CN104940599A - Application of traditional Chinese medicine composition in preparation of medicines for improving lipid metabolism - Google Patents

Abstract

The invention discloses an application of a traditional Chinese medicine composition in preparation of medicines for improving lipid metabolism, and belongs to the field of traditional Chinese medicine applications. The traditional Chinese medicine composition is prepared from ginseng, rhizoma polygonati, rhizoma atractylodis, radix sophorae flavescentis, radix ophiopogonis, rehmannia, polygonum multiflorum, dogwood, poria cocos, herba eupatorii, coptis chinensis and rhizoma anemarrhenae. The traditional Chinese medicine composition disclosed by the invention is capable of improving the lipid metabolism of kidneys by inhibiting SREBP-1/ACC/FASN (sterol regulatory element binding protein-1/activated calcium carbonate/fatty acid synthetase).

Description

A kind of Chinese medicine composition is preparing the application improved in lipid metabolism medicine

Technical field

The invention belongs to the field of Chinese medicines, be specifically related to the purposes of Chinese medicine composition.

Background technology

Metabolism syndrome, is also insulin resistance syndrome, is the simultaneous a kind of pattern of multiple metabolic risk factors.So-called insulin resistant refers to that body is to insulin insensitivity, and the secretion in early days still by increasing insulin makes blood glucose remain normal, and late period is then because islet function exhaustion causes blood glucose to raise and occur various complication.

Along with raising and the living-pattern preservation of human living standard, the sickness rate of metabolism syndrome is in the trend increased year by year.The principal character of metabolism syndrome comprises obesity, insulin resistant, hypertension, dysbolism of blood fat, hyperglycemia etc., and wherein insulin resistant is as common pathologic basis, is the independent hazard factor of diabetes and chronic renal disease etc.Thought in the past, perhaps the multi-factor disease of metabolism syndrome, as nephropathy etc. only just can progressively produce after the generation diabetes several years, now is clear and definite, the diabetics of new diagnosis is partly with nephropathy, this points out us to want prevention of metabolic syndrome and various complication, just must intervene in advance insulin resistant.

Insulin resistant (insulin resistance, IR) belongs to the category such as " obesity ", " quenching one's thirst " in Chinese medicine, and total pathogenesis is dysfunction of the spleen in transportation.Dysfunction of the spleen in transportation can promote that pancreas is fallen ill, and makes insulin produce, secrete, utilize functional disorder, needs treatment through spleen." Tianjin is transported in spleen invigorating " Therapeutic Principle of Chinese medicine thinks, temper is good for the glucosylation spermatogenesis gas that fortune could will be taken in body, is distributed to whole body, glucose is fully utilized.It acts on and is reduce sugar merely, can also coordinate the function of each internal organs.Therefore strong activating the spleen gas can produce dual function: reduce blood glucose on the one hand, alleviate high sugared toxicity, improve insulin resistant; Improve each internal organs function on the other hand, slow down the decline of beta Cell of islet.Insulin resistant cause kidney disease mechanism mainly comprise hemodynamic responses, glucose-lipid metabolism disorder, oxidative stress, inflammatory factor and cytokine etc., wherein when body food intake and energy expenditure imbalance, when i. e. is taken in and is greater than energy expenditure, unnecessary fatty acid and glucose synthesize triacylglycerol at cell, and be stored in cell interior with the form that fat drips, just cell dysfunction or death is there is when exceeding its storage capacity, also be called Fatty toxicity (lipotoxicify), cause disorders of lipid metabolism thus.Disorders of lipid metabolism can inspire glomerular sclerosis and tubulointerstitial injury, thus increases the weight of the progress that the approach such as the oxidative stress of kidney cause kidney injury.

Fat acid endogenous building-up process refers to that S-acetyl-coenzyme-A generates free fatty (FFA) under acetyl-CoA carboxylase (ACC) and fatty acid synthetase (FAS) effect, the latter is as the catabolite of triglyceride (TG) and synthesis material, and its metabolism is the important component part of lipid metabolism process.When cell requirement increase or extracellular FFA excessive concentration time, FFA can enter cell by beta-oxidation produce power, also can be used for the biosynthesis of film or forms lipid signal molecule.Research finds, ACC and FAS plays an important role in lipid de novo synthesis, and this building-up process is by Sterol regulatory element binding protein.SREBPs belongs to helix-loop-helix-zinc-methionine and refers to nuclear factor family, and it is combined by the sterol regulatory element of the promoter/enhancer with lipid synthase gene, and activation target gene is transcribed, the metabolism of specific regulatory control fatty acid and cholesterol.SREBPs has 3 kinds of hypotypes: SREBP-1a, SREBP-1c and SREBP-2.The genetic transcription of the fatty acid synthase of SREBP-1a major regulatory cholesterol, promotes cholesterol and fatty acid synthesis; The gene of relevant enzyme in SREBP-1c selective regulation fatty acid, TG building-up process.The gene of SREBP-2 major regulatory cholesterol synthase, promotes cholesterol biosynthesis.

The method of current western medical treatment diabetes and complication thereof is a lot, but its action target spot is single, untoward reaction also often has generation.And China's TCM treatment of diabetes is paid attention to regulating on the whole, particularly the mechanism of action of its multipath, Mutiple Targets makes much Chinese medicine at blood sugar lowering and prevents and treats the advantage showing uniqueness in complication, and has no adverse reaction.

Summary of the invention

The object of the invention is to provide a kind of Chinese medicine composition and is improving the application in lipid metabolism medicine.

The technical solution adopted in the present invention is:

Chinese medicine composition is preparing the application that improves in the medicine of lipid metabolism, and this Chinese medicine composition is made up of the crude drug of following parts by weight: Radix Ginseng 50-150, Rhizoma Polygonati 60-180, Rhizoma Atractylodis 40-90, Radix Sophorae Flavescentis 30-58, Radix Ophiopogonis 60-180, Radix Rehmanniae 60-110, Radix Polygoni Multiflori 40-90, Fructus Corni 60-180, Poria 40-90, Herba Eupatorii 35-58, Rhizoma Coptidis 35-58, Rhizoma Anemarrhenae 35-90, Herba Epimedii 35-58, Radix Salviae Miltiorrhizae 40-110, Radix Puerariae 60-180, Semen Litchi 80-140, Cortex Lycii 40-90.

