CN104946639A - Primer, method and kit for constructing gene mutation sequencing library - Google Patents
Primer, method and kit for constructing gene mutation sequencing library Download PDFInfo
- Publication number
- CN104946639A CN104946639A CN201510382788.1A CN201510382788A CN104946639A CN 104946639 A CN104946639 A CN 104946639A CN 201510382788 A CN201510382788 A CN 201510382788A CN 104946639 A CN104946639 A CN 104946639A
- Authority
- CN
- China
- Prior art keywords
- seq
- gene
- label
- pcr primer
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a PCR primer involving 47 genes and a tag PCR primer. The tag PCR primer is composed of the PCR primer and a DNA tag sequence connected to the 5' end of at least one primer in the PCR primer pair, wherein the DNA tag sequence is selected from SEQ ID NO: 107 to SEQ ID NO: 126. The invention further relates to a method and a kit for constructing a sequencing library by applying the DNA tag of the tag PCR primer. The coincidence rates of the detection method provided by the invention and the sequencing method is up to 100%, the provided amplification primer and the DNA tag form a detection product with a specificity, a sensitivity and a repeatability which are optimized and balanced, somatic mutation and mononucleotide polymorphism can be detected in parallel, and a plurality of base sequences of 1-20 sample sources can be accurately differentiated by one-time detection.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, particularly relate to the primer and method and test kit that build transgenation sequencing library.
Technical background
Transgenation refers to the change that gene base pair composition structurally occurs or puts in order.Common transgenation has somatic mutation and single nucleotide polymorphism (single nucleotide polymorphism, SNP).
Somatic mutation occurs in the sudden change in normal body cell, such as occurs in the sudden change in skin or organ.In recent years, the research of cancer gene group finds, there is thousands of place in somatic mutation site associated in Carcinogenesis.But the diagnosis and treatment of current cancer but often ignore this point.The mutant cells that therapeutic strategy is clinically dominant mainly for number.To treat the monoclonal antibody medicine Trastuzumab (Herceptin) of mammary cancer, its action target spot is the HER2 gene of cancer cells overexpression.If in the cancer cells in patient body, exist not containing HER2 gene subclone, even if Trastuzumab is effective at the beginning of using, along with this kind of cancer cells evolution, propagation, cancer development or recurrence can be caused equally.Why identical this also just explains, treatment plan, in the face of different patients has different curative effects.There is again the possibility of disease relapse in the cancer patients cured.At present relevant to the generation of tumour, development or curative effect of medication somatic mutation mainly contains: AKT1, AKT3, APC, ATM, BARF, CDH1, CDKN2A, CTNNB1, EGFR, FGFR1, FGFR2, FGFR3, FLT3, HER2, HRAS, IDH1, IDH2, KIT, KRAS, MEK1, MET, NRAS, PDGFRA, PIK3CA, PIK3R1, PIK3R5, PTEN, PTPN11, RB1, STK11, TP53, TSC1, VHL etc.
The occurrence frequency of SNP in crowd is greater than 1%, comprises the manifestation such as insertion or disappearance of the conversion of single base, transversion and single base.It is modal one in the heritable variation of the mankind, accounts for more than 90% of all known polymorphisms, is between ethnic group, one of the physical basis of heredity of interindividual variation.SNP is used widely as a kind of genetic marker, mainly come from following characteristic: (1) density is high: SNP is estimated as 500 ~ 1000bp in human genome mean density, more than 3,000,000 are reached in whole genomic distribution, genetic distance is 2 ~ 3cm, its density ratio microsatellite marker exceeds several order of magnitude, can the inside of any gene to be studied or near a series of mark is provided.(2) representative: some SNP may transcribing, translate, splice and play a significant role in rna stability etc., and some SNP being positioned at gene internal likely directly affects protein structure or expression level, therefore they may represent some influencing factor in disease genetic mechanism.(3) genetic stability: SNP derives from the sudden change occurred before thousands of year, and along with the mankind multiply stably heredity so far from generation to generation, compare with the Repeat Polymorphism mark such as micro-satellite, SNP has higher genetic stability.Possess above advantage, SNP is considered to the third generation molecular genetic marker after first-generation restriction fragment length polymorphism and s-generation microsatellite polymorphism.At present to the generation of tumour, develop relevant SNP and mainly contain: CYP2D6, DPYD, TYMS, UGT1A1, VEGFA, VEGFR2, VEGFR3, CYP3A5, TPMT, MTHFR, GSTP1, ERCC1, ERCC2 and XRCC1 etc.
Existing multiple method can be used for detection in Gene Mutation, as sequencing, DHPLC method, ARMS method, biochip etc. at present.Wherein the method such as first-generation sequencing technologies, ARMS, DHPLC cannot realize multiple target gene parallel detection and can only separate repeatedly carrying out; thus cause using sample size to increase progressively at double, increase the consuming time and problems such as somewhat expensive of systematic error, testing process, make it be difficult to realize mass-producing.Although liquid-phase chip detection method can realize the parallel detection of multiple gene, to the mutational site of the unknown, there is certain limitation.
Polygene parallel detection, not only increases efficiency, reduces expense, and its even more important effect improves detection sensitivity and susceptible clinical degree, to the detection of transgenation to tumour morning sieve and clinical individualization treatment have important directive significance.At present, based on the polygene parallel detection of multiplex PCR, fail to solve following problem very well: primer inside forms the secondary structure such as hairpin structure or dimer; There is non-specific binding between designed primer, and form dimer between the Tag primer that formed of DNA tag combination, exist between mispairing and PCR primer and all there is non-specific binding etc.
The ultimate principle of s-generation order-checking is the order-checking of synthesis limit, limit.On the basis of the sequence measurements such as Sanger, with the dNTP that the fluorescent mark four kinds of different colours is different, when archaeal dna polymerase synthesis complementary strand, often add a kind of dNTP and will discharge different fluorescence, according to the fluorescent signal caught and through specific software processing, thus obtain the sequence information of DNA to be measured.The order-checking of two generations is a new low cost, high-throughput, the quick sequencing technologies of split hair caccuracy, all has a wide range of applications in clinical and scientific research.
Summary of the invention
An object of the present invention is to provide a kind of PCR primer, this PCR primer can connect and compose tag amplified primer with DNA label, corresponding DNA label on PCR primer band is made by pcr amplification, and by the PCR primer with different DNA label of multiple different sample source is mixed into a library, thus realize high-flux sequence.
The technical scheme realizing above-mentioned purpose is as follows.
A kind of PCR primer, be selected from least one pair of primer sequence for the design of target gene mutational site following: for SEQ ID NO:1 and the SEQ ID NO:2 of AKT1 gene, for SEQ ID NO:3 and the SEQ ID NO:4 of AKT3 gene, for SEQ ID NO:5 and the SEQ ID NO:6 of apc gene, SEQ ID NO:7 and SEQ ID NO:8, for SEQ ID NO:9 and the SEQ ID NO:10 of ATM gene, for SEQ ID NO:11 and the SEQ ID NO:12 of BRAF gene, SEQ ID NO:13 and SEQ ID NO:14, for SEQ ID NO:15 and the SEQ ID NO:16 of CDH1 gene, for SEQ ID NO:17 and the SEQ ID NO:18 of CDKN2A gene, for SEQ ID NO:19 and the SEQ ID NO:20 of CTNNB1 gene, for SEQ ID NO:21 and the SEQ ID NO:22 of CYP2D6 gene, SEQ ID NO:23 and SEQ ID NO:24, for SEQ ID NO:25 and the SEQ ID NO:26 of CYP3A5 gene, for SEQ ID NO:27 and the SEQ ID NO:28 of DPYD gene, for SEQ ID NO:29 and the SEQ ID NO:30 of EGFR gene, for SEQ ID NO:31 and the SEQ ID NO:32 of ERCC1 gene, for SEQ ID NO:33 and the SEQ ID NO:34 of ERCC2 gene, for SEQ ID NO:35 and the SEQ ID NO:36 of FGFR1 gene, for SEQ ID NO:37 and the SEQ ID NO:38 of FGFR2 gene, for SEQ ID NO:39 and the SEQ ID NO:40 of FGFR3 gene, for SEQ ID NO:41 and the SEQ ID NO:42 of FLT3 gene, for SEQ ID NO:43 and the SEQ ID NO:44 of GSTP1 gene, for SEQ ID NO:45 and the SEQ ID NO:46 of HER2 gene, for SEQ ID NO:47 and the SEQ ID NO:48 of HRAS gene, for SEQ ID NO:49 and the SEQ ID NO:50 of IDH1 gene, for SEQ ID NO:51 and the SEQ ID NO:52 of IDH2 gene, for SEQ ID NO:53 and the SEQ ID NO:54 of KIT gene, for SEQ ID NO:55 and the SEQ ID NO:56 of KRAS gene, SEQ ID NO:57 and SEQ ID NO:58, for SEQ ID NO:59 and the SEQ ID NO:60 of MEK1 gene, for SEQ ID NO:61 and the SEQ ID NO:62 of MET gene, for SEQ ID NO:63 and the SEQ ID NO:64 of mthfr gene, SEQ ID NO:65 and SEQ ID NO:66, for SEQ ID NO:67 and the SEQ ID NO:68 of NRAS gene, for SEQ ID NO:69 and the SEQ ID NO:70 of PDGFRA gene, for SEQ ID NO:71 and the SEQ ID NO:72 of PIK3CA gene, for SEQ ID NO:73 and the SEQ ID NO:74 of PIK3R1 gene, for SEQ ID NO:75 and the SEQ ID NO:76 of PIK3R5 gene, for SEQ ID NO:77 and the SEQ ID NO:78 of PTEN gene, for SEQ ID NO:79 and the SEQ ID NO:80 of PTPN11 gene, for SEQ ID NO:81 and the SEQ ID NO:82 of RB1 gene, for SEQ ID NO:83 and the SEQ ID NO:84 of STK11 gene, SEQ ID NO:85 and SEQ ID NO:86, for SEQ ID NO:87 and the SEQ ID NO:88 of TP53 gene, for SEQ ID NO:89 and the SEQ ID NO:90 of TPMT gene, for SEQ ID NO:91 and the SEQ ID NO:92 of TSC1 gene, for SEQ ID NO:93 and the SEQ ID NO:94 of TYMS gene, for SEQ ID NO:95 and the SEQ ID NO:96 of UGT1A1 gene, for SEQ ID NO:97 and the SEQ ID NO:98 of VEGFA gene, for SEQ ID NO:99 and the SEQ ID NO:100 of VEGFR2 gene, for SEQ ID NO:101 and the SEQ ID NO:102 of VEGFR3 gene, for SEQ ID NO:103 and the SEQ ID NO:104 of vhl gene, for SEQ ID NO:105 and the SEQ ID NO:106 of XRCC1 gene.
Another object of the present invention is to provide a kind of label PCR primer.
Concrete technical scheme is as follows.
A kind of label PCR primer, by above-mentioned PCR primer and be connected to the DNA sequence label that in often pair of primer, at least one primer 5 ' is held and form, described DNA sequence label is selected from SEQ ID NO:107-SEQ ID NO:126.
Another object of the present invention is to provide a kind of method that DNA label builds sequencing library.
The technical scheme realizing above-mentioned purpose is as follows.
DNA label builds a method for sequencing library, mainly comprises the following steps:
A, the DNA extracted in sample;
B, adopt above-mentioned label PCR primer for target gene mutational site, the testing sample that pcr amplification is different, different for the DNA sequence label in the label PCR primer of often kind of different testing sample;
C, purifying reclaim pcr amplification product, and are mixed by the amplified production of different testing sample, form nucleic acid sequencing library.
Wherein in an embodiment, the quantity of the sample detected is 1-20.
Wherein in an embodiment, the quantity of the sample detected is 20.
Another object of the present invention is to provide a kind of method of high-flux sequence.
The technical scheme realizing above-mentioned purpose is as follows.
A method for high-flux sequence, mainly comprises the following steps:
A, adopt above-mentioned DNA label to build the method for sequencing library, set up nucleic acid sequencing library;
B, nucleic acid sequencing library carried out successively end reparation, jointing and purifying and reclaim and connect product
C, above-mentioned connection product to be checked order, to determine the sequence information in described nucleic acid sequencing library.
Wherein in an embodiment, the base sequence of the described joint in described step B is as shown in SEQ ID NO:127 and SEQ ID NO:128.
Another object of the present invention is to provide the test kit that a kind of DNA label builds sequencing library.
The technical scheme realizing above-mentioned purpose is as follows.
A kind of DNA label builds the test kit of sequencing library, include: for the different PCR primer groups of different sample, each group PCR primer described includes at least one pair of PCR primer pair, and the 5 ' end of at least one is connected with DNA sequence label in often pair of PCR primer pair, the DNA sequence label of described same primer sets is identical, the DNA sequence label of different primers group is different, and described DNA sequence label is selected from SEQ ID NO:107-SEQ ID NO:126, and described PCR primer as claimed in claim 1.
Wherein in an embodiment, there are 20 groups of label PCR primer, DNA sequence label in these 20 groups of label PCR primer is selected from SEQ ID NO:107-SEQ ID NO:126, and DNA sequence label often in group is different, the often PCR primer sequence organized in label PCR primer often organized is: for SEQ ID NO:1 and the SEQ ID NO:2 of AKT1 gene, for SEQ ID NO:3 and the SEQ ID NO:4 of AKT3 gene, for SEQ ID NO:5 and the SEQ ID NO:6 of apc gene, SEQ ID NO:7 and SEQ ID NO:8, for SEQ ID NO:9 and the SEQ ID NO:10 of ATM gene, for SEQ ID NO:11 and the SEQ ID NO:12 of BRAF gene, SEQ ID NO:13 and SEQ ID NO:14, for SEQ ID NO:15 and the SEQ ID NO:16 of CDH1 gene, for SEQ ID NO:17 and the SEQ ID NO:18 of CDKN2A gene, for SEQ ID NO:19 and the SEQ ID NO:20 of CTNNB1 gene, for SEQ ID NO:21 and the SEQ ID NO:22 of CYP2D6 gene, SEQ ID NO:23 and SEQ ID NO:24, for SEQ ID NO:25 and the SEQ ID NO:26 of CYP3A5 gene, for SEQ ID NO:27 and the SEQ ID NO:28 of DPYD gene, for SEQ ID NO:29 and the SEQ ID NO:30 of EGFR gene, for SEQ ID NO:31 and the SEQ ID NO:32 of ERCC1 gene, for SEQ ID NO:33 and the SEQ ID NO:34 of ERCC2 gene, for SEQ ID NO:35 and the SEQ ID NO:36 of FGFR1 gene, for SEQ ID NO:37 and the SEQ ID NO:38 of FGFR2 gene, for SEQ ID NO:39 and the SEQ ID NO:40 of FGFR3 gene, for SEQ ID NO:41 and the SEQ ID NO:42 of FLT3 gene, for SEQ ID NO:43 and the SEQ ID NO:44 of GSTP1 gene, for SEQ ID NO:45 and the SEQ ID NO:46 of HER2 gene, for SEQ ID NO:47 and the SEQ ID NO:48 of HRAS gene, for SEQ ID NO:49 and the SEQ ID NO:50 of IDH1 gene, for SEQ ID NO:51 and the SEQ ID NO:52 of IDH2 gene, for SEQ ID NO:53 and the SEQ ID NO:54 of KIT gene, for SEQ ID NO:55 and the SEQ ID NO:56 of KRAS gene, SEQ ID NO:57 and SEQ ID NO:58, for SEQ ID NO:59 and the SEQ ID NO:60 of MEK1 gene, for SEQ ID NO:61 and the SEQ ID NO:62 of MET gene, for SEQ ID NO:63 and the SEQ ID NO:64 of mthfr gene, SEQ ID NO:65 and SEQ ID NO:66, for SEQ ID NO:67 and the SEQ ID NO:68 of NRAS gene, for SEQ ID NO:69 and the SEQ ID NO:70 of PDGFRA gene, for SEQ ID NO:71 and the SEQ ID NO:72 of PIK3CA gene, for SEQ ID NO:73 and the SEQ ID NO:74 of PIK3R1 gene, for SEQ ID NO:75 and the SEQ ID NO:76 of PIK3R5 gene, for SEQ ID NO:77 and the SEQ ID NO:78 of PTEN gene, for SEQ ID NO:79 and the SEQ ID NO:80 of PTPN11 gene, for SEQ ID NO:81 and the SEQ ID NO:82 of RB1 gene, for SEQ ID NO:83 and the SEQ ID NO:84 of STK11 gene, SEQ ID NO:85 and SEQ ID NO:86, for SEQ ID NO:87 and the SEQ ID NO:88 of TP53 gene, for SEQ ID NO:89 and the SEQ ID NO:90 of TPMT gene, for SEQ ID NO:91 and the SEQ ID NO:92 of TSC1 gene, for SEQ ID NO:93 and the SEQ ID NO:94 of TYMS gene, for SEQ ID NO:95 and the SEQ ID NO:96 of UGT1A1 gene, for SEQ ID NO:97 and the SEQ ID NO:98 of VEGFA gene, for SEQ ID NO:99 and the SEQ ID NO:100 of VEGFR2 gene, for SEQ ID NO:101 and the SEQ ID NO:102 of VEGFR3 gene, for SEQ ID NO:103 and the SEQ ID NO:104 of vhl gene, with for the SEQ ID NO:105 of XRCC1 gene and SEQ ID NO:106.
Major advantage of the present invention is:
1. amplimer provided by the invention, can respectively for somatic mutation and single nucleotide polymorphism, primary first-order equation process, realize good the Efficiency of Mutiplex PCR, accuracy in detection reaches more than 99%, avoids the mutual competitive resource of different amplified fragments in multiplex PCR and the high abundance template caused can be easy to detect (such as: single nucleotide polymorphism), and low-abundance template then becomes background, for the somatic mutation of template number pettiness, particularly so.
2, the identical rate of detection method provided by the present invention and sequencing is up to 100%, the amplimer provided and DNA label form a specificity, reach the testing product optimized, balance between sensitivity and repeatability, energy parallel detection somatic mutation and single nucleotide polymorphism, one-time detection accurately can distinguish many base sequences of 1-20 kind samples sources.
3, the amplimer designed by the present invention has extraordinary specificity, and after amplimer and DNA sequence label are combined into Tag primer, inside does not exist the secondary structure such as hairpin structure or dimer; There is not non-specific binding between designed amplimer, and do not form dimer between the Tag primer that formed of DNA tag combination, do not exist between mispairing and PCR primer and all there is not non-specific binding.
4, detection method step of the present invention is simple, according to different testing goals, the amplimer composition multiple PCR primer of different quantities and kind can be selected, plurality of target in a sample can be completed by One_step PCR amplification and detect the amplification of sequence, and make its amplified production all bring a specific DNA label, by the different sample P CR products with different label are mixed, realize the parallel detection of the multiple PCR primer of the multiple sample of one-time detection, avoid the many uncertain factors existed in the complex operations processes such as repeated multiple times PCR, thus greatly Detection accuracy can be improved, embody accurate simultaneously qualitative, quantitative analysis feature.
5, the time required for detection method provided by the present invention, well below conventional sequencing technologies, meets clinical needs especially.
Embodiment
In order to more clearly understand technology contents of the present invention, describe in detail especially exemplified by following examples.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition, the people such as such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.Various conventional chemical reagent used in embodiment, is commercially available prod.
Unless otherwise defined, all technology used in the present invention and scientific terminology are identical with belonging to the implication that those skilled in the art of the present invention understand usually.The object of the term used in specification sheets of the present invention just in order to describe specific embodiment, is not used in restriction the present invention.Term "and/or" used in the present invention comprises arbitrary and all combinations of one or more relevant Listed Items.
Embodiment 1 builds the primer of transgenation sequencing library
One, the primer of the target sequence containing gene mutation site is provided in amplification
The invention provides the amplimer of 47 target genes, and, according to the kind detecting gene and mutational site, corresponding amplimer can be selected, in table 1.
Table 1 amplimer
Embodiment 2DNA sequence label and Tag primer
DNA label used in the present invention, refer to a bit of base sequence being added on PCR primer 5 ' end, for the PCR primer of each sample, in often pair of primer wherein at least one is connected with specific a kind of DNA label, thus form DNA Tag primer, and corresponding DNA label on PCR primer band same sample being originated by pcr amplification, thus the samples sources of DNA is accurately characterized by DNA label, and by the PCR primer (the DNA labels with different) of multiple different sample source is mixed into a library, thus realize the high-flux sequence completing multiple sample in once sequencing.
Often pair of Tag primer is made up of two portions, article two, at least one in primer is respectively the amplimer that 5 ' the DNA label and 3 ' held is held, and wherein, DNA label is used for marking PCR primer in pcr amplification reaction, amplimer part and template base pair complementarity, thus start PCR polyreaction.
Forward Tag primer=5 '-forward label-just at amplimer-3 ' end
Reverse Tag primer=5 '-oppositely label-oppositely amplimer-3 ' end
DNA label designed by the present invention, meets the following conditions, is specially: 1) avoid 3 or more base repetitive sequences in sequence label; 2) the GC content of sequence label is between 40% ~ 60%; 3), after sequence label and amplimer are combined into Tag primer, there is not the secondary structure such as hairpin structure or dimer in inside; 4) there is not non-specific binding, 5 between different DNA sequence labels) avoid the sequence that occurs being greater than 80% with amplimer similarity in sequence label; 6) do not form dimer between Tag primer, there is not mispairing and amplimer, all there is not non-specific binding between PCR primer.
The present invention, on the basis meeting above-mentioned condition, devises the DNA label that specificity is high, in table 2.DNA label, by combining with pcr amplification primer, forms corresponding tag amplified primer.
Table 2 DNA sequence label
| SEQIDNO. | Sequence label (5 ' → 3 ') | SEQIDNO. | Sequence label (5 ' → 3 ') |
| 107 | AGATCCTG | 117 | TCACGACA |
| 108 | TGCATGCA | 118 | TGTCTGAG |
| 109 | ACGAGATC | 119 | TGACGTAC |
| 110 | GTCGATGA | 120 | TGTCGTGA |
| 111 | GTCTGACT | 121 | TCGACTGA |
| 112 | GAGATCGT | 122 | GAGCTCAT |
| 113 | GACATCAG | 123 | TGCTACGT |
| 114 | GTACTCGA | 124 | GCTAGTAC |
| 115 | GACATCAG | 125 | TGCACTGT |
| 116 | GCTACTGA | 126 | AGCTGTAC |
Embodiment 3DNA label builds the test kit of sequencing library
DNA label of the present invention builds sequencing library test kit, include: for the different PCR primer groups of different sample, each group PCR primer described includes at least one pair of PCR primer pair, and the 5 ' end of at least one is connected with DNA sequence label in often pair of PCR primer pair, the DNA sequence label of described same primer sets is identical, the DNA sequence label of different primers group is different, and described DNA sequence label is selected from embodiment 2, and described PCR primer is selected from embodiment 1.
The present embodiment uses DNA label (table 2) the structure label PCR primer in embodiment 1 in amplimer (table 1) and embodiment 2, in the present embodiment, the test kit that described DNA label builds sequencing library has 20 groups of label PCR primer groups, often organize whole primers that label PCR primer all includes table 1 in embodiment 1, the forward amplimer of often pair of primer and 5 ' end of reverse amplimer (table 1) all introduce identical DNA label, thus form " DNA Tag primer ", and the tag amplified primer (with same DNA label) of multiple target detect gene is mixed, form Tag primer group, realize the parallel amplification of target detect gene in same sample.
Often organize label PCR primer and can correspond respectively to a detected sample, wherein, first sample uses a kind of DNA label to be connected with the amplimer described in table 1, thus formed " the Tag primer group " of the first sample, second sample uses another kind of DNA label to be connected with the amplimer described in table 1, thus formed " the Tag primer group " of the second sample, so analogize, the pcr amplification primer of different sample, different DNA labels is used to mark, and formation and detected sample are one to one " Tag primer group ", specifically as shown in table 3, the present embodiment uses the Tag primer built according to mentioned above principle, respectively pcr amplification is carried out to 20 kinds of samples.
Table 3 label PCR primer
Label PCR primer is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every bar sequence after synthesis is mixed with the stock solution of 100pmol/mL respectively with 10mmol/L Tris Buffer, wherein, often kind of label stock solution is separately preserved, and carries out mark.
Embodiment 4 uses label PCR primer pair sample in embodiment 3 to detect
One, the DNA extraction of sample:
Illustrate with reference to AxyPrep whole blood genome Mini Kit, obtain DNA to be detected.
Two, the pcr amplification of testing sample
Preparation Tag primer working fluid: according to the order of 20 samples in table 3, get PCR primer stock solution 100ul with DNA label respectively in 1.5ml Eppendorf tube, be assembled into 20 pipe label pcr amplification primers, mix and be multiple PCR primer working fluid, for each sample, that often introduce specific DNA label containing 5 ' end in pipe working fluid, detect sequence for 47 gene target amplimer.Amplification is containing the target sequence in mutational site respectively, and PCR reaction system is as follows:
Pcr amplification program is: 95 DEG C of 3min; 94 DEG C of 20s, 56 DEG C of 30s, 72 DEG C of 30s, 30 circulations; 72 DEG C of 10min;
By 20 reacted product mixing of sample P CR, and carry out the agarose gel electrophoresis of 2.5%, cutting glue recovery size is the fragment of 100 ~ 200bp, and purified product carries out mark, saves backup in 4 DEG C.
Three, end reparation
The purified product of step 2 is carried out end reparation, in the centrifuge tube of 1.5ml, prepares end repair reaction system: be specific as follows:
The mixed solution of above-mentioned preparation gained is placed in 25 DEG C, carries out reaction 1h.Reacted rear commercially available test kit or the magnetic bead of utilizing and carried out purifying, final purification product is dissolved in the elution buffer of 40 μ l.
Four, jointing
In the present embodiment, selected A1 joint and A2 joint specifically as shown in table 4, wherein, different sample uses identical A1 joint and identical A2 joint.
Table 4 A1 joint and A2 joint
| Title | Base sequence (5 ' → 3 ') | SEQIDNO. |
| A1 joint | CCTCTCAGGATGCGCATACTGAT | 127 |
| A2 joint | CCATGACACTCAGAGATGTGTCCGA | 128 |
Synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every bar sequence after synthesis is mixed with the stock solution of 100pmol/mL respectively with 10mmol/L Tris Buffer.
Respectively get A1 joint and A2 joint stock solution 100ul in 1.5ml Eppendorf tube, be mixed with joint working fluid;
Configuration jointing reaction system, concrete steps are as follows:
| End repairs product | 40μL |
| MgCl 2(200mM) | 7μL |
| Connect damping fluid (10 ×) | 10μL |
| Joint working fluid | 8μL |
| Tris-HCl(500mM) | 10μL |
| Dithiothreitol (DTT) (100mM) | 15μL |
| T4DNA ligase enzyme (200U/ul) | 10μL |
| Cumulative volume | 100μL |
The reaction system configured is placed in 20 DEG C, 20min; 65 DEG C, 15min.React rear use magnetic bead and carry out purifying; Purified product is placed in 4 DEG C and saves backup.
Five, library detection
Amplification gained PCR primer carries out purifying, and detects clip size and library concentration with Agilent Bioanalyzer2100 or Q-PCR.
Six, Ion Proton is used
tMpreparation sequencing template
According to Ion Proton
tMsequenator matched reagent box, uses step 5 gained sequencing library to prepare sequencing template, concrete operations, referring to product description.
Seven, upper machine order-checking
Carry out sequencing procedures in strict accordance with instrumentation specification sheets, adopt PI chip in the present embodiment, the sequencing template etc. loading enzyme, sequencing primer in the chips and prepare, sequencing procedure about 2.5 hours, just can obtain sequencing sequence information.
Eight, the analysis of sequencing result
According to the corresponding relation of DNA sequence label and sample 1 ~ 20, the data of each sample order-checking gained and direct sequencing are contrasted, calculates the identical rate of detected result provided by the present invention.Present method detect 20 increments this detected result in 47 gene target mutational sites and the sequencing result rate of coincideing reach 100%.Visible tag amplified primer provided by the present invention can detect the mutation type of 47 genes of 20 samples exactly in testing process, and result is reliable and stable.Concrete sequencing result is as follows:
Table 5 detected result contrasts
The different DNA Tag primer of embodiment 5 is on the impact of sequencing result
One, the selection (different DNA Tag primers) of primer pair
Act as from embodiment 2, DNA label the amplified production characterizing different sample source, investigation different DNA label of the present invention is formed different DNA Tag primers from amplimer by the present embodiment, and it is on the impact of Detection results.
The present embodiment, for ERCC1, FGFR3, KRAS, NRAS and TPMT gene, uses amplimer in table 1, respectively with the DNA label of table 2, builds label PCR primer, specifically as shown in table 6.
In the present embodiment, be provided with and all introduce identical DNA label at the forward amplimer of ERCC1, FGFR3, KRAS, NRAS and TPMT gene and 5 ' end of reverse amplimer, thus form " Tag primer group ", by this tag amplified group of primer mixing during use, realize the parallel amplification of target detect ERCC1, FGFR3, KRAS, NRAS and TPMT gene in a sample.
The present embodiment uses the Tag primer built according to mentioned above principle, design three groups of contrast experiments, and respectively pcr amplification is carried out to two samples, PCR primer in this experimental group is carried out mix, end reparation, library detection, preparation sequencing template, its Detection results of contrast such as upper machine order-checking, concrete operations are as shown in embodiment 2 and embodiment 3.
Table 6 selects different DNA labels on the impact of sequencing result
Method with reference to embodiment 4 detects sample, and result is as follows:
Table 7 detected result
As can be seen from the present embodiment, for ERCC1, FGFR3, KRAS, NRAS and TPMT gene, different DNA labels and its amplimer is used to form different DNA Tag primer groups, and same sample is detected, its detected result is consistent, simultaneously, the detected result of two samples is all reliable and stable, in like manner, 47 genes of target detect of the present invention, different quantities different types of target detect gene amplification primer DNA label different from embodiment 2 combines, and it is consistent and reliable and stable to the detected result of transgenation, and concrete test-results is omitted.
Embodiment 6 different quantities DNA Tag primer is on the impact of sequencing result
One, the selection (the DNA Tag primer of different quantities) of primer pair
From embodiment 1, the invention provides the amplimer of 47 target genes, according to the kind detecting gene and mutational site, select corresponding amplimer, the pcr amplification primer and DNA label of investigating different quantities are formed DNA Tag primer group by the present embodiment, and it is on the impact of Detection results.
The present embodiment, for AKT1, AKT3, ATM, CDH1 and CDKN2A gene, uses amplimer in table 1, respectively with the DNA label of table 2, builds label PCR primer group, specifically as shown in table 8.
In the present embodiment, be provided with and all introduce identical DNA label at the forward amplimer of AKT1, AKT3, ATM, CDH1 and CDKN2A gene and 5 ' end of reverse amplimer, thus form " Tag primer ", and this tag amplified primer is mixed to form a Tag primer group, use different primers group for different sample, thus realize the parallel amplification of target detect AKT1, AKT3, ATM, CDH1 and CDKN2A gene in three samples.
The present embodiment uses the Tag primer built according to mentioned above principle, design three groups of contrast experiments, and respectively pcr amplification is carried out to three samples, PCR primer in this experimental group is carried out mix, end reparation, library detection, preparation sequencing template, its Detection results of contrast such as upper machine order-checking, concrete operations are as shown in embodiment 2 and embodiment 3.
Table 8 selects different DNA labels on the impact of sequencing result
Method with reference to embodiment 4 detects sample, and result is as follows:
Table 8 detected result
As can be seen from the present embodiment, for AKT1, AKT3, ATM, CDH1 and CDKN2A gene, use the pcr amplification primer of different quantities and DNA label to form DNA Tag primer group, detect three samples, detected result is consistent, and it is reliable and stable, in like manner, 47 genes of target detect of the present invention, the DNA label different from embodiment 2 for different target detection gene amplification primer of different quantities combines, it is reliable and stable to the detected result of transgenation, and concrete test-results is omitted.
Each technical characteristic of the above embodiment can combine arbitrarily, for making description succinct, the all possible combination of each technical characteristic in above-described embodiment is not all described, but, as long as the combination of these technical characteristics does not exist contradiction, be all considered to be the scope that this specification sheets is recorded.
The above embodiment only have expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be construed as limiting the scope of the patent.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Claims (10)
1. a PCR primer, it is characterized in that, be selected from least one pair of primer sequence for the design of target gene mutational site following: for SEQ ID NO:1 and the SEQ ID NO:2 of AKT1 gene, for SEQ ID NO:3 and the SEQ ID NO:4 of AKT3 gene, for SEQ ID NO:5 and the SEQ ID NO:6 of apc gene, SEQ ID NO:7 and SEQ ID NO:8, for SEQ ID NO:9 and the SEQ ID NO:10 of ATM gene, for SEQ ID NO:11 and the SEQ ID NO:12 of BRAF gene, SEQ ID NO:13 and SEQ ID NO:14, for SEQ ID NO:15 and the SEQ ID NO:16 of CDH1 gene, for SEQ ID NO:17 and the SEQ ID NO:18 of CDKN2A gene, for SEQ ID NO:19 and the SEQ ID NO:20 of CTNNB1 gene, for SEQ ID NO:21 and the SEQ ID NO:22 of CYP2D6 gene, SEQ ID NO:23 and SEQ ID NO:24, for SEQ ID NO:25 and the SEQ ID NO:26 of CYP3A5 gene, for SEQ ID NO:27 and the SEQ ID NO:28 of DPYD gene, for SEQ ID NO:29 and the SEQ ID NO:30 of EGFR gene, for SEQ ID NO:31 and the SEQ ID NO:32 of ERCC1 gene, for SEQ ID NO:33 and the SEQ ID NO:34 of ERCC2 gene, for SEQ ID NO:35 and the SEQ ID NO:36 of FGFR1 gene, for SEQ ID NO:37 and the SEQ ID NO:38 of FGFR2 gene, for SEQ ID NO:39 and the SEQ ID NO:40 of FGFR3 gene, for SEQ ID NO:41 and the SEQ ID NO:42 of FLT3 gene, for SEQ ID NO:43 and the SEQ ID NO:44 of GSTP1 gene, for SEQ ID NO:45 and the SEQ ID NO:46 of HER2 gene, for SEQ ID NO:47 and the SEQ ID NO:48 of HRAS gene, for SEQ ID NO:49 and the SEQ ID NO:50 of IDH1 gene, for SEQ ID NO:51 and the SEQ ID NO:52 of IDH2 gene, for SEQ ID NO:53 and the SEQ ID NO:54 of KIT gene, for SEQ ID NO:55 and the SEQ ID NO:56 of KRAS gene, SEQ ID NO:57 and SEQ ID NO:58, for SEQ ID NO:59 and the SEQ ID NO:60 of MEK1 gene, for SEQ ID NO:61 and the SEQ ID NO:62 of MET gene, for SEQ ID NO:63 and the SEQ ID NO:64 of mthfr gene, SEQ ID NO:65 and SEQ ID NO:66, for SEQ ID NO:67 and the SEQ ID NO:68 of NRAS gene, for SEQ ID NO:69 and the SEQ ID NO:70 of PDGFRA gene, for SEQ ID NO:71 and the SEQ ID NO:72 of PIK3CA gene, for SEQ ID NO:73 and the SEQ ID NO:74 of PIK3R1 gene, for SEQ ID NO:75 and the SEQ ID NO:76 of PIK3R5 gene, for SEQ ID NO:77 and the SEQ ID NO:78 of PTEN gene, for SEQ ID NO:79 and the SEQ ID NO:80 of PTPN11 gene, for SEQ ID NO:81 and the SEQ ID NO:82 of RB1 gene, for SEQ ID NO:83 and the SEQ ID NO:84 of STK11 gene, SEQ ID NO:85 and SEQ ID NO:86, for SEQ ID NO:87 and the SEQ ID NO:88 of TP53 gene, for SEQ ID NO:89 and the SEQ ID NO:90 of TPMT gene, for SEQ ID NO:91 and the SEQ ID NO:92 of TSC1 gene, for SEQ ID NO:93 and the SEQ ID NO:94 of TYMS gene, for SEQ ID NO:95 and the SEQ ID NO:96 of UGT1A1 gene, for SEQ ID NO:97 and the SEQ ID NO:98 of VEGFA gene, for SEQ ID NO:99 and the SEQ ID NO:100 of VEGFR2 gene, for SEQ ID NO:101 and the SEQ ID NO:102 of VEGFR3 gene, for SEQ ID NO:103 and the SEQ ID NO:104 of vhl gene, for SEQ ID NO:105 and the SEQ ID NO:106 of XRCC1 gene.
2. a label PCR primer, is characterized in that, be made up of PCR primer according to claim 1 and 5 ' the DNA sequence label held that is connected in often pair of primer at least one, described DNA sequence label is selected from SEQ ID NO:107-SEQ ID NO:126.
3. label PCR primer according to claim 2, it is characterized in that, PCR primer is SEQ ID NO:1 for AKT1 gene and SEQ ID NO:2, for SEQ ID NO:3 and the SEQ ID NO:4 of AKT3 gene, for SEQ ID NO:5 and the SEQ ID NO:6 of apc gene, SEQ ID NO:7 and SEQ ID NO:8, for SEQ ID NO:9 and the SEQ ID NO:10 of ATM gene, for SEQ ID NO:11 and the SEQ ID NO:12 of BRAF gene, SEQ ID NO:13 and SEQ ID NO:14, for SEQ ID NO:15 and the SEQ ID NO:16 of CDH1 gene, for SEQ ID NO:17 and the SEQ ID NO:18 of CDKN2A gene, for SEQ ID NO:19 and the SEQ ID NO:20 of CTNNB1 gene, for SEQ ID NO:21 and the SEQ ID NO:22 of CYP2D6 gene, SEQ ID NO:23 and SEQ ID NO:24, for SEQ ID NO:25 and the SEQ ID NO:26 of CYP3A5 gene, for SEQ ID NO:27 and the SEQ ID NO:28 of DPYD gene, for SEQ ID NO:29 and the SEQ ID NO:30 of EGFR gene, for SEQ ID NO:31 and the SEQ ID NO:32 of ERCC1 gene, for SEQ ID NO:33 and the SEQ ID NO:34 of ERCC2 gene, for SEQ ID NO:35 and the SEQ ID NO:36 of FGFR1 gene, for SEQ ID NO:37 and the SEQ ID NO:38 of FGFR2 gene, for SEQ ID NO:39 and the SEQ ID NO:40 of FGFR3 gene, for SEQ ID NO:41 and the SEQ ID NO:42 of FLT3 gene, for SEQ ID NO:43 and the SEQ ID NO:44 of GSTP1 gene, for SEQ ID NO:45 and the SEQ ID NO:46 of HER2 gene, for SEQ ID NO:47 and the SEQ ID NO:48 of HRAS gene, for SEQ ID NO:49 and the SEQ ID NO:50 of IDH1 gene, for SEQ ID NO:51 and the SEQ ID NO:52 of IDH2 gene, for SEQ ID NO:53 and the SEQ ID NO:54 of KIT gene, for SEQ ID NO:55 and the SEQ ID NO:56 of KRAS gene, SEQ ID NO:57 and SEQ ID NO:58, for SEQ ID NO:59 and the SEQ ID NO:60 of MEK1 gene, for SEQ ID NO:61 and the SEQ ID NO:62 of MET gene, for SEQ ID NO:63 and the SEQ ID NO:64 of mthfr gene, SEQ ID NO:65 and SEQ ID NO:66, for SEQ ID NO:67 and the SEQ ID NO:68 of NRAS gene, for SEQ ID NO:69 and the SEQ ID NO:70 of PDGFRA gene, for SEQ ID NO:71 and the SEQ ID NO:72 of PIK3CA gene, for SEQ ID NO:73 and the SEQ ID NO:74 of PIK3R1 gene, for SEQ ID NO:75 and the SEQ ID NO:76 of PIK3R5 gene, for SEQ ID NO:77 and the SEQ ID NO:78 of PTEN gene, for SEQ ID NO:79 and the SEQ ID NO:80 of PTPN11 gene, for SEQ ID NO:81 and the SEQ ID NO:82 of RB1 gene, for SEQ ID NO:83 and the SEQ ID NO:84 of STK11 gene, SEQ ID NO:85 and SEQ ID NO:86, for SEQ ID NO:87 and the SEQ ID NO:88 of TP53 gene, for SEQ ID NO:89 and the SEQ ID NO:90 of TPMT gene, for SEQ ID NO:91 and the SEQ ID NO:92 of TSC1 gene, for SEQ ID NO:93 and the SEQ ID NO:94 of TYMS gene, for SEQ ID NO:95 and the SEQ ID NO:96 of UGT1A1 gene, for SEQ ID NO:97 and the SEQ ID NO:98 of VEGFA gene, for SEQ ID NO:99 and the SEQ ID NO:100 of VEGFR2 gene, for SEQ ID NO:101 and the SEQ ID NO:102 of VEGFR3 gene, for SEQ ID NO:103 and the SEQ ID NO:104 of vhl gene, for SEQ ID NO:105 and the SEQ ID NO:106 of XRCC1 gene.
4. DNA label builds a method for sequencing library, it is characterized in that, mainly comprises the following steps:
A. the DNA at least one sample to be detected is extracted respectively;
B. adopt for the label PCR primer described in the Claims 2 or 3 in target gene mutational site, the testing sample that pcr amplification is different, different for the DNA sequence label in the label PCR primer of different testing samples;
C. purifying reclaims pcr amplification product, and is mixed by the amplified production of different testing sample, forms nucleic acid sequencing library.
5. DNA label according to claim 4 builds the method for sequencing library, it is characterized in that, the quantity of sample to be detected is 1-20.
6. DNA label according to claim 5 builds the method for sequencing library, and it is characterized in that, the quantity of sample to be detected is 20.
7. a method for high-flux sequence, is characterized in that, mainly comprises the following steps:
The DNA label of A, any one of employing claim 4-6 builds the method for sequencing library, sets up nucleic acid sequencing library;
B, nucleic acid sequencing library carried out successively end reparation, jointing and purifying and reclaim and connect product;
C, above-mentioned connection product to be checked order, to determine the sequence information in described nucleic acid sequencing library.
8. the method for high-flux sequence according to claim 7, is characterized in that, the base sequence of described step B center tap is as shown in SEQ ID NO:127 and SEQ ID NO:128.
9. the test kit of a DNA label structure sequencing library, it is characterized in that, include: for the different PCR primer groups of different sample, described often group in PCR primer group includes at least one pair of PCR primer pair, and the 5 ' end of at least one is connected with DNA sequence label in often pair of PCR primer pair, the DNA sequence label of described same primer sets is identical, the DNA sequence label of different primers group is different, described DNA sequence label is selected from SEQ ID NO:107-SEQ ID NO:126, and described PCR primer pair as claimed in claim 1.
10. DNA label according to claim 9 builds the test kit of sequencing library, it is characterized in that, include 20 groups of PCR primer groups for different sample, DNA sequence label in these 20 groups of label PCR primer is selected from SEQ ID NO:107-SEQ ID NO:126, and DNA sequence label often in group is different, often the PCR primer sequence organized in label PCR primer is: for SEQ ID NO:1 and the SEQ ID NO:2 of AKT1 gene, for SEQ ID NO:3 and the SEQ ID NO:4 of AKT3 gene, for SEQ ID NO:5 and the SEQ ID NO:6 of apc gene, SEQ ID NO:7 and SEQ ID NO:8, for SEQ ID NO:9 and the SEQ ID NO:10 of ATM gene, for SEQ ID NO:11 and the SEQ ID NO:12 of BRAF gene, SEQ ID NO:13 and SEQ ID NO:14, for SEQ ID NO:15 and the SEQ ID NO:16 of CDH1 gene, for SEQ ID NO:17 and the SEQ ID NO:18 of CDKN2A gene, for SEQ ID NO:19 and the SEQ ID NO:20 of CTNNB1 gene, for SEQ ID NO:21 and the SEQ ID NO:22 of CYP2D6 gene, SEQ ID NO:23 and SEQ ID NO:24, for SEQ ID NO:25 and the SEQ ID NO:26 of CYP3A5 gene, for SEQ ID NO:27 and the SEQ ID NO:28 of DPYD gene, for SEQ ID NO:29 and the SEQ ID NO:30 of EGFR gene, for SEQ ID NO:31 and the SEQ ID NO:32 of ERCC1 gene, for SEQ ID NO:33 and the SEQ ID NO:34 of ERCC2 gene, for SEQ ID NO:35 and the SEQ ID NO:36 of FGFR1 gene, for SEQ ID NO:37 and the SEQ ID NO:38 of FGFR2 gene, for SEQ ID NO:39 and the SEQ ID NO:40 of FGFR3 gene, for SEQ ID NO:41 and the SEQ ID NO:42 of FLT3 gene, for SEQ ID NO:43 and the SEQ ID NO:44 of GSTP1 gene, for SEQ ID NO:45 and the SEQ ID NO:46 of HER2 gene, for SEQ ID NO:47 and the SEQ ID NO:48 of HRAS gene, for SEQ ID NO:49 and the SEQ ID NO:50 of IDH1 gene, for SEQ ID NO:51 and the SEQ ID NO:52 of IDH2 gene, for SEQ ID NO:53 and the SEQ ID NO:54 of KIT gene, for SEQ ID NO:55 and the SEQ ID NO:56 of KRAS gene, SEQ ID NO:57 and SEQ ID NO:58, for SEQ ID NO:59 and the SEQ ID NO:60 of MEK1 gene, for SEQ ID NO:61 and the SEQ ID NO:62 of MET gene, for SEQ ID NO:63 and the SEQ ID NO:64 of mthfr gene, SEQ ID NO:65 and SEQ ID NO:66, for SEQ ID NO:67 and the SEQ ID NO:68 of NRAS gene, for SEQ ID NO:69 and the SEQ ID NO:70 of PDGFRA gene, for SEQ ID NO:71 and the SEQ ID NO:72 of PIK3CA gene, for SEQ ID NO:73 and the SEQ ID NO:74 of PIK3R1 gene, for SEQ ID NO:75 and the SEQ ID NO:76 of PIK3R5 gene, for SEQ ID NO:77 and the SEQ ID NO:78 of PTEN gene, for SEQ ID NO:79 and the SEQ ID NO:80 of PTPN11 gene, for SEQ ID NO:81 and the SEQ ID NO:82 of RB1 gene, for SEQ ID NO:83 and the SEQ ID NO:84 of STK11 gene, SEQ ID NO:85 and SEQ ID NO:86, for SEQ ID NO:87 and the SEQ ID NO:88 of TP53 gene, for SEQ ID NO:89 and the SEQ ID NO:90 of TPMT gene, for SEQ ID NO:91 and the SEQ ID NO:92 of TSC1 gene, for SEQ ID NO:93 and the SEQ ID NO:94 of TYMS gene, for SEQ ID NO:95 and the SEQ ID NO:96 of UGT1A1 gene, for SEQ ID NO:97 and the SEQ ID NO:98 of VEGFA gene, for SEQ ID NO:99 and the SEQ ID NO:100 of VEGFR2 gene, for SEQ ID NO:101 and the SEQ ID NO:102 of VEGFR3 gene, for SEQ ID NO:103 and the SEQ ID NO:104 of vhl gene, with for the SEQ ID NO:105 of XRCC1 gene and SEQ ID NO:106.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510382788.1A CN104946639B (en) | 2015-07-01 | 2015-07-01 | Build the primer and method and kit of gene mutation sequencing library |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510382788.1A CN104946639B (en) | 2015-07-01 | 2015-07-01 | Build the primer and method and kit of gene mutation sequencing library |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104946639A true CN104946639A (en) | 2015-09-30 |
| CN104946639B CN104946639B (en) | 2017-10-31 |
Family
ID=54161703
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510382788.1A Active CN104946639B (en) | 2015-07-01 | 2015-07-01 | Build the primer and method and kit of gene mutation sequencing library |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104946639B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105255865A (en) * | 2015-10-16 | 2016-01-20 | 苏州贝斯麦医疗仪器有限公司 | Fluorescent quantitative PCR (polymerase chain reaction) detection kit for TYMS (thymidylate synthase) gene expression quantity and application of kit |
| CN105950774A (en) * | 2016-07-11 | 2016-09-21 | 江苏医诺万细胞诊疗有限公司 | Kit for detecting Rett syndrome pathogenic gene SNP loci based on next generation sequencing and detection method thereof |
| CN106995836A (en) * | 2016-01-22 | 2017-08-01 | 益善生物技术股份有限公司 | The primer and method and kit of sample pre-treatments was sequenced in two generations |
| CN107236788A (en) * | 2016-03-29 | 2017-10-10 | 杭州致远医学检验所有限公司 | A kind of Miseq sequence measurements for detecting helicobacter pylori gene and drug metabolism type |
| CN110168087A (en) * | 2017-04-27 | 2019-08-23 | 深圳华大基因股份有限公司 | DNA label and its application |
| CN114736967A (en) * | 2022-05-07 | 2022-07-12 | 北京大学肿瘤医院 | Markers and methods for predicting primary drug resistance of immune checkpoint inhibitor therapy |
| CN114736967B (en) * | 2022-05-07 | 2024-06-11 | 北京大学肿瘤医院 | Markers and methods for predicting primary drug resistance of immune checkpoint inhibitor therapy |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102203273A (en) * | 2008-09-09 | 2011-09-28 | 生命技术公司 | Methods of generating gene specific libraries |
| CN104131008A (en) * | 2014-07-24 | 2014-11-05 | 深圳华大基因医学有限公司 | DNA labels, PCR primers and application thereof |
-
2015
- 2015-07-01 CN CN201510382788.1A patent/CN104946639B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102203273A (en) * | 2008-09-09 | 2011-09-28 | 生命技术公司 | Methods of generating gene specific libraries |
| CN104131008A (en) * | 2014-07-24 | 2014-11-05 | 深圳华大基因医学有限公司 | DNA labels, PCR primers and application thereof |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105255865A (en) * | 2015-10-16 | 2016-01-20 | 苏州贝斯麦医疗仪器有限公司 | Fluorescent quantitative PCR (polymerase chain reaction) detection kit for TYMS (thymidylate synthase) gene expression quantity and application of kit |
| CN106995836A (en) * | 2016-01-22 | 2017-08-01 | 益善生物技术股份有限公司 | The primer and method and kit of sample pre-treatments was sequenced in two generations |
| CN107236788A (en) * | 2016-03-29 | 2017-10-10 | 杭州致远医学检验所有限公司 | A kind of Miseq sequence measurements for detecting helicobacter pylori gene and drug metabolism type |
| CN107236788B (en) * | 2016-03-29 | 2021-07-02 | 杭州致远医学检验所有限公司 | Miseq sequencing method for non-diagnosis purpose detection of helicobacter pylori gene and drug metabolism |
| CN105950774A (en) * | 2016-07-11 | 2016-09-21 | 江苏医诺万细胞诊疗有限公司 | Kit for detecting Rett syndrome pathogenic gene SNP loci based on next generation sequencing and detection method thereof |
| CN110168087A (en) * | 2017-04-27 | 2019-08-23 | 深圳华大基因股份有限公司 | DNA label and its application |
| CN110168087B (en) * | 2017-04-27 | 2023-11-14 | 深圳华大基因股份有限公司 | DNA tag and application thereof |
| CN114736967A (en) * | 2022-05-07 | 2022-07-12 | 北京大学肿瘤医院 | Markers and methods for predicting primary drug resistance of immune checkpoint inhibitor therapy |
| CN114736967B (en) * | 2022-05-07 | 2024-06-11 | 北京大学肿瘤医院 | Markers and methods for predicting primary drug resistance of immune checkpoint inhibitor therapy |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104946639B (en) | 2017-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110628880B (en) | Method for detecting gene variation by synchronously using messenger RNA and genome DNA template | |
| CN104946639A (en) | Primer, method and kit for constructing gene mutation sequencing library | |
| Berenstein | Class III receptor tyrosine kinases in acute leukemia–biological functions and modern laboratory analysis | |
| CN102586420B (en) | Method and kit for assaying breast cancer susceptibility genes | |
| WO2016181128A1 (en) | Methods, compositions, and kits for preparing sequencing library | |
| CN106757379B (en) | Lung cancer polygenic variation library constructing method | |
| US20220325357A1 (en) | Method and Apparatus for Multi-Omic Simultaneous Detection of Protein Expression, Single Nucleotide Variations, and Copy Number Variations in the Same Single Cells | |
| Bacher et al. | Mutational profiling in patients with MDS: ready for every-day use in the clinic? | |
| CN103571822B (en) | A kind of multipurpose DNA fragmentation enriching method analyzed for new-generation sequencing | |
| CN105524983A (en) | Marker based on high-throughput sequencing and method and kit for capturing one or multiple specific genes of multiple samples | |
| WO2018147438A1 (en) | Pcr primer set for hla gene, and sequencing method using same | |
| CN106520917A (en) | Gene large fragment deletion/duplication detection method | |
| US20240060134A1 (en) | Methods, systems and apparatus for copy number variations and single nucleotide variations simultaneously detected in single-cells | |
| CN105039322A (en) | DNA label sequence, sequencing library construction method and kit | |
| CN108103164A (en) | A kind of method that copy number variation is detected using multi-fluorescence competitive PCR | |
| Sastre | New DNA sequencing technologies open a promising era for cancer research and treatment | |
| CN111235281A (en) | Composite amplification kit for detecting transcription products of 18 human genes and application thereof | |
| CN107475392B (en) | Primer combination for detecting single-cell EGFR gene mutation and application thereof | |
| Peng et al. | Development and validation of an RNA sequencing assay for gene fusion detection in formalin-fixed, paraffin-embedded tumors | |
| CN107236727B (en) | Preparation method of single-stranded probe for polygene capture sequencing | |
| CN107988320A (en) | A kind of molecular label connector and its preparation method and application | |
| JP2022522221A (en) | Methods and systems for characterizing tumors and identifying tumor inhomogeneities | |
| KR102559124B1 (en) | Composition for amplifying FLT3 gene and Uses thereof | |
| TWI771847B (en) | Method of amplifying and determining target nucleotide sequence | |
| Kovach et al. | Next-generation sequencing for measurable residual Disease Assessment in Acute Leukemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230720 Address after: 510700, 8th floor, No. 29 Helix 3 Road, Guangzhou International Biological Island, Huangpu District, Guangzhou City, Guangdong Province Patentee after: GUANGZHOU SUREXAM MEDICAL LABORATORY Co.,Ltd. Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Patentee before: SUREXAM BIO-TECH Co.,Ltd. |
|
| TR01 | Transfer of patent right |