CN104928372A - Heterodera filipjevi Taqman MGB probe real-time quantitative PCR detection method and application thereof - Google Patents
Heterodera filipjevi Taqman MGB probe real-time quantitative PCR detection method and application thereof Download PDFInfo
- Publication number
- CN104928372A CN104928372A CN201510295749.8A CN201510295749A CN104928372A CN 104928372 A CN104928372 A CN 104928372A CN 201510295749 A CN201510295749 A CN 201510295749A CN 104928372 A CN104928372 A CN 104928372A
- Authority
- CN
- China
- Prior art keywords
- probe
- philips
- cyst
- qhf
- cyst roundworm
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a heterodera filipjevi Taqman MGB probe real-time quantitative PCR detection method and application thereof, belongs to the technical field of plant nematode molecular detection, and discloses a specific fluorescence probe HF-probe and a group of specific primers qHF-R and qHF-F, which are designed on the basis of a heterodera filipjevi RAPD specific sequence. The probe and the primers can be amplified in heterodera filipjevi to obtain specific fluorescence curves, so that the quick molecular detection of heterodera filipjevi is achieved. The detection method has high sensitivity and strong specificity, is fast and accurate, and has high practical applied values in the aspects of early diagnosis and field monitoring and early warning of heterodera filipjevi.
Description
Technical field
The invention belongs to Plant nematode field of molecular detection, relate to Philips's cyst roundworm rapid molecular detection method and application thereof.
Background technology
Wheat cyst roundworm (cereal cyst nematode, CCN) is the cereal crop important pathogen nematode of distribution in worldwide.This nematode is from 1874 since Germany is found, and in the whole world, all there is occurrence and harm in more than 40 country at present, and wherein the Cereal Cyst Nematode in the area such as China, Australia, Europe, India, the Middle East endangers serious and is subject to huge financial loss.Wheat cyst roundworm group (Heterodera avenae group) comprises 12 kinds of cyst roundworms altogether, wherein serious with the harm of cereal cyst nematode (H.avenae), Philips's cyst roundworm (H.filipjevi) and wide vaginal orifice cyst roundworm (H.latipons).
In China, cereal cyst nematode was from [Chen Pinsan since Late Cambrian in the short yellow wheat strain in Tianmen county, Hubei in 1989, Wang Mingzu, Peng get Liang. China's wheat cearal cyst nematode (Heterodera avenae wollenweber) identification research [J]. Plant Pathology, 1992,22 (4): 339-343], all have distribution at 16 provinces, municipalities and autonomous regions such as Hebei, Henan, Beijing, Shanxi, the Inner Mongol, Qinghai, Hubei, Anhui of China's wheat main producing region at present, hazard area reaches 4,000,000 hm
2above, and have the gesture spread gradually, become at present harm China wheat crops important pathogen nematode (Peng Deliang etc., the kainogenesis Distribution Area of China's wheat cyst roundworm. Chinese nematology research volume Two, 2008,2:344-345; Huang Wenkun, Ye Wenxing, Wang Gaofeng, Longhai City's ripple, Ou Shiqi, Peng Deliang, the occurrence and distribution of Ningxia, China cereal cyst nematode. Hua Zhong Agriculture University's journal, 2011,30 (1): 74-77).According to investigations; general sick field can underproduction 20%-40%; the underproduction of serious plot reaches more than 70% [Peng Deliang; Zhang Dongsheng; Qi Shuhua, Chen Pin are third-class, China's wheat cyst roundworm (Heterodera avenae) occurrence and distribution region and prevent and treat preliminary study. plant protection progress; 1995, p53-56. China Science Tech Publishing House].
Philips's cyst roundworm in 1981 to be in the news (Madzhidov in Tajikistan at first, A.R.1981.Bidera filipjevin.sp. (Heteroderina:Tylenchida) in Tadzhikistan.Izv.Akad.Nauk Tadzh.SSR Otd.Biol.Nauk2:40-44), at present in Europe, Asia, all there is distribution (Smiley North America, R.W., Yan, G.P., and Handoo, Z.A.2008.First Record of the Cyst Nematode Heterodera filipjevi on Wheat in Oregon.PlantDisease 92 (7): 1136, Holgado, R., Andersson, S., Rowe, J.A., and Magnusson, C.2004First recordof Heterodera filipjevi in Norway.Nematologia Mediterranea 32 (2): 205-211, ).Peng Deliang etc. (2010) find Philips's cyst roundworm harm (Peng at first in Tangyin, China Henan, D.L., Ye, W.X., Peng, H., and Gu, X.C.2010.First Report of the Cyst Nematode (Heterodera filipjevi) on Wheat in Henan Province, China.Plant Disease 94 (10): 1262-1262.).This nematode current is considered to the potential threat nematode faced during the cereal crops such as international wheat produce.The harm of Philips's cyst roundworm is also very serious, this nematode of Turkey cause Yield Reduction of Winter Wheat 35% (Nicol, J.M., Bolat, N., Sahin, E., T ü lek, A.,
a.F.,
a., Kaplan, A., andBraun, H.J.2006.The cereal cyst nematode is causing economic damage on rain-fed wheatproduction systems of Turkey.Phytopathology 96:S196; Yan, G.P., and Smiley, R.W.2008.Firstdetection of the cereal cyst nematode Heterodera filipjevi in North America.Phytopathology98:176), in Iran, maximum to cause 48% be production loss (Hajihasani, A., Tanha Maafi, Z., Nicol, J.M., andRezaee, S.2010.Effect of the cereal cyst nematode, Heterodera filipjevi, on wheat in microplottrials.Nematology 12 (3): 357-363.).In China, Philips's cyst nematode disease mainly occurs in Henan Province, and cause serious production loss, the wheat class having become at present China produce in have a serious threat, seriously govern the development that wheat crops is produced, the occurrence and distribution of this nematode also not very clear and definite simultaneously, making qualification fast and accurately to this nematode is that current wheat crops produces urgent problem.
The Morphological Differences of Philips's cyst roundworm and cereal cyst nematode is very little, mainly be that Philips's cyst roundworm vaginal orifice cone has lower bridge construction, and cereal cyst nematode not this structure, sporangiocyst color simultaneously, vesica, the shape of two fenestra also has subtle difference (Subbotin, S.A., Waeyenberge, L., Molokanova, I.A., and Moens, M.1999.Identification ofspecies from the Heterodera avenae group by morphomometrics and ribosomal DNA RFLPs.Nematology (1): 195-207), but these difference needs abundant expertise to distinguish, application is difficult in production reality, simultaneously traditional Morphological Identification is consuming time more, workload is difficult to greatly the requirement meeting current high-throughput rapid detection.
In this year, along with molecular biological fast development, the Fast Detection Technique such as PCR have applied to the rapid detection of Plant nematode widely with in qualification.The detection technique applying to wheat cyst roundworm at present mainly comprises ITS-RFLP, PCR, real timePCR etc.
Zheng etc. adopt ITS-RFLP technology, by Hinf I endonuclease digestion ITS region, find that the cereal cyst nematode of China is all not identical with colony of India (Type B) with European H.avenae (A type), be called " C type " (Zheng, J., SubbotinS.A., Waeyenberge L., Moens M., Molecular characterization of Chinese Heterodera glycines and H.avenae populations based on RFLPs and sequences of rDNA-ITS regions.Russian Journal ofNematology 2000, 8:109-113.).Peng Deliang etc. have increased the Internal Transcribed Spacer of ribosomal gene of Wheat in China cereal cyst nematode colony, cut ITS amplified production with AluI and RsaI enzyme and prove that Chinese cereal cyst nematode ITS belongs to " Type B ", Hinf I enzyme is cut to disclose between China and Morocco cereal cyst nematode ITS exists notable difference (Peng Deliang, Subbotin S.A., M.Moens. ribosomal gene (rDNA) the restriction fragment length polymorphism research of wheat cearal cyst nematode (Heterodera avenae). Plant Pathology, 2003,33 (4): 323-329).Subbotin etc. adopt ITS-RFLP technology effectively can distinguish Philips's cyst roundworm (Subbotin by Cfo I restriction endonuclease equally, S.A., Sturhan, D., Rumpenhopst, H.J., andMoens, M.2003.Molecular and morphological characterisation of the Heterodera avenae complexspecies (Tylenchida:Heteroderidae) .Nematology 5 (5): 515-538.).Yan etc. use the cereal cyst nematode of method to Some Areas of USA of rDNA-ITS region RFLP combining form qualification to detect, the method effectively can distinguish cereal cyst nematode and Philips's cyst roundworm (Yan by 6 kinds of restriction enzymes, G.P., and Smiley, R.W.2010.Distinguishing Heterodera filipjevi and H.avenae using polymerase chain reaction-restrictionfragment length polymorphism and cyst morphology.Phytopathology 100 (3): 216-224.).The cereal cyst nematode to China Huang-Huai-Hai Mai Qu such as Fu has carried out ITS and rflp analysis (Fu Bo, Ian T.Riley, Li Honglian, et al.Molecular characterisation of cereal cyst nematodes in winter wheat on the Huang-Huai floodplainof China using RFLP and rDNA-ITS sequence analyses.Australasian Plant Pathol 2011,40:277 – 285).QiXiao Li etc. adopt the method for RAPD, develop cereal cyst nematode specific SCAR molecule marker, the method can be special differentiation cereal cyst nematode, detection sensitivity is up to 1/80 2 instar larvae (QiXiao Li, Peng Deliang, Peng Huan, Longhai City's ripple, Huang Wenkun, He Wenting. based on wheat cearal cyst nematode (Heterodera avenae) the rapid molecular detection technique of SCAR mark. Scientia Agricultura Sinica, 2012,45 (21): 4388-4395).Simultaneously, Ophel-Keller etc. develop the real time PCR detection technique of direct-detection cereal cyst nematode in worm soil, sensitivity reaches 1 ovum/1g (Ophel-Keller Kathy, McKay Alan, Hartley Di, Herdina and Curran, John.Development of a routine DNA-based testingservice for soilborne diseases in Australia.Australian Plant Pathology, 2008,37:243-253).
In the rapid molecular of Philips's cyst roundworm detects, Philips's cyst roundworm RAPD specific sequence that Peng Huan etc. amplify according to OPK16 random primer designs SCAR primer, specially from Philips's cyst roundworm can amplify the fragment that length is 646bp, detection sensitivity is 1/80 larva, Philips's cyst roundworm (Peng of 4 different larval instar can be detected from the soil of 1/0.5g and plant of falling ill simultaneously, H., Qi, X., Peng, D., Long, H., He, X., Huang, W., and He, W.2013.Sensitive and direct detection of Heterodera filipjevi in soil and wheat roots byspecies-specific SCAR PCR assays.Plant Disease 97:1288-1294.).On this basis, according to above-mentioned RAPD sequence, Peng Deliang etc. adopt loop-mediated isothermal amplification technique to have developed Philips's cyst roundworm LAMP detection technique, can detect Philips's cyst roundworm and cereal cyst nematode (patent of invention number: ZL201310053055.4) from soil and plant tissue of falling ill.Yan etc., according to the ITS sequence difference of Philips's cyst roundworm, devise Auele Specific Primer, and amplification that can be special is fragment (Yan, the Guiping of 171bp to length; Smiley, Richard W.; Okubara, Patricia A. (2013) Species-Specific PCR Assays for Differentiating Heterodera filipjevi and H-avenae.PlantDisease 97:1611-1619).Li Hong such as to connect at the ITS difference equally according to Philips and cereal cyst nematode, develops the real time PCR detection technique (patent of invention number: ZL201110338657.5) of 2 kinds of cyst roundworms.This research, according to above-mentioned Philips's cyst roundworm RAPD specific marker, develops Philips's cyst roundworm real time PCR detection technique.
In the detection of other cyst roundworms, Subbotin S A, Peng D L, Moens M. develops soy bean cyst roundworm one one-step dual PCR detection method, add universal primer D3A and D3B and Auele Specific Primer GlyF1 and rDNA2 in PCR reaction system simultaneously, two DNA segments (181bp and 345bp) are all amplified from 52 soy bean cyst roundworm colonies, the susceptibility detected is up to minim DNA (the Subboton S.A. of monospore capsule or single head second instar larvae, Peng D L, Moens M., A rapidmethod for the identification of the soybean cyst nematode Heterodera glycines using duplex PCR.Nematology 2001, vol.3 (4): 365-371).Ou, S.Q. RAPD technology is adopted with Peng D.L, obtain soy bean cyst roundworm specific SCAR label, can increase from soy bean cyst roundworm colony and obtain specific fragment (the Ou S.Q. that length is 500bp, Peng D.L., Li Y., Moens M., Identification of Heterodera glycines using PCR withsequence characterised amplified region (SCAR) primers.Nematology 2008,10 (3): 397-403).
Along with molecular biological fast development, molecular assay method based on PCR compensate for the defect in traditional form qualification to a certain extent, but regular-PCR is consuming time longer, also need after PCR terminates to carry out gel electrophoresis analysis, and need the chemical reagent that EB etc. is poisonous.Real-time fluorescence quantitative PCR by the fluorescence intensity in real-time detection reaction, thus realizes the detection to target.Have that specificity is stronger, sensitivity is higher and can detection be completed in the shorter time.This technology is widely used in the detection of various plants nematode at present, but reports very few in wheat cyst roundworm.
Have the real time PCR detection technique that Philips's cyst roundworm is developed based on ITS sequence at present, the present invention, on the basis of Philips's cyst roundworm RAPD distinguished sequence of acquisition in early stage, establishes the method for quick of the Philips's cyst roundworm Real Time PCR developed based on RAPD specific fragment first.
Summary of the invention
BROAD SUMMARY of the present invention is to provide a kind of Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting method based on the design of RAPD specific fragment and application thereof, for the rapid molecular formulating Philips cyst roundworm detect, the service such as early diagnosis and assistant identification.
Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting method, wherein PCR system comprises a group-specific primers and probe, described Auele Specific Primer is qHF-R and qHF-F, and a specific probe is HF-probe, and its nucleotide sequence is respectively:
qHF-R:5’-GTCGAATATCGAAGTGTTG-3’，
qHF-F:5’-CTACCACTTTCAACTCAAA-3’，
HF-probe：5’-AGGCAGGACGAAACTCATTCAAC-3。
5 ' the end of described probe HF-probe has FAM fluorescent mark, and 3 ' end has BHQ1 to mark.
PCR reaction system is 2 × PCR mix 10 μ l; ROX reference DyeII 0.4 μ l; Primer qHF-R/qHF-F (10uM) and probe HF-probe (10uM) is 0.4 μ l; 1 μ l template DNA; Sterilizing ddH
2o complements to 20 μ l.
PCR reaction conditions is 95 DEG C of denaturation 30sec, 95 DEG C, 3s, 60 DEG C, 30s, 40 circulations,
The application of Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting method in Philips's cyst roundworm rapid molecular detects.
Describedly be applied as the field sample detection of Philips's cyst roundworm and the monitoring and warning of occurrence and distribution.
The present invention utilizes the RAPD random primer of early development to increase from Philips's cyst roundworm to obtain the fragment that a length is about 1000bp, and (sequence NCBI announces, accession number: KC529338), pass through order-checking and blast comparison determination fragment and other nematodes all without similarity, specific to Philips's cyst roundworm, design Auele Specific Primer and probe on this basis and detect for the rapid molecular of Philips's cyst roundworm.
Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting method of the present invention's exploitation, adopt Auele Specific Primer qHf-F, qHf-R and probe HF-probe can carry out specific amplification to from 8 Philips's cyst roundworm geographical population, obtain special fluorescence curve, and the equal unstressed configuration curve of other cyst roundworm sibling specieses, thus the detection fast and accurately realized Philips's cyst roundworm and qualification.Simultaneously, the genomic dna of a series of weaker concns that Philips's cyst roundworm DNA of different weaker concn and concentration are determined is for the Taqman MGB probe for real-time fluorescence quantitative PCR detecting method sensitivity technique of these research and development, thus the detection threshold determining the Taqman MGB probe for real-time fluorescence quantitative PCR detecting method of Philips's cyst roundworm of the present invention is 4
-3j2 larva, 10
-3female worm DNA and 10ng genomic dna, have very high sensitivity.Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting method high specificity that the present invention builds, highly sensitive, quick, accurate can be determined thus.
The present invention amplifies the specificity RAPD fragment of Philips's cyst roundworm according to OPK16 random primer, design Auele Specific Primer and Taqman MGB probe, achieving the diagnosis and detection to Philips's cyst roundworm, there is high specificity and sensitivity, reducing the erroneous judgement to detecting sample.The method can be applied to the aspect such as the field sample detection of Philips's cyst roundworm and the monitoring and warning of occurrence and distribution simultaneously, have actual using value.
Accompanying drawing explanation
Fig. 1: Auele Specific Primer and MGB specific designs,
Fig. 2: Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR specific detection result,
1-8 is respectively Philips nematode different groups (being encoded to HF01, HF02, HF03, HF04, HF05, HF06, HF07 and HF08); 9-28 is respectively cereal cyst nematode different groups (HA01, HA02, HA03, HA04, HA05, HA06, HA07 and HA08), wide vaginal orifice cyst roundworm (HL01, HL02, HL03, HL04), soy bean cyst roundworm (Hg), pea cyst roundworm (Hgo), Feng Shi cyst roundworm (HFengi) upland rice cyst roundworm (He), beet cyst roundworm (Hs), globodera rostochiensis (Gr), G.pallida (Gp) and CK negative control;
Fig. 3: the wall scroll J2 nematode DNA sensitivity technique result of different weaker concn,
1-8 is respectively 1,1/4,4
-2, 4
-3, 4
-4, 4
-5, 4
-6bar Philips cyst roundworm DNA and CK negative control,
Fig. 4: the single head female worm DNA sensitivity technique result of different weaker concn,
1-8 is respectively 1,1/10,10
-2, 10
-3, 10
-4, 10
-5, 10
-6the female worm DNA of bar Philips cyst roundworm and CK negative control,
Fig. 5: Philips's sporangiocyst genomic dna sensitivity technique result of different concns,
1-8 is Philips's cyst roundworm genomic dna (100 μ g/ μ l, 10 μ g/ μ l, 1 μ g/ μ l, 100ng/ μ l, 10ng/ μ l, 1ng/ μ l, 10pg/ μ l and 1pg/ μ l) and CK negative control.
Embodiment
Below in conjunction with embodiment, the present invention is described in further detail.
The material that experiment of the present invention is selected:
8 Philips's cyst roundworms respectively from Henan, Turkey, Iran, Saudi Arabia etc. gathers or present, 8 cereal cyst nematodes respectively from Qinghai, Beijing, Shandong, the U.S., Saudi Arabia, France and Turkey gathers or present, the nematodes such as 4 wide vaginal orifice cyst roundworms, upland rice cyst roundworm, beet cyst roundworm, soy bean cyst roundworm, pea cyst roundworm, Feng Shi cyst roundworm, potato cyst nematode are this laboratory Collection and preservation, and above-mentioned nematode DNA all can external disclosure granting.
The cyst roundworm Sample code that table 1 detects and colony source
Main agents: Taq archaeal dna polymerase, DNA gel reclaim test kit, DNA marker and PMD 18-T vector purchased from TaKaRa company, primer and probe are synthesized by the precious biotechnology company limited in Dalian.
Embodiment 1: Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting method is set up
The extraction of 1.1 nematode DNA
The single sporangiocyst of picking, put into fill 7 μ l 10 × PCR buffer, in the centrifuge tube in the redistilled water of 3 μ l Proteinase K Solution (600 μ g/ml) and 10 μ l sterilizings ,-20 DEG C of refrigerator and cooled freeze 1h.Ice-out is turned to, then freezing at least 2h at-20 DEG C with the glass stick of 75% alcohol disinfecting.After 2h, centrifuge tube is taken out from refrigerator, incubation 1.5h at putting 65 DEG C, then at 95 DEG C of 10min, centrifugal 1min under last 10000rpm, supernatant liquor saves backup in-20 DEG C.The DNA extracted adopts universal primer D2A and D3B to increase to above-mentioned DNA, detects the quality of DNA.
1.2 Philips's cyst roundworm specific primer and probe design
According to early development the RAPD-SCAR specific fragment (Genbank accession No.KC529338) of Philips's cyst roundworm, adopt Primer 3.0 to design primer and probe sequence called after qHf-F, qHf-R and HF-probe respectively of a group-specific, (primer and probe location figure are shown in Fig. 1) its nucleotide sequence is as follows:
qHF-R:5’-GTCGAATATCGAAGTGTTG-3’，
qHF-F:5’-CTACCACTTTCAACTCAAA-3’。
HF-probe：5’-(FAM)AGGCAGGACGAAACTCATTCAAC(BHQ1)-3
1.3 Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting methods are set up
Adopt Auele Specific Primer qHf-F, qHf-R and the specific probe HF-probe of the present invention's design, with the genomic dna of Philips's cyst roundworm for template, carry out pcr amplification, qPCR reaction system is 2 × PCR mix 10 μ l; ROX referenceDyeII 0.4 μ l; Primer qHF-R/qHF-F (10uM) and probe HF-probe (10uM) is 0.4 μ l; 1 μ l template DNA; Sterilizing ddH
2o complements to 20 μ l.Adopt sterilized water as negative control.PCR adopts ABI 7500FAST quantitative real time PCR Instrument, and PCR reaction conditions is 95 DEG C of denaturation 30sec, 95 DEG C, 3s, 60 DEG C, 30s, 40 circulations, collects fluorescent signal while 60 DEG C.
Embodiment 2: Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR specificity and sensitivity technique.
2.1 Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR specific detection.
Auele Specific Primer qHf-F, qHf-R and the specific probe HF-probe of the present invention's design transfer to precious biotechnology (Dalian) company limited to synthesize, PCR reaction system: 2 × PCR mix 10 μ l; ROX reference DyeII 0.4 μ l; Primer qHF-R/qHF-F (10uM) and probe HF-probe (10uM) is 0.4 μ l; 1 μ l template DNA; Sterilizing ddH
2o complements to 20 μ l.Adopt sterilized water as negative control.PCR adopts ABI 7500FAST quantitative real time PCR Instrument, and PCR reaction conditions is 95 DEG C of denaturation 30sec, 95 DEG C, 3s, 60 DEG C, 30s, 40 circulations, collects fluorescent signal while 60 DEG C.
8 Philips's line insect populations all can obtain specific fluorescence curve through the amplification of Auele Specific Primer qHf-F, qHf-R and specific probe HF-probe, and in other cyst roundworm populations and negative control, unstressed configuration curve occurs, as shown in Figure 2.Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR molecular detecting method that the present invention sets up effectively can detect Philips's cyst roundworm accurately from 10 kinds of cyst roundworms, has high specificity.
2.2 Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR sensitivity technique.
Extract the DNA of wall scroll Philips cyst roundworm J2 larva, adopt 4 times of dilution methods, dilution is carried out to DNA and obtains 1,1/4,4
-2, 4
-3, 4
-4, 4
-5, 4
-6bar horse Philips cyst roundworm J2 larva DNA, respectively get 1 μ l DNA be template the present invention set up Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR system detect, with check Auele Specific Primer sensitivity.The results are shown in Figure 3.
Extract the DNA of the female worm of single head Philips's sporangiocyst, adopt 10 times of dilution methods, dilution is carried out to DNA and obtains 1,1/10,10
-2, 10
-3, 10
-4, 10
-5, 10
-6the DNA of the female worm of bar Philips cyst roundworm, respectively get 1 μ l DNA be template the present invention set up Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR system detect, with check Auele Specific Primer sensitivity.The results are shown in Figure 4.
Adopt the genomic dna of phenol/chloroform extraction method Philips sporangiocyst cyst roundworm, Nanodrop 2000 is adopted to measure its genomic dna concentration, adopt water to be diluted to 100 μ g/ μ l, 10 μ g/ μ l, 1 μ g/ μ l, 100ng/ μ l, 10ng/ μ l, 1ng/ μ l and 100pg/ μ l 7 concentration, respectively get 1 μ l Philips cyst roundworm DNA and do the template Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR system set up with the present invention and carry out increasing to check sensitivity.Auele Specific Primer sensitivity technique amplification reaction system and amplification program are as described in 2.1, and detected result as shown in Figure 5.
The result of Fig. 3-5 shows, from 4
-3bar wall scroll J2 and 10
-3all specific fluorescence curve in female worm DNA, negative control does not increase.The result explanation of Fig. 4, the detection threshold of this Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR system is 10ng/ μ l, this illustrates that the sensitivity of this Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR system is very high, and this research sets up Philips's sporangiocyst line real-time fluorescence quantitative PCR detection system accurately and reliably.
Claims (6)
1. Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting method, wherein PCR system comprises a group-specific primers and probe, described Auele Specific Primer is qHF-R and qHF-F, and a specific probe is HF-probe, and its nucleotide sequence is respectively:
qHF-R:5’-GTCGAATATCGAAGTGTTG-3’，
qHF-F:5’-CTACCACTTTCAACTCAAA-3’，
HF-probe：5’-AGGCAGGACGAAACTCATTCAAC-3。
2. method according to claim 1, the 5 ' end of described probe HF-probe has fluorescent mark FAM, and 3 ' end has BHQ1 to mark.
3. method according to claim 2, PCR reaction system is 2 × PCR mix 10 μ l; ROX reference DyeII0.4 μ l; Primer qHF-R/qHF-F (10uM) and probe HF-probe (10uM) is 0.4 μ l; 1 μ l template DNA; Sterilizing ddH
2o complements to 20 μ l.
4. method according to claim 3, PCR reaction conditions is 95 DEG C of denaturation 30sec, 95 DEG C, 3s, 60 DEG C, 30s, 40 circulations.
5. according to the application of the arbitrary described Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting method of claim 1-4 in Philips's cyst roundworm rapid molecular detects.
6. applying described in claim 5, is the field sample detection of Philips's cyst roundworm and the monitoring and warning of occurrence and distribution