Preferably, this Chinese medicine composition is made up of the crude drug of following parts by weight:

Radix Ginseng 50, Rhizoma Polygonati 180, Rhizoma Atractylodis 40, Radix Sophorae Flavescentis 58, Radix Ophiopogonis 60, Radix Rehmanniae 110, Radix Polygoni Multiflori 40, Fructus Corni 180, Poria 40, Herba Eupatorii 35, Rhizoma Coptidis 58, the Rhizoma Anemarrhenae 90, Herba Epimedii 35, Radix Salviae Miltiorrhizae 40, Radix Puerariae 180, Semen Litchi 80, Cortex Lycii 40.

Or

Radix Ginseng 150, Rhizoma Polygonati 60, Rhizoma Atractylodis 90, Radix Sophorae Flavescentis 30, Radix Ophiopogonis 180, Radix Rehmanniae 60, Radix Polygoni Multiflori 90, Fructus Corni 60, Poria 90, Herba Eupatorii 58, Rhizoma Coptidis 35, the Rhizoma Anemarrhenae 35, Herba Epimedii 58, Radix Salviae Miltiorrhizae 110, Radix Puerariae 60, Semen Litchi 140, Cortex Lycii 90.

Or

Radix Ginseng 102, Rhizoma Polygonati 136, Rhizoma Atractylodis 68, Radix Sophorae Flavescentis 56, Poria 83, Radix Ophiopogonis 136, Radix Polygoni Multiflori 83, Radix Rehmanniae 102, Fructus Corni 136, Rhizoma Coptidis 56, Herba Eupatorii 56, Semen Litchi 136, Herba Epimedii 56, the Rhizoma Anemarrhenae 68, Radix Salviae Miltiorrhizae 89, Radix Puerariae 136, Cortex Lycii 83.

The active fraction preparation of this Chinese medicine composition is made up of following steps:

A, take Chinese crude drug according to crude drug part by weight, clean, cataclasm;

B, Herba Eupatorii, Rhizoma Atractylodis add 5-9 times amount water extraction volatile oil, extract 3-6 hour, and the another device of volatile oil is collected, and aqueous solution is for subsequent use after filtering;

C, Fructus Corni 5-9 times amount 50-90% ethanol make solvent, flood after 12-48 hour, carry out percolation, collect percolate, reclaim ethanol, and be condensed into 60 DEG C measure relative densities be the thick paste of 1.30-1.35, dry, for subsequent use;

D, Radix Ginseng, Radix Ophiopogonis, Herba Epimedii, the Rhizoma Anemarrhenae, Radix Puerariae, add 6-10 times amount 50-90% ethanol, reflux, extract, 1-3 time, each 1-3 hour, extracting liquid filtering, reclaims ethanol, be condensed into thick paste, dries, for subsequent use;

E, Rhizoma Polygonati, Radix Sophorae Flavescentis, Radix Rehmanniae, Radix Polygoni Multiflori, Poria, Rhizoma Coptidis, Radix Salviae Miltiorrhizae, Semen Litchi, Cortex Lycii, add 7-11 times of water gaging, decoct 1-2 time, each 1-3 hour, extracting liquid filtering, carries the aqueous solution after oil merge with Herba Eupatorii, Rhizoma Atractylodis in step b, be condensed into clear paste, adding ethanol regulates determining alcohol to be 50-80%, and cold preservation is placed, and filters, filtrate recycling ethanol, be concentrated into thick paste, dry, for subsequent use;

The active component that cream, the dry cream of step e gained water extract-alcohol precipitation and step b gained volatile oil form this Chinese medicine composition jointly promoted by the dry cream of step c gained Fructus Corni, steps d gained alcohol.

For realizing technique scheme, this Chinese medicine composition is made capsule, tablet or granule.

The preparation of this Chinese medicinal composition granules is made up of following steps:

A, take Chinese crude drug according to crude drug part by weight, clean, cataclasm;

B, Herba Eupatorii, Rhizoma Atractylodis merge, and add 5-9 times of water gaging, and vapour method extracts volatile oil, extract 3-6 hour, and the another device of volatile oil is collected, and aqueous solution is for subsequent use after filtering;

C, Fructus Corni 5-9 times amount 50-90% ethanol make solvent, flood after 12-48 hour, carry out percolation, collect percolate, reclaim ethanol, and be condensed into 60 DEG C measure relative densities be the thick paste of 1.30-1.35, dry, for subsequent use;

D, Radix Ginseng, Radix Ophiopogonis, Herba Epimedii, the Rhizoma Anemarrhenae, Radix Puerariae, add 6-10 times amount 50-90% ethanol, reflux, extract, 1-3 time, each 1-3 hour, extracting liquid filtering, reclaims ethanol, be condensed into thick paste, dries, for subsequent use;

E, Rhizoma Polygonati, Radix Sophorae Flavescentis, Radix Rehmanniae, Radix Polygoni Multiflori Preparata, Poria, Rhizoma Coptidis, Radix Salviae Miltiorrhizae, Semen Litchi, Cortex Lycii, add 7-11 times of water gaging, decoct 1-2 time, each 1-3 hour, extracting liquid filtering, carries the aqueous solution after oil merge with Herba Eupatorii, Rhizoma Atractylodis in step b, be condensed into clear paste, adding ethanol regulates determining alcohol to be 50-80%, and cold preservation is placed, and filters, filtrate recycling ethanol, be concentrated into thick paste, dry, for subsequent use;

F, by the dry cream of step c gained Fructus Corni, steps d gained alcohol promote cream, the dry cream mix homogeneously of step e gained water extract-alcohol precipitation, pulverize, add adjuvant granulate;

G, step b gained volatile oil add dissolve with ethanol, spray into the granule of step f gained, and mixing, airtight, subpackage, to obtain final product.

This Chinese medicine composition is suppressing the application in SREBP-1/ACC/FASN path medicine.

This Chinese medicine composition is reducing the application in T hypolipidemic medicine.

Radix Puerariae of the present invention comprises Radix Puerariae and Pachyrhizua angulatus, and the pharmacopeia of 2005 does not distinguish this two kinds of Chinese medicines, and the pharmacopeia of 2010 is distinguished, and Radix Puerariae derives from legume pueraria lobata, and Pachyrhizua angulatus derives from leguminous plant Radix Puerariae rattan, and the present invention is preferably Pachyrhizua angulatus.

For illustrating the effect of Chinese medicine composition of the present invention, carry out following test with medicine obtained in embodiment 1:

1 materials and methods

1.1 Animals Male SD rats (n=36), cleaning grade, 6 week age, (140 ± 20 g), is purchased from National Institute for Food and Drugs Control, Laboratory Animal Resource institute, the quality certification number: slxk (capital) 7009-0017.Keep ambient humidity (50% ~ 60%), temperature (20 ~ 25 DEG C), 12h/12h circadian (in the daytime 6:00 to 18:00), ad lib food and water.Cage for rearing poultry, bedding and padding, feedstuff, drinking-water are all prepared and sterilization by the requirement of SPF level laboratory animal.

1.2 medicines and reagent standard diet feedstuff and high fat diet feedstuff provide by Hebei Medical University's Experimental Animal Center.Medicine of the present invention (Hebei Yi Ling Pharmaceutical Group Co., Ltd); Pioglitazone (Shanghai Shi Guibao company limited of Sino-U.S.); Organize free fatty testing cassete (bio tech ltd is built up in Nanjing); Tissue triglycerides enzymic measuring reagent box (Puli's lema gene Technology Co., Ltd.); Organize T-CHOL enzymic measuring reagent box (Puli's lema gene Technology Co., Ltd.); RT-PCR Reverse Transcriptase kit (Beijing Quanshijin Biotechnology Co., Ltd); Pcr amplification test kit (Beijing health is century biological company limited); Little anti-rat β-actin polyclonal antibody (Santa Cruz company of the U.S.); Radix Cochleariae officinalis enzyme labelling goat anti-mouse IgG antibody (Kang Wei company); Radix Cochleariae officinalis enzyme labelling goat anti-rabbit IgG antibody (Kang Wei company); SREBP1 rabbit polyclonal antibody (Santa Cruz company of the U.S.); ACC1 rabbit monoclonal antibodies (Cell Signaling company of the U.S.); FAS rabbit monoclonal antibodies (Epitomics company of the U.S.); High sensitivity chemistry luminescence detection kit (Beijing CoWin Bioscience Co., Ltd.)

After 1.3 modelings and grouping 36 SD Rat Standard diet adaptabilities feed 1 week, get 6 at random and accept standard diet (heat ratio is: fat 10.3%, carbohydrate 65.5%, protein 24.2%) as Normal group.Remain 30 give high fat diet (heat ratio is: fat 59.8%, carbohydrate 20.1%, protein 20 .1%) 6 week be used for induced insulin resist model.After clamp experiment confirms modeling success, Normal group continues to give standard diet, and insulin resistant model rat is divided into 5 groups at random: high fat feeds insulin resistant group, the basic, normal, high dosage group of medicine of the present invention and pioglitazone group, often organizes 6.

1.4 medication Normal groups and hyperlipidemia model group give solvent 0.5% sodium carboxymethyl cellulose, the medicine of the present invention that the low middle high dose group of medicine of the present invention gives 0.75,1.5,3.0 g/kg is respectively dissolved in 0.5% sodium carboxymethyl cellulose, the pioglitazone that pioglitazone group gives 50mg/kg is dissolved in 0.5% sodium carboxymethyl cellulose, and every day 8 to 9 presses 10ml/kg gavage.Daily 1 time, continuous 8 weeks.

1.5 collection of specimens

1.5.1 body weight and average daily food intake dose: the food intake dose recording weekly an empty body weight and each cage, and the average daily food intake dose calculating every Mus.

1.5.2 serum specimen: Rat Fast whole night, under secondary morning fasted conditions, 3% pentobarbital (0.2ml/kg) intraperitoneal injection of anesthesia, puncture heart collects blood sample, and after low-temperature centrifugation, obtain serum-20 DEG C preservation, censorship blood biochemistry, detection blood FINS, FBG, HbA1c and free fatty acid.

1.5.3 nephridial tissue specimen: take out bilateral renal rapidly after getting blood, remove tunicle, be separated and cut part renal cortex (5mm × 5mm × 2mm) be placed in rapidly 4% paraformaldehyde fixedly give over to Hematoxylin-eosin (HE) dyeing; Separately cutting part renal cortex is put in rapidly in the normal saline polluted without RNA enzyme that 0.1%DEPC is water-treated, rinsing is dehematized stain, put into liquid nitrogen immediately freezing, proceed in the EP pipe without RNA enzyme more respectively,-70 DEG C of preservations, treat in the future for the detection of lipid content (FFA, TG, TC) test kit, RT-PCR and Western blot.

1.6 Serum Indexes measure

1.6.1 blood biochemistry index measures: U.S. Beckman X20 automatic clinical chemistry analyzer detects blood T-CHOL (Total cholesterol, TC), triglyceride (Triglycerides, TG), HDL-C (HDL-C), low-density lipoprotein cholesterol (LDL-C) and C-VLDL (VLDL-C) concentration.

1.6.2 FINS(Fasting insulin) measure: measured by enzyme-linked immunosorbent assay kit (Mercodia, USA).

1.6.3 FBG(blood glucose) measure: Roche Holding Ag ACCU CHEK blood glucose meter.

1.6.4 HbA1c(glycolated hemoglobin) measure: measured by enzyme-linked immunosorbent assay kit (Mercodia, USA).

1.6.5 blood FFA measures: measured by enzyme-linked immunosorbent assay kit (Mercodia, USA).

With 3% pentobarbital 0.2 ml/kg intraperitoneal injection of anesthesia after 1.7 positive glucose-hyperinsulinism clamp experiment rat weight, be fixed on the up right neck venous incubation art of operation bracket, conduit is through subcutaneous by drawing after ear and fixing, and with 100 U/ml heparin in sealing, skin after neck is fixed in ligation.3 ~ 5 d after intubation, treat that rat recovers body weight, after fasted overnight, in positive glucose clamp experiment of hyperinsulinism under row waking state in special mouse cage in morning next day.Measure blood glucose value based on fasting glucose, with 4 mU/(kgmin) fixed rate infusion of insulin injection, insulin level in rat body is raised rapidly.Then within every 10 minutes, a vein blood glucose is measured, infusion also adjusts the infusion rate of 30% glucose solution, maintain (5 ± 0.5) mmol/L scope for more than 3 times namely show to reach stable state when blood glucose is continuous, glucose average entry rate (ml/h) × concentration of glucose (30%) × 1000/ body weight (kg)/60 during evaluation index (the GIR(mg/kgmin)=stable state of the meansigma methods of getting 5 ~ 6 glucose infusion rate (glucose infusion rete, GIR) under this stable state as rat insulin sensitivity).

1.8 nephridial tissue om observations are placed in the fixing renal tissue of 4% paraformaldehyde, and through routine dehydration, embedding, section, dyeing, the form of kidney is observed in slice thick 4 um, HE dyeing.(HE staining cell core dyes blueness, and cytoplasm and erythrocyte dye redness in various degree)

The mensuration of 1.9 nephridial tissue FFA, TG, TC content detects according to corresponding reagent box description respectively.

The mensuration of 1.10 kidney lipid synthesis key enzymes and upstream regulatory factor gene expression

Get-70 DEG C of freezing nephridial tissues, extract total serum IgE according to Trizol one-step method.Reverse transcription generates cDNA, and reaction condition is: 25 DEG C of 10 min, 42 DEG C of 30 min, 85 DEG C of 5 min.Primer sequence uses DNAMAN software design, is synthesized by Shanghai biological engineering company limited.Rat SREBP-1 primer sequence (152bp), forward primer: AGGTCACCGTTTCTTCGTG, downstream primer: CGATACAGTTCAATGCTCGC; FAS primer sequence (167bp), forward primer: TGACCAAGGTGCTGTTATCC, downstream primer: TCCGAAGCCAAACGAGTT; ACC primer sequence (135bp), forward primer: CGTGGTGATAATGAACGGC, downstream primer: AACTGCTGCCATCGTAGGAC; Internal reference GAPDH primer sequence (120bp), forward primer: TGAACGGGAAGCTCACTGG, downstream primer: GCTTCACCACCTTCTTGATGTC.Amplified reaction parameter is: 94 DEG C of denaturation 5 min, 94 DEG C of degeneration 30 s, 58 DEG C of annealing 30 s, and 72 DEG C extend 30 s, carry out 30 circulations, and last 72 DEG C extend 10 min.Enter the software results assay surface of ABI 7300 type quantitative fluorescent PCR instrument after amplification, arranging GAPDH is reference gene, obtains the Ct value of each sample, each gene amplification.According to RQ=2 ^{-△ △ Ct} formula obtains the relative quantification value (RQ value) of each genes of interest expression in each sample, and RQ value is used for statistical analysis.

The mensuration of 1.11 kidney lipid synthesis key enzymes and upstream regulatory factor protein expression

Get-70 DEG C of frozen lipid peroxicitions through PBS rinsing, extract total protein with Tissue lysates; BCA method is got equal protein and is carried out polyacrylamide agarose gel electrophoresis (SDS-PAGE), moved to by protein transduction on nitrocellulose filter (PVDF) after measuring protein content; Little mouse-anti β-actin antibody (1:5000), rabbit anti-SREBP1 antibody (1:200), rabbit anti-ACC antibody (1:1000), rabbit anti-FAS antibody (1:1000) room temperature jog 30 min is added, 4 after closing 2 h with the TBST containing 5% skim milk ^.c overnight incubation; Goat anti-mouse or the goat anti-rabbit igg (1:10000) of horseradish peroxidase-labeled is used respectively, incubated at room 2 h after TBST rinsing; Add ECL reagent after TBST rinsing, carry out pvdf membrane is put into magazine in darkroom after tabletting, development and fixing; Film after fixing U.S. UVP gel imaging system is taken a picture, and LabWorks 4. 5 image analysis software carries out quantitative analysis to band, using the relative level that object band and β-actin band integral optical density value ratio are expressed as destination protein.

1.12 statistical analysis application SPSS13.0 statistical softwares carry out data analysis, and measurement data represents with x ± s, compare and adopt one factor analysis of variance (ANOVA) between many groups, and P < 0.05 has statistical significance for difference.

2 results

2.1 medicines of the present invention on the impact of body weight and average daily food ration compared with Normal group, the body weight of hyperlipidemia model group and average daily food ration occurred obvious rising ( p< 0.05).After giving medicine of the present invention and pioglitazone body weight obviously lower ( p< 0.05), compared with Normal group, difference also have statistical significance ( p< 0.05), though and average daily food ration slightly reduce no significant difference ( p> 0.05) (table 1).

* p< 0.05 versus hyperlipidemia model group, #p<0.05 versus matched group.

2.2 impacts of medicine of the present invention on blood FINS, FBG and HbA1c are compared with Normal group, the FINS of hyperlipidemia model group obviously increases (P < 0.05), after giving medicine of the present invention and pioglitazone, its level significantly declines (P < 0.05), compared with Normal group, no significant difference (P > 0.05).FBG and the HbA1c of hyperlipidemia model group is apparently higher than Normal group (P < 0.05), after giving medicine of the present invention, FBG and HbA1c level obviously declines (P < 0.05), compare with Normal group, difference also has statistical significance (P < 0.05).Give pioglitazone and all obviously reduce FBG and HbA1c(P < 0.05), compared with Normal group, no significant difference (P > 0.05) (table 1).

2.3 medicines of the present invention affect the impact of medicine of the present invention on Lipid to Lipid: compare with Normal group, TG and the VLDL-C of hyperlipidemia model obviously raises (P < 0.05), HDL-C obviously declines (P < 0.05), and significant change (P > 0.05) does not appear in TC, LDL-C.After giving medicine of the present invention and Mellitus Model With Pioglitazone, TG obviously declines (P < 0.05), and compared with Normal group, difference has statistical significance (P < 0.05); Obviously declining appears in VLDL-C, compared with Normal group, low dosage medicine of the present invention group and the equal no difference of science of statistics of pioglitazone group (P > 0.05), middle and high dosage medicine group of the present invention all has significant difference (P < 0.05); Give with medicine of the present invention after TC there is obvious decline (P < 0.05), compared with Normal group, low, middle dosage medicine group of the present invention has significant difference (P < 0.05), high dose medicine group of the present invention no difference of science of statistics (P > 0.05), and after giving pioglitazone there is not obvious change (P > 0.05) in TC content; After giving low, middle dosage medicine of the present invention, LDL-C obviously declines (P < 0.05), compared with Normal group, and no significant difference (P > 0.05); After giving medicine of the present invention and pioglitazone, there is not significant change (P > 0.05) (table 2) in HDL-C.

* p< 0.05 versus hyperlipidemia model group, #p<0.05 versus matched group.

TC: T-CHOL, TG: triglyceride, HDL-C: HDL-C,

LDL-C: low-density lipoprotein cholesterol, VLDL-C: C-VLDL, FFA: free fatty.

2.4 Medication on Glucose infusion rate of the present invention affect Hyperinsulin euglycemic clamp display, the glucose infusion rate of high fat diet group obviously declines ( p< 0.05), after giving medicine of the present invention and Mellitus Model With Pioglitazone, can obviously improve this situation, difference have statistical significance ( p< 0.05).And the two is improving effect suitable (Fig. 1) in insulin resistant.

2.5 medicines of the present invention observe display on the nephridial tissue section that affects that nephridial tissue HE dyes under HE dyes high power lens (× 400), normal group glomerule and renal tubules are showed no obvious abnormalities, hyperlipidemia model group group glomerular volume obviously increases, cell number increases, renal cells swelling, mesangial region is broadening, mesangial cell and endotheli ocytosis.The above-mentioned exception of medicine of the present invention basic, normal, high dosage group and pioglitazone group is obviously improved, comprise that glomerule increases, cell number increases, the broadening and mesangial cell in renal cells swelling, glomerular mesangium district and endotheli ocytosis degree obviously alleviate, but do not return to normal condition (Fig. 2-7) yet.

2.6 medicines of the present invention on the impact of nephridial tissue FFA, TG, TC content compared with Normal group, hyperlipidemia model group FFA, TG occurred obvious rising ( p< 0.05), significantly reduce after giving medicine of the present invention and pioglitazone FFA content ( p< 0.05), compared with Normal group, no significant difference ( p> 0.05); After giving medicine of the present invention and pioglitazone TG content obviously decline ( p< 0.05), compared with Normal group, low, middle dosage medicine group of the present invention and pioglitazone group difference have statistical significance ( p< 0.05), high dose medicine group of the present invention no significant difference ( p> 0.05).And the TC of hyperlipidemia model group is compared with Normal group, do not occur significant change ( p> 0.05), and also occurred after giving medicine of the present invention and pioglitazone obvious reduction ( p< 0.05) (Fig. 8-10).

2.7 medicines of the present invention on the impact of lipid synthesis key enzyme and upstream regulatory factor compared with Normal group, the gene expression dose of hyperlipidemia model group SREBP-1, ACC, FASN obviously raises ( p< 0.05), all obviously reduce after giving medicine of the present invention and pioglitazone ( p< 0.05), compared with Normal group, no significant difference ( p< 0.05) (Figure 11).The protein expression level of related keyword enzyme and upstream regulatory factor is consistent with gene (Figure 12).

The scope that the scope of the ratio of each taste medicine of Chinese medicine composition of the present invention is through great many of experiments and preferably draws, if the selection of each taste medicine of pharmaceutical composition is outside this scope, so its effect can weaken greatly.

Use high lipid food (fat 59.8%, carbohydrate 20.1%, protein 20.1%) feed 6 weeks, there is body weight, often per day showed increased of ingesting in hyperlipidemia model group, reason is that the palatability of food source property fat and energy density all can cause hyperphagia, and the signal of being satiated with food caused after reducing high fat diet.Concrete mechanism reduces with npy gene because saturated fat causes blood leptin and POMC gene to increase.Weight loss after giving medicine of the present invention and pioglitazone and ingesting obviously does not reduce, this illustrate both do not reach slimming effect by reducing appetite.

Adopt model group after high fat diet to occur that hyperinsulinemia, hyperglycemia, HbA1c raise, and positive glucose hyperinsulinism clamp experiment show glucose infusion rate obviously reduce ( p< 0.05), these all point out modeling success.This may be because free fatty in body and triglyceride raise, thus Insulin receptor INSR horizontal down-regulation, the affinity reduction etc. of insulin and receptor.This modeling method convenience, economy, survival rate are high, one-tenth mould rate is high, model stability, and adopt this kind of method, this experiment modeling success rate reaches 90%.At the end of experiment, after using medicine of the present invention and pioglitazone intervention, FINS, FBG and HbA1c all obviously decline, positive glucose hyperinsulinism clamp experiment display glucose infusion rate obviously raises ( p< 0.05), and pioglitazone effect in reduction FBG and HbA1c is horizontal is more remarkable.This illustrates that medicine of the present invention can improve body insulin resistant, reduces blood glucose, but not as pioglitazone in hypoglycemic effect.

There is obvious kidney damage in pathological section HE dyeing display high fat diet group; comprise glomerular volume obviously to increase; cell number increases; renal cells swelling; mesangial region is broadening, mesangial cell and endotheli ocytosis, and after giving medicine of the present invention and pioglitazone, above-mentioned exception is obviously improved; absolutely prove that high fat diet causes insulin resistance rat to occur kidney damage, and medicine of the present invention and pioglitazone has obvious protection renal.

Blood TG, VLDL-C that this experimental result shows hyperlipidemia model group obviously raise ( p< 0.05), HDL-C obviously declines ( p< 0.05), reduce TG, VLDL-C(in varying degrees after giving medicine of the present invention and pioglitazone p< 0.05), and HDL-C without obviously changing ( p> 0.05).TC, LDL-C of hyperlipidemia model group compared with Normal group without significant change ( p> 0.05), but give medicine of the present invention reach rear TC, LDL-C obviously decline ( p< 0.05), and give pioglitazone the latter two all do not occur obvious change ( p> 0.05).This prompting medicine of the present invention is better than pioglitazone in lipid-lowering effect.In addition, hyperlipidemia model group kidney FFA and TG content apparently higher than Normal group ( p< 0.05), TC no significant difference ( p> 0.05), all obviously can reduce the content of FFA, TG and TC after giving medicine of the present invention and pioglitazone, and effect of drugs of the present invention is better than pioglitazone.

SREBP-1, ACC, FASN gene and protein expression of this experimental result display hyperlipidemia model group obviously raises ( p< 0.05), obviously reduce after giving medicine of the present invention and pioglitazone ( p< 0.05).This shows that medicine of the present invention improves lipometabolic agency part and realizes by regulating SREBP/ACC/FAS path.

In sum, kidney disorders of lipid metabolism during insulin resistant can affect matrix reconstruction in the hemodynamics of kidney, signal transduction system and kidney, participates in developing of chronic renal disease.Medicine of the present invention can improve kidney lipid metabolism by suppressing SREBP-1/ACC/FASN.Medicine of the present invention has potential Renoprotective Effect, thus the chronic renal disease of being correlated with for effectively preventing and treating disorders of lipid metabolism provides novel targets.

Accompanying drawing explanation

Fig. 1 is the comparison diagram that medicine of the present invention and pioglitazone are tested at euglycemic hyperinsulinemic pliers folder, in figure, GIR is glucose infusion rate, * p< 0.05 versus hyperlipidemia model group, #p<0.05 versus matched group;

Fig. 2 is the section of matched group nephridial tissue;

Fig. 3 is the section of hyperlipidemia model group nephridial tissue;

Fig. 4 is medicine low dose group nephridial tissue of the present invention section;

Fig. 5 is dosage group nephridial tissue section in medicine of the present invention;

Fig. 6 is medicine high dose group nephridial tissue of the present invention section;

Fig. 7 is the section of pioglitazone group nephridial tissue;

Fig. 8 is the content of each group of FFA, * p< 0.05 versus hyperlipidemia model group, #p<0.05 versus matched group;

Fig. 9 is the content of each group of TG, * p< 0.05 versus hyperlipidemia model group, #p<0.05 versus matched group;

Figure 10 is the content of TC, * p< 0.05 versus hyperlipidemia model group, #p<0.05 versus matched group;

Figure 11 is each group of Gene Expression to SREBP-1, ACC, FASN, * p< 0.05 versus hyperlipidemia model group, #p<0.05 versus matched group;

Figure 12 is that each group of protein expression on SREBP-1, ACC, FASN affects, * p< 0.05 versus hyperlipidemia model group, #p<0.05 versus matched group.

Detailed description of the invention

Below in conjunction with detailed description of the invention, the present invention is described in further details:

Embodiment 1

The proportioning of this Chinese medicine composition is as follows:

Radix Ginseng 102 g, Rhizoma Polygonati 136 g, parched with bran Rhizoma Atractylodis 68 g, Radix Sophorae Flavescentis 56 g, Poria 83 g, Radix Ophiopogonis 136 g, Radix Polygoni Multiflori Preparata 83 g, Radix Rehmanniae 102 g, Fructus Corni 136 g, Rhizoma Coptidis 56 g, Herba Eupatorii 56 g, Semen Litchi 136 g, Herba Epimedii Preparata 56 g, the Rhizoma Anemarrhenae 68 g, Radix Salviae Miltiorrhizae 89 g, Radix Puerariae 136 g, Cortex Lycii 83 g.

The preparation process of this Chinese medicinal composition granules is:

A, take Chinese crude drug according to recipe quantity, clean, cataclasm;

B, Herba Eupatorii, Rhizoma Atractylodis add 6 times of water gagings, extract volatile oil, and carrying the oil time is 5 hours, and the another device of volatile oil is collected, and aqueous solution is for subsequent use after filtering, and residue discards;

C, Fructus Corni after 24 hours, carry out percolation by 7 times amount 75% alcohol dipping, collect percolate, reclaim ethanol, and be condensed into 60 DEG C measure relative densities be the thick paste of 1.30,70 DEG C of oven dry, for subsequent use;

D, Radix Ginseng, Radix Ophiopogonis, Herba Epimedii, the Rhizoma Anemarrhenae, Radix Puerariae, add 8 times amount 70% ethanol, reflux, extract, 3 times, each 2 hours.Extracting liquid filtering, reclaims ethanol, and being concentrated into 60 DEG C of mensuration relative densities is the thick paste of 1.30, and 65 DEG C of oven dry are for subsequent use;

E, Rhizoma Polygonati, Radix Sophorae Flavescentis, Radix Rehmanniae, Radix Polygoni Multiflori, Poria, Rhizoma Coptidis, Radix Salviae Miltiorrhizae, Semen Litchi, Cortex Lycii, add 9 times of water gagings, decocts 2 times, each 2 hours, extracting liquid filtering, carried the aqueous solution after oil with Herba Eupatorii, Rhizoma Atractylodis and merges, measuring relative density when being concentrated into 60 DEG C is the clear paste of 1.15, adding 95% ethanol conciliation determining alcohol is 60%, and cold preservation places 24 hours, filters, filtrate recycling ethanol, and to measure relative density when being concentrated into 60 DEG C be the thick paste of 1.30,70 DEG C of oven dry, for subsequent use;

F, by the dry cream of step c gained Fructus Corni, steps d gained alcohol promote cream, the dry cream mix homogeneously of step e gained water extract-alcohol precipitation, pulverize;

G, step f gained dried cream powder to be mixed homogeneously by 4:5:1 with lactose powder, dextrin, be adhesive with 60% ethanol, soft material processed, 14 eye mesh screen granules, 60 DEG C of oven dry, 12-60 eye mesh screen granulate, sift out part fine powder, spray into step b gained volatile oil, mixing, airtight half an hour, obtain 556 grams of granules.

Embodiment 2

Crude drug formula is:

Radix Ginseng 50 g, Rhizoma Polygonati 180 g, Rhizoma Atractylodis 40 g, Radix Sophorae Flavescentis 58 g, Poria 40 g, Radix Ophiopogonis 180 g, Radix Polygoni Multiflori 40 g, Radix Rehmanniae 110 g, Fructus Corni 60 g, Rhizoma Coptidis 58 g, Herba Eupatorii 35 g, Semen Litchi 140 g, Herba Epimedii 35 g, the Rhizoma Anemarrhenae 90 g, Radix Salviae Miltiorrhizae 40 g, Radix Puerariae 180 g, Cortex Lycii 40 g.

Preparation method is:

A, take Chinese crude drug by recipe quantity, clean, cataclasm;

B, Herba Eupatorii, Rhizoma Atractylodis add 5 times of water gagings, extract volatile oil, and carrying the oil time is 3 hours, and the another device of volatile oil is collected, and aqueous solution is for subsequent use after filtering, and residue discards;

C, Fructus Corni after 12 hours, carry out percolation by 5 times amount 50% alcohol dipping, collect percolate, reclaim ethanol, and be condensed into 60 DEG C measure relative densities be the thick paste of 1.30,65 DEG C of oven dry, for subsequent use;

D, Radix Ginseng, Radix Ophiopogonis, Herba Epimedii, the Rhizoma Anemarrhenae, Radix Puerariae, add 6 times amount 5% ethanol, reflux, extract, 2 times, each 1 hour.Extracting liquid filtering, reclaims ethanol, and being concentrated into 60 DEG C of mensuration relative densities is the thick paste of 1.30, and 65 DEG C of oven dry are for subsequent use;

E, Rhizoma Polygonati, Radix Sophorae Flavescentis, Radix Rehmanniae, Radix Polygoni Multiflori, Poria, Rhizoma Coptidis, Radix Salviae Miltiorrhizae, Semen Litchi, Cortex Lycii, add 7 times of water gagings, decocts 1 hour, extracting liquid filtering, carry the aqueous solution after oil with Herba Eupatorii, Rhizoma Atractylodis to merge, measuring relative density when being concentrated into 60 DEG C is the clear paste of 1.10, and adding 95% ethanol conciliation determining alcohol is 50%, cold preservation places 24 hours, filter, filtrate recycling ethanol, and to measure relative density when being concentrated into 60 DEG C be the thick paste of 1.30,65 DEG C of oven dry, for subsequent use;

F, by the dry cream of step c gained Fructus Corni, steps d gained alcohol promote cream, the dry cream mix homogeneously of step e gained water extract-alcohol precipitation, pulverize, make granule;

G, step b gained volatile oil is added dissolve with ethanol, spray into step f gained granule, formulation method is made tablet and be get final product routinely.

Embodiment 3:

Crude drug formula is:

Radix Ginseng 150 g, Rhizoma Polygonati 60 g, Rhizoma Atractylodis 90 g, Radix Sophorae Flavescentis 30 g, Poria 90 g, Radix Ophiopogonis 60 g, Radix Polygoni Multiflori 90 g, Radix Rehmanniae 60 g, Fructus Corni 180 g, Rhizoma Coptidis 30 g, Herba Eupatorii 58 g, Semen Litchi 80 g, Herba Epimedii 58 g, the Rhizoma Anemarrhenae 35 g, Radix Salviae Miltiorrhizae 110 g, Radix Puerariae 56 g, Cortex Lycii 90 g.

Preparation method is:

A, take Chinese crude drug by recipe quantity, clean, cataclasm;

B, Herba Eupatorii, Rhizoma Atractylodis add 9 times of water gagings, extract volatile oil, and carrying the oil time is 6 hours, and the another device of volatile oil is collected, and aqueous solution is for subsequent use after filtering, and residue discards;

C, Fructus Corni after 48 hours, carry out percolation by 9 times amount 90% alcohol dipping, collect percolate, reclaim ethanol, and be condensed into 60 DEG C measure relative densities be the thick paste of 1.35,70 DEG C of oven dry, for subsequent use;

D, Radix Ginseng, Radix Ophiopogonis, Herba Epimedii, the Rhizoma Anemarrhenae, Radix Puerariae, add 10 times amount 90% ethanol, reflux, extract, 3 times, each 3 hours.Extracting liquid filtering, reclaims ethanol, and being concentrated into 60 DEG C of mensuration relative densities is the thick paste of 1.35, and 70 DEG C of oven dry are for subsequent use;

E, Rhizoma Polygonati, Radix Sophorae Flavescentis, Radix Rehmanniae, Radix Polygoni Multiflori, Poria, Rhizoma Coptidis, Radix Salviae Miltiorrhizae, Semen Litchi, Cortex Lycii, add 11 times of water gagings, decocts 2 times, each 3 hours, extracting liquid filtering, carried the aqueous solution after oil with Herba Eupatorii, Rhizoma Atractylodis and merges, measuring relative density when being concentrated into 60 DEG C is the clear paste of 1.15, and adding 95% ethanol conciliation determining alcohol is 80%, and cold preservation places 24 hours, filter, filtrate recycling ethanol, and to measure relative density when being concentrated into 60 DEG C be the thick paste of 1.35,70 DEG C of oven dry, pulverize, for subsequent use;

F, step b gained volatile oil is added dissolve with ethanol, spray in step e gained dried cream powder, formulation method is made capsule and be get final product routinely.

Claims (9)

1. Chinese medicine composition is preparing the application that improves in the medicine of lipid metabolism, it is characterized in that this Chinese medicine composition is made up of the crude drug of following parts by weight: Radix Ginseng 50-150, Rhizoma Polygonati 60-180, Rhizoma Atractylodis 40-90, Radix Sophorae Flavescentis 30-58, Radix Ophiopogonis 60-180, Radix Rehmanniae 60-110, Radix Polygoni Multiflori 40-90, Fructus Corni 60-180, Poria 40-90, Herba Eupatorii 35-58, Rhizoma Coptidis 35-58, Rhizoma Anemarrhenae 35-90, Herba Epimedii 35-58, Radix Salviae Miltiorrhizae 40-110, Radix Puerariae 60-180, Semen Litchi 80-140, Cortex Lycii 40-90.

2. application according to claim 1, is characterized in that this Chinese medicine composition is made up of the crude drug of following parts by weight:

Radix Ginseng 50, Rhizoma Polygonati 180, Rhizoma Atractylodis 40, Radix Sophorae Flavescentis 58, Radix Ophiopogonis 60, Radix Rehmanniae 110, Radix Polygoni Multiflori 40, Fructus Corni 180, Poria 40, Herba Eupatorii 35, Rhizoma Coptidis 58, the Rhizoma Anemarrhenae 90, Herba Epimedii 35, Radix Salviae Miltiorrhizae 40, Radix Puerariae 180, Semen Litchi 80, Cortex Lycii 40.

3. application according to claim 1, is characterized in that this Chinese medicine composition is made up of the crude drug of following parts by weight:

Radix Ginseng 150, Rhizoma Polygonati 60, Rhizoma Atractylodis 90, Radix Sophorae Flavescentis 30, Radix Ophiopogonis 180, Radix Rehmanniae 60, Radix Polygoni Multiflori 90, Fructus Corni 60, Poria 90, Herba Eupatorii 58, Rhizoma Coptidis 35, the Rhizoma Anemarrhenae 35, Herba Epimedii 58, Radix Salviae Miltiorrhizae 110, Radix Puerariae 60, Semen Litchi 140, Cortex Lycii 90.

4. application according to claim 1, is characterized in that this Chinese medicine composition is made up of the crude drug of following parts by weight:

Radix Ginseng 102, Rhizoma Polygonati 136, Rhizoma Atractylodis 68, Radix Sophorae Flavescentis 56, Poria 83, Radix Ophiopogonis 136, Radix Polygoni Multiflori 83, Radix Rehmanniae 102, Fructus Corni 136, Rhizoma Coptidis 56, Herba Eupatorii 56, Semen Litchi 136, Herba Epimedii 56, the Rhizoma Anemarrhenae 68, Radix Salviae Miltiorrhizae 89, Radix Puerariae 136, Cortex Lycii 83.

5. the application according to any one of claim 1-4, is characterized in that the active fraction preparation of this Chinese medicine composition is made up of following steps:

A, take Chinese crude drug according to crude drug part by weight, clean, cataclasm;

B, Herba Eupatorii, Rhizoma Atractylodis add 5-9 times amount water extraction volatile oil, extract 3-6 hour, and the another device of volatile oil is collected, and aqueous solution is for subsequent use after filtering;

C, Fructus Corni 5-9 times amount 50-90% ethanol make solvent, flood after 12-48 hour, carry out percolation, collect percolate, reclaim ethanol, and be condensed into 60 DEG C measure relative densities be the thick paste of 1.30-1.35, dry, for subsequent use;

D, Radix Ginseng, Radix Ophiopogonis, Herba Epimedii, the Rhizoma Anemarrhenae, Radix Puerariae, add 6-10 times amount 50-90% ethanol, reflux, extract, 1-3 time, each 1-3 hour, extracting liquid filtering, reclaims ethanol, be condensed into thick paste, dries, for subsequent use;

E, Rhizoma Polygonati, Radix Sophorae Flavescentis, Radix Rehmanniae, Radix Polygoni Multiflori, Poria, Rhizoma Coptidis, Radix Salviae Miltiorrhizae, Semen Litchi, Cortex Lycii, add 7-11 times of water gaging, decoct 1-2 time, each 1-3 hour, extracting liquid filtering, carries the aqueous solution after oil merge with Herba Eupatorii, Rhizoma Atractylodis in step b, be condensed into clear paste, adding ethanol regulates determining alcohol to be 50-80%, and cold preservation is placed, and filters, filtrate recycling ethanol, be concentrated into thick paste, dry, for subsequent use;

The active component that cream, the dry cream of step e gained water extract-alcohol precipitation and step b gained volatile oil form this Chinese medicine composition jointly promoted by the dry cream of step c gained Fructus Corni, steps d gained alcohol.

6. the application according to any one of claim 1-4, is characterized in that the preparation formulation of this Chinese medicine composition is capsule, tablet or granule.

7. application according to claim 6, is characterized in that the preparation of this Chinese medicinal composition granules is made up of following steps:

A, take Chinese crude drug according to crude drug part by weight, clean, cataclasm;

B, Herba Eupatorii, Rhizoma Atractylodis merge, and add 5-9 times of water gaging, and vapour method extracts volatile oil, extract 3-6 hour, and the another device of volatile oil is collected, and aqueous solution is for subsequent use after filtering;

C, Fructus Corni 5-9 times amount 50-90% ethanol make solvent, flood after 12-48 hour, carry out percolation, collect percolate, reclaim ethanol, and be condensed into 60 DEG C measure relative densities be the thick paste of 1.30-1.35, dry, for subsequent use;

D, Radix Ginseng, Radix Ophiopogonis, Herba Epimedii, the Rhizoma Anemarrhenae, Radix Puerariae, add 6-10 times amount 50-90% ethanol, reflux, extract, 1-3 time, each 1-3 hour, extracting liquid filtering, reclaims ethanol, be condensed into thick paste, dries, for subsequent use;

E, Rhizoma Polygonati, Radix Sophorae Flavescentis, Radix Rehmanniae, Radix Polygoni Multiflori Preparata, Poria, Rhizoma Coptidis, Radix Salviae Miltiorrhizae, Semen Litchi, Cortex Lycii, add 7-11 times of water gaging, decoct 1-2 time, each 1-3 hour, extracting liquid filtering, carries the aqueous solution after oil merge with Herba Eupatorii, Rhizoma Atractylodis in step b, be condensed into clear paste, adding ethanol regulates determining alcohol to be 50-80%, and cold preservation is placed, and filters, filtrate recycling ethanol, be concentrated into thick paste, dry, for subsequent use;

F, by the dry cream of step c gained Fructus Corni, steps d gained alcohol promote cream, the dry cream mix homogeneously of step e gained water extract-alcohol precipitation, pulverize, add adjuvant granulate;

G, step b gained volatile oil add dissolve with ethanol, spray into the granule of step f gained, and mixing, airtight, subpackage, to obtain final product.

8. the application according to any one of claim 1-4, is characterized in that this Chinese medicine composition is suppressing the application in SREBP-1/ACC/FASN path medicine.

9. the application according to any one of claim 1-4, is characterized in that this Chinese medicine composition is reducing the application in hypolipidemic medicine.