 and application thereof.
Rice variety 93-11 seed (M0 generation) is first carried out at co-60 radiation mutation by the present invention
Reason, the seed that plantation processes obtains M1 for plant；M1 produces seed (for M2 for plant selfing
Generation), plantation M2, for plant, carries out bentazone process to M2 for plant, the sensitive plant of screening；
Then sensitive plant is carried out gene sequencing and DNA sequence analysis, test on a molecular scale
Card.Finally obtain isozygoty individual plant extremely sensitive to bentazone, and for cross-breeding and biological skill
Art research.
The Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 that the present invention provides, it is Oryza sativa L.
23 bases, the 23 of described disappearance are lacked at second exons 1 of CYP81A6 gene 747
Individual base is CCGAGATCGACGCATCCGTCGGC.
Further, Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2, its nucleotides sequence
Row are as shown in SEQ ID No.1.
The invention provides containing Oryza sativa L. CYP81A6 gene mutation body of the present invention
The expression vector of CYP81A6-m2.
The invention provides the host cell containing above-mentioned expression vector.
The invention provides Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 and turn base in preparation
Because of the application in plant.
The invention provides Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 prepare right
Application in the transgenic plant that bentazone is sensitive.
Preferably, described plant is Oryza sativa L., Semen Maydis, Semen Tritici aestivi, Cotton Gossypii.
The invention provides Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 crops
Application in improvement breeding, the production of hybrid seeds.
Preferably, described crops are Oryza sativa L., Semen Maydis, Semen Tritici aestivi, Cotton Gossypii.
The invention provides the side of cloning rice CYP81A6 gene mutation body CYP81A6-m2
Method, with oryza sativa genomic dna as template, respectively with following 4 pairs of primers to carrying out PCR, by 4
Individual amplified production splices successively and obtains Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2, institute
The nucleotide sequence stating 4 pairs of primers pair is respectively as follows: SEQ ID NO.2-3 and SEQ ID NO.4-5
With SEQ ID NO.6-7 and SEQ ID NO.8-9.
With the Oryza sativa L. to 1314bp can be amplified of the primer shown in SEQ ID NO.2-3
CYP81A6 gene amplification fragment, can amplify with the primer shown in SEQ ID NO.4-5
The Oryza sativa L. CYP81A6 gene amplification fragment of 1216bp, with drawing shown in SEQ ID NO.6-7
Thing can amplify 1377bp wild rice CYP81A6 gene or the Oryza sativa L. of 1354bp
CYP81A6-m2 gene amplification fragment, can expand with the primer shown in SEQ ID NO.8-9
Go out the Oryza sativa L. CYP81A6 gene amplification fragment of 796bp.
Present invention also offers detection Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2's
Molecular marker, this molecular marker is to be obtained by following primer pair amplifies, the nucleoside of described primer pair
Acid sequence is:
SEQ ID NO.10-11 or SEQ ID NO.12-13 or
SEQ ID NO.14-15 or SEQ ID NO.16-17.
The invention provides above-mentioned molecular marker at detection CYP81A6 gene mutation body
Application in CYP81A6-m2.
The invention provides above-mentioned molecular marker and prepare the transgenic plant sensitive to bentazone
In application.
The invention provides the application in Rice Germplasm Resources is improved of the above-mentioned molecular marker.
A kind of method of the molecular marker of Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2,
By the primer pair amplifies of one of the following plant genome DNA to be checked, and detect amplified production:
The nucleotides sequence of described primer pair is classified as: SEQ ID NO.10-11 or SEQ ID
NO.12-13 or SEQ ID NO.14-15 or SEQ ID NO.16-17；
If with the expansion to 270bp can be amplified of the primer shown in SEQ ID NO.10-11
Increase fragment, or with the primer shown in SEQ ID NO.12-13 to amplifying 83bp's
Amplified fragments, or with the primer shown in SEQ ID NO.14-15 to amplifying 109bp
Amplified fragments, or with the primer shown in SEQ ID NO.16-17 to amplifying 193
The amplified fragments of bp, then indicate that this plant to be checked exists Oryza sativa L. CYP81A6 gene mutation body
CYP81A6-m2。
It is an advantage of the current invention that: it is key that (1) this mutant CYP81A6-m2 derives from long-grained nonglutinous rice
Parental breed 93-11.This kind has completed genome sequencing, to Rice molecular breeding ten
Divide favourable.(2) radioinduction occurs a cytochrome P450 gene (CYP81A6)
Second exon in so that it is completely lose function, find mutant CYP81A6-m2's
Existing makes Oryza sativa L. extremely sensitive to Bentazon herbicide.(3) cause and wild type because of radioinduction
Having compared 23bp disappearance, the sepharose electrophoresis using laboratory conventional just can carry out Molecular Detection,
I.e. it is capable of differentiating, it is not necessary to particularly detection technique and method.(4) Oryza sativa L. of the present invention
CYP81A6 gene mutation body CYP81A6-m2 is screening effect in Rice Germplasm Resources is improved
Substantially, economic worth is huge.
Accompanying drawing explanation
Fig. 1 is the 3522 doubtful mutants of strain, and 3522-M3 seedling spraying 1g/L bentazone screens
Doubtful mutant, white arrow instruction wild type；Black arrow instruction mutant.
The A figure of Fig. 2 is CYP81A6 gene element section PCR amplification.-: negative control；
1-2:2 kind rice varieties i.e. 93-11,3522m, F1/R1, F2/R2, F3/R3, F4/R4 in figure
Represent SEQ ID NO.2-3, SEQ ID NO.4-5, SEQ ID NO.6-7 and SEQ ID respectively
NO.8-9；B figure is mutant 3522m and wild type (93-11) sequence alignment result,.
Fig. 3 is the gene structure of 3522m Oryza sativa L. and agricultural 8m (n8m) and 8077S mutational site
Schematic diagram, Exon: exon；Intron: intron；UTR: untranslated region；△: lack
Lose.
Fig. 4 is wild type and the amino acid alignment of each mutant cytochrome P450 coding
Figure.
The A figure of Fig. 5 is that 2% sepharose electrophoresis screening is applicable to molecular marker assisted selection breeding
Primer result figure；B figure is that 6% polyacrylamide gel electrophoresis (PAGE) screening is applicable to molecule mark
The primer result figure of note assisted selection.BM1-4 is that the title of design different molecular labelling is divided
Not corresponding SEQ ID NO.10-11, SEQ ID NO.12-13, SEQ ID NO.14-15, SEQ
ID NO.16-17；-, 1,2: be respectively H2O, WT (wild type), the present invention suddenlys change
The 3522m Oryza sativa L. arrived.
Fig. 6 is molecular marker BM3 at 3522 strains M2 generation checkings and M3 for screening mutant
(polyacrylamide gel electrophoresis) figure, wherein A figure: the BM4 of 3522m mutant is in M3 generation sudden change
Body screens；B schemes: molecular marker screening obtains mutant and sprays checking through bentazone；Wherein W,
WT: wild type；M: mutant；H: heterozygosis strain；1-10: wild-type homozygous individual plant；0d:
1g/L bentazone solution sprays the same day；7d:1g/L bentazone solution sprays latter 7 days.
Detailed description of the invention
Following example are used for illustrating the present invention, but are not limited to the scope of the present invention.Not
In the case of deviating from present invention spirit and essence, the inventive method, step or condition are made
Amendment or replacement, belong to the scope of the present invention.
If not specializing, technological means used in embodiment is ripe by those skilled in the art
The conventional means known；If not specializing, in embodiment, agents useful for same is commercially available.
The primer sequence table of table 1 embodiment of the present invention
The screening of the rice mutant that embodiment 1 is sensitive to bentazone
1, cobalt60In radioinduction mutant library and M1, M2 generation, plant and character observation
Summer in 2013 in Changsha through cobalt60Radiate 10 kilograms of 93-11 seeds, plant in Hainan summer
Field, Lingao, this is M1 generation, and point individual plant results M1, for seed, gathers in the crops about 4557 parts altogether
Seed.Choose M1 for 3617 strains of seed, each strain 50 individual plants of plantation, 2014
Spring in year plants in field, Lingao, Hainan, and this is M2 generation.After transplanting, in tillering stage, booting
Phase, heading stage, florescence, pustulation period etc. pass through and examine field character, examination plant type,
All types of mutant individual plant sowings are preserved by all kinds mutants such as fringe type, fertility, yield
As special mutant；Each strain receives 6 individual plants, as mutant library resource conservation.Point
The each individual plant of strain is collected 1 tassel and is screened for bentazone sensitive mutant.
2, bentazone sensitive mutant screening
M2 mixes sowing, the side's of being seeded in basin in batches with strain, grows about 2 weeks, by 100
mL/m2Spray the bentazone solution (precision bio tech ltd, Changzhou) of 1g/L to mixed
Gregarious body blade surface, starts after spraying 2 days to observe, finds the individual plant that blade is sallow.Screening
In 1326 strains, find that 3 strains occur that more than 2 strains are withered and yellow quick by blade tip altogether
Sense individual plant, confirms have many strains to show blade in one of them strain 3522 after multiple sieve withered and yellow existing
As, as it is shown in figure 1, doubtful bentazone sensitivity strain.By named for doubtful individual plant 3522m.
The determination of embodiment 2 Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2
After confirming bentazone sensitive mutant, taking 3522m blade, extract DNA, design covers
Primer (SEQ ID NO.2-3, SEQ ID NO.4-5, the SEQ ID NO.6-7 of full length gene
And SEQ ID NO.8-9), carry out PCR amplification and product is checked order.DNA extraction is by such as
Lower step is carried out: the blade of the Oryza sativa L. 3522m taking about 2cm length is placed in 2ml centrifuge tube；
In mortar, add 800 μ l 1.5 × CTAB, grind blade to being homogenized and refunding in centrifuge tube；
The reverse mixing of 65 DEG C of water-bath 20-30min, every 5min 1 time；Add isopyknic chloroform/isoamyl
Alcohol (24 1), mixing of turning upside down, continue 10min；10000rpm is centrifuged, 10min；
Draw 400 μ l supernatant to new centrifuge tube, add 2 times of volumes, 95% ethanol through ice pre-cooling,
-20 DEG C of ice put 20min；12000rpm is centrifuged, 15min；Abandon supernatant, add 500 μ l 75%
Ethanol, reverse rinsing, 12000rpm is centrifuged 5min；Abandon supernatant, be placed in super-clean bench dry up or
Naturally dry, add 100 μ l ddH2O dissolving DNA, electrophoresis detection DNA mass.
Obtaining after DNA, design primer carries out PCR reaction, primer be (SEQ ID NO.2-3,
SEQ ID NO.4-5, SEQ ID NO.6-7 and SEQ ID NO.8-9),.PCR response procedures
As follows with system:
Program: 94 DEG C of denaturations 10min, 94 DEG C of degeneration 30s, 57 DEG C of annealing 30s, 72 DEG C are prolonged
Stretch 90s, carry out 42 circulations, re-extend 72 DEG C and extend 10min, 16 DEG C of end.
Wherein P1/P2 represents primer pair, i.e. (SEQ ID NO.2-3 or SEQ ID NO.4-5
Or SEQ ID NO.6-7 or SEQ ID NO.8-9).
After PCR has reacted, carry out agarose gel electrophoresis, result as shown in the A of Fig. 2,
Choose PCR amplified band clear, meet the order-checking of size expected result sample presentation.Sequencing result
3522m is compared with wild type (93-11) in display, lacks 1747 (ATG is initial 1)
Lose the base of 23bp, as shown in the B of Fig. 2.Show that 3522m there occurs base in this position
Because of sudden change, by the named CYP81A6-m2 of this mutant of Oryza sativa L. CYP81A6 gene.Its
Nucleotide sequence as shown in SEQ ID NO.1, total length 3891bp, promoter 5 '-UTR and
3 '-UTR are identical with wild type, but its coding region total length 2245bp, compared with wild type,
CYP81A6-m2 has one section of 23bp at second exons 1 747
(CCGAGATCGACGCATCCGTCGGC) disappearance, such as B and Fig. 3 of Fig. 2
Shown in, cause encoder block frameshift mutation thereafter, only 404 aminoacid of coding, wherein only have
340 aminoacid and wild type just as, as shown in Figure 4.This sudden change causes its cell encoded
The Core domain haemachrome of cytochrome p 450 PROTEIN C end combines and catalyst structure domain lacks
Lose, as shown in black box in Fig. 4, in turn result in this albumen loss of function.The present invention is obtained
Saltant type CYP81A6 gene C YP81A6-m2 obtained is prominent with the CYP81A6 of existing report
Variant all differs, and is a new allelic mutation site, as shown in Figure 3 and Figure 4.
Embodiment 3 detects the screening of CYP81A6-m2 molecular marker
Behind the DNA mutation site of the clear and definite 3522m that checks order, the most aobvious around the design of this site
Property primer mark, for molecular marker assisted selection breeding.PCR amplification condition with embodiment 2,
Amplified production is respectively by sepharose electrophoresis and polyacrylamide (PAGE) electrophoresis detection.Result
As shown in Figure 5 and Figure 6.2% sepharose electrophoresis result shows (the A figure of Fig. 5), primer pair
BM1, BM3, BM4 amplification purpose fragment is single, band clear, can be as molecular marker
Wild type CYP81A6 and saltant type is divided for follow-up molecular marker assisted selection breeding zone
CYP81A6-m2；6%PAGE electrophoresis result shows (the B figure of Fig. 5), primer pair
BM1-BM4 all can distinguish wild type as molecular marker for follow-up assisted selection
CYP81A6 and saltant type CYP81A6-m2.
Molecular marker BM4 result in PAGE electrophoresis shows simultaneously, uses this labelling permissible
Substantially distinguishing wild type and mutant, as shown in Figure 6A, this primer amplifies in wild type
216bp characteristic strip, amplifies 193bp characteristic strip in mutant.On this basis, profit
Screen 3522m M3 generation mixing strain 184 strain further with BM4 labelling, screen 1 strain
Mutants homozygous (193bp single slice, such as square frame M in the A figure of Fig. 6) and 4 strain heterozygosis
Mutant (the double band of 216bp and 193bp, such as square frame H in the A figure of Fig. 6), this common
Dominant molecular marker for selection-breeding stealth karyogene more effectively, is possible to prevent the morning in selection-breeding
Phase leakage choosing.Further with 1g/L bentazone solution blade-section spray screening obtain 3 strains pure
Closing mutant, all there is the withered and yellow phenomenon of blade in 3 strain Mutants homozygous, as shown in the B of Fig. 6 schemes,
Show that this labelling BM4 can be used for detecting CYP81A6-m2 gene, and then for 3522m
The molecule assisted selection of the bentazone sensitive paddy material of selection-breeding based on mutant.
Embodiment 4 hybridizes transformation: utilize molecular marker by mutant CYP81A6-m2 gene transformation
It is in restorer to three
Excellent insensitive with bentazone of bentazone sensitive mutant 3522m obtained with embodiment 1
Good Indica Rice Restorer Lines R808 carries out hybridizing, backcrossing and selfing, and uses molecule mark in the process
Remember that such as BM4 carries out assisted Selection to gained offspring, final acquisition banding pattern and 3522m banding pattern one
The individual plant caused is for producing and breeding practice.It is as follows that it is embodied as step:
1, F1 is obtained for maternal with 3522m hybridization with R808.
2, with F1 for the maternal acquisition BC1F1 that backcrosses with R808.
3, molecular marker such as BM4 is utilized to select CYP81A6 site (i.e. to have for heterozygous state
Have the double band of 216bp and 193bp) BC1F1.Concrete operations are as follows:
(1) plantation BC1F1, as described in embodiment 2, method extracts seedling leaf genomic DNA.
(2) with molecular marker such as BM4 described in embodiment 3 to the present embodiment step 3 (1)
The genomic DNA of middle acquisition carries out PCR amplification, and PCR amplification condition is with embodiment 2.Choosing
Selecting in CYP81A6 site is the individuality of heterozygous state, i.e. selects PCR primer to show simultaneously
The individuality of 216bp and 193bp fragment.
4, the BC1F1 with CYP81A6 site as heterozygous state backcrosses with R808 for female parent
Obtain BC2F1.
5, molecular marker such as BM4 is utilized to select CYP81A6 site to be heterozygous state
BC2F1.Concrete operations are with the present embodiment step 3.
6, the BC2F1 with CYP81A6 site as heterozygous state backcrosses with R808 for female parent
Obtain BC3F1.
7, molecular marker such as BM4 is utilized to select CYP81A6 site to be heterozygous state
BC3F1.Concrete operations are with the present embodiment step 3.
8, the BC3F1 selfing that CYP81A6 site is heterozygous state is obtained BC3F2.
9, molecular marker such as BM4 is utilized to select CYP81A6 site consistent with 3522m banding pattern
BC3F2.Concrete operations are as follows:
(1) plantation BC3F2, extracts seedling leaf genomic DNA.
(2) the molecular marker BM3 genome to obtaining in the present embodiment step 9 (1) is utilized
DNA carries out PCR amplification, and amplification condition is with embodiment 2.Select in CYP81A6 site
The individuality consistent with 3522m banding pattern, i.e. selects PCR primer only to show the individual of 193bp fragment
Body, namely with the R808 restorer of saltant type CYP81A6, is bentazone sensitive
Type restorer.
Embodiment 5 hybridizes transformation: utilize molecular marker by mutant CYP81A6-m2 gene transformation
In CMS line
Utilize molecular marker assisted selection first by bentazone sensitive mutant described in embodiment 1
Saltant type CYP81A6 transformation in 3522m is forever in 6B to keeping, then by 6B forever
By in saltant type CYP81A6 transformation to CMS line 6A forever, thus finally obtain
6A forever that CYP81A6 site banding pattern is consistent with 3522m banding pattern and forever 6B are used for producing and educating
Plant practice.It is as follows that it is embodied as step:
1, F1 is obtained for maternal with 3522m hybridization with 6B forever.
2, with F1 for the maternal acquisition BC1F1 that backcrosses with 6B forever.
3, molecular marker such as BM4 is utilized to select CYP81A6 site to be heterozygous state
BC1F1.Concrete operations are as follows:
(1) plantation BC1F1, extracts seedling leaf genomic DNA.
(2) with molecular marker BM4 described in embodiment 3 in the present embodiment step 3 (1)
The genomic DNA obtained carries out PCR amplification, PCR amplification condition such as embodiment 2.Select
It is the individuality of heterozygous state in CYP81A6 site, i.e. selects PCR primer to show 216 simultaneously
The individuality of bp and 193bp fragment.
4, from the BC1F1 that CYP81A6 site is heterozygous state, phenotype is selected at heading stage
The individual plant similar to 6B forever is that maternal backcrossing with 6B forever obtains BC2F1.
5, molecular marker such as BM4 is utilized to select CYP81A6 site to be heterozygous state
BC2F1.Concrete operations are with the present embodiment step 3.
6, from the BC2F1 that CYP81A6 site is heterozygous state, phenotype is selected at heading stage
The individual plant similar to 6B forever is that maternal backcrossing with 6B forever obtains BC3F1.
7, molecular marker such as BM4 is utilized to select CYP81A6 site to be heterozygous state
BC3F1.Concrete operations are with the present embodiment step 3.
8, from the BC3F1 that CYP81A6 site is heterozygous state, phenotype is selected at heading stage
The individual plant high with 6B similarity forever, after self-fertility maturation, point individual plant results BC3F2.
9, molecular marker such as BM4 is utilized to select CYP81A6 site consistent with 3522m banding pattern
BC3F2.Concrete operations are as follows:
(1) plantation BC3F2, extracts seedling leaf genomic DNA.
(2) the molecular marker such as BM4 gene to obtaining in the present embodiment step 9 (1) is utilized
Group DNA carries out PCR amplification, and amplification condition is with embodiment 2.Select in CYP81A6 position
The individuality that point is consistent with 3522m banding pattern, i.e. selects PCR primer only to show 193bp fragment
Individual.
10, at heading stage, BC3F2 to obtaining from step 9 carries out estimating phenotypic screen,
The individual plant similar to 6B phenotype forever is selected to gather in the crops F1, and difference respectively with 6A paired cross forever
Receive BC3F3.
11, F1 and BC3F3 that sowing step 10 obtains, selects the F1 of pollen 100% abortion
Individual plant is that the BC3F3 of maternal and corresponding paternal origin backcrosses, it is thus achieved that with corresponding male parent as samsara
The BC1F1 of parent.
12, the hereafter continuous selfing of male parent is to BC3F6, and at per generation and corresponding maternal pairing backcrossing
To BC3F1.
13, molecular marker such as BM4 is utilized to select CYP81A6 site and 3522m banding pattern one
Male parent BC3F6 caused and maternal BC3F1.Concrete operations are as follows:
(1) plantation male parent BC3F6 and maternal BC3F1, extract seedling leaf genomic DNA.
(2) the molecular marker such as BM4 base to obtaining in the present embodiment step 13 (1) is utilized
Because group DNA carries out PCR amplification, amplification condition is with embodiment 2.Select at CYP81A6
The individuality that site is consistent with 3522m banding pattern, i.e. selects PCR primer only to show 193bp fragment
Individuality.
14, at heading stage and period of maturation, step 13 acquisition had saltant type CYP81A6
Male parent BC3F6 and maternal BC3F1 carry out Phenotypic Observation, select that there is excellent agronomy respectively
The individual plant sowing of character.
15, single-strain seed kind step 14 obtained becomes strain, the most numbered " father forever
18 " and the sterile line of " forever female 18 " and holding are that regularity is high, outcrossing habit is good, breeding
Yield is high, is named as " 7B the most forever " and " 7A the most forever ".
The above is only the preferred embodiment of the present invention, it is noted that lead for this technology
For the those of ordinary skill in territory, on the premise of without departing from the technology of the present invention principle, it is also possible to
Making some improvements and modifications, these improvements and modifications also should be regarded as protection scope of the present invention.
Claims (9)
1. an Oryza sativa L.CYP81A6Gene mutation bodyCYP81A6-m2, it is Oryza sativa L.CYP81A6Lacking 23 bases at second exons 1 of gene 747,23 bases of described disappearance are CCGAGATCGACGCATCCGTCGGC, and the nucleotide sequence of this mutant is as shown in SEQ ID No.1.
2. contain Oryza sativa L. described in claim 1CYP81A6Gene mutation bodyCYP81A6-m2Expression vector.
3. contain the host cell of expression vector described in claim 2.
4. the Oryza sativa L. described in claim 1CYP81A6Gene mutation bodyCYP81A6-m2Application in preparing transgenic plant.
5. the Oryza sativa L. described in claim 1CYP81A6Gene mutation bodyCYP81A6-m2Application in rice modification breeding, the production of hybrid seeds.
6. test right requires the Oryza sativa L. described in 1CYP81A6Gene mutation bodyCYP81A6-m2Molecular marker, it is characterised in that this molecular marker is to be obtained by following primer pair amplifies, and the nucleotides sequence of described primer pair is classified as:
SEQ ID
NO.10-11 or SEQ ID NO.12-13 or
SEQ ID
NO.14-15 or SEQ ID NO.16-17.
7. the molecular marker described in claim 6 is in detectionCYP81A6Gene mutation bodyCYP81A6-m2In application.
8. the application in the transgenic plant that preparation is sensitive to bentazone of the molecular marker described in claim 6.
9. the Oryza sativa L. described in claim 1CYP81A6Gene mutation bodyCYP81A6-m2The detection method of molecular marker, it is characterised in that by the primer pair amplifies of one of the following plant genome DNA to be checked, and detect amplified production:
The nucleotides sequence of described primer pair is classified as: SEQ ID NO.10-11 or SEQ ID NO.12-13 or SEQ ID NO.14-15 or SEQ ID NO.16-17；
If with the amplified fragments to 270 bp can be amplified of the primer shown in SEQ ID NO.10-11, or with the amplified fragments to 83 bp can be amplified of the primer shown in SEQ ID NO.12-13, or with the amplified fragments to 109 bp can be amplified of the primer shown in SEQ ID NO.14-15, or with the primer shown in SEQ ID NO.16-17 to the amplified fragments of 193 bp can be amplified, then indicate that this plant to be checked exists Oryza sativa L.CYP81A6Gene mutation bodyCYP81A6-m2。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510351880.1A CN104946671B (en) | 2015-06-24 | 2015-06-24 | A kind of Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510351880.1A CN104946671B (en) | 2015-06-24 | 2015-06-24 | A kind of Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104946671A CN104946671A (en) | 2015-09-30 |
| CN104946671B true CN104946671B (en) | 2016-09-28 |
Family
ID=54161735
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510351880.1A Active CN104946671B (en) | 2015-06-24 | 2015-06-24 | A kind of Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104946671B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018018979A1 (en) * | 2016-07-26 | 2018-02-01 | 浙江大学 | Recombinant plant vector and method for screening non-transgenic gene-edited strain |
| CN109957577A (en) * | 2019-02-27 | 2019-07-02 | 海南波莲水稻基因科技有限公司 | A kind of plant expression vector and its application inhibiting cytochrome P450 gene using rice endogenous sequence |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007000077A1 (en) * | 2005-06-28 | 2007-01-04 | Zhejiang University | A bentazon and sulfonylurea herbicide-resistant gene cyp81a6 of rice |
| CN102946715A (en) * | 2010-01-07 | 2013-02-27 | 巴斯福农业有限责任公司阿纳姆(荷兰)韦登斯维尔分公司 | Herbicide-tolerant plants |
| CN103602705A (en) * | 2013-11-11 | 2014-02-26 | 浙江大学 | Method for obtaining safely and optionally killed transgenic rice by using artificial micro ribonucleic acids (amiRNAs) |
| CN104206268A (en) * | 2014-09-09 | 2014-12-17 | 扬州大学 | Novel method for sensitively cultivating efficient rice intelligent sterile line by using herbicides |
-
2015
- 2015-06-24 CN CN201510351880.1A patent/CN104946671B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007000077A1 (en) * | 2005-06-28 | 2007-01-04 | Zhejiang University | A bentazon and sulfonylurea herbicide-resistant gene cyp81a6 of rice |
| CN102946715A (en) * | 2010-01-07 | 2013-02-27 | 巴斯福农业有限责任公司阿纳姆(荷兰)韦登斯维尔分公司 | Herbicide-tolerant plants |
| CN103602705A (en) * | 2013-11-11 | 2014-02-26 | 浙江大学 | Method for obtaining safely and optionally killed transgenic rice by using artificial micro ribonucleic acids (amiRNAs) |
| CN104206268A (en) * | 2014-09-09 | 2014-12-17 | 扬州大学 | Novel method for sensitively cultivating efficient rice intelligent sterile line by using herbicides |
Non-Patent Citations (2)
| Title |
|---|
| Map-based cloning of a novel rice cytochrome P450 gene CYP81A6 that confers resistance to two different classes of herbicides.;Gang Pan et al;《Plant Molecular Biology》;20061231;第61卷(第6期);933-943页 * |
| 水稻及其敏感突变体苯达松抗性的生理生化差异研究(英文)。;王云生等;《作物学报》;20081231;第34卷(第9期);第1616页左栏第4段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104946671A (en) | 2015-09-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10238062B2 (en) | Methods to identify soybean aphid resistant quantitative trait loci in soybean and compositions thereof | |
| Sundaram et al. | Marker assisted introgression of bacterial blight resistance in Samba Mahsuri, an elite indica rice variety | |
| Pottorff et al. | Leaf morphology in Cowpea [Vigna unguiculata (L.) Walp]: QTL analysis, physical mapping and identifying a candidate gene using synteny with model legume species | |
| Yadav et al. | Marker aided introgression of ‘Saltol’, a major QTL for seedling stage salinity tolerance into an elite Basmati rice variety ‘Pusa Basmati 1509’ | |
| Abdelkhalik et al. | QTL-based analysis of leaf senescence in an indica/japonica hybrid in rice (Oryza sativa L.) | |
| Liao et al. | Development of male-specific markers and identification of sex reversal mutants in papaya | |
| Li et al. | Gynoecy instability in cucumber (Cucumis sativus L.) is due to unequal crossover at the copy number variation-dependent Femaleness (F) locus | |
| CN105349684A (en) | Molecular marker closely linked to maize rough dwarf disease resistant main effect QTL | |
| Gomez et al. | CRISPR-Cas9-mediated knockout of CYP79D1 and CYP79D2 in cassava attenuates toxic cyanogen production | |
| Yamada et al. | Effects on flowering and seed yield of dominant alleles at maturity loci E2 and E3 in a Japanese cultivar, Enrei | |
| US20200275628A1 (en) | Methods for Producing Corn Plants with Northern Leaf Blight Resistance and Compositions Thereof | |
| Oumouloud et al. | Development of molecular markers linked to the Fom-1 locus for resistance to Fusarium race 2 in melon | |
| Harris-Shultz et al. | Identification of simple sequence repeat markers that differentiate bermudagrass cultivars derived from ‘Tifgreen’ | |
| CN104946671B (en) | A kind of Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m2 and application thereof | |
| Rani et al. | Development of advance pearl millet lines tolerant to terminal drought stress using marker-assisted selection | |
| CN104946670B (en) | A kind of Oryza sativa L. CYP81A6 gene mutation body CYP81A6-m1 and application thereof | |
| Barrero et al. | Identifying genes associated with abiotic stress tolerance suitable for CRISPR/Cas9 editing in upland rice cultivars adapted to acid soils | |
| Zhang et al. | Identification of a cytochrome P450 hydroxylase, CYP81A6, as the candidate for the bentazon and sulfonylurea herbicide resistance gene, Bel, in rice | |
| Zhong et al. | MC03g0810, an important candidate gene controlling black seed coat color in bitter gourd (Momordica spp.) | |
| Chang et al. | Genetic behavior of Triticum aestivum–Dasypyrum villosum translocation chromosomes T6V# 4S· 6DL and T6V# 2S· 6AL carrying powdery mildew resistance | |
| Akinbo et al. | QTL Analysis for Root Protein in a Backcross Family of Cassava Derived from Manihot esculenta ssp flabellifolia | |
| Saminadane et al. | Development of early maturing salt-tolerant rice variety KKL (R) 3 using a combination of conventional and molecular breeding approaches | |
| Boopalakrishnan et al. | Mapping and linkage analysis of epistatic QTLs for gynoecious trait (F) in cucumber (Cucumis sativus L) | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| Valarmathi et al. | Development of early maturing, high yielding, drought tolerant rice variety with superior grain quality through molecular breeding and its performance evaluation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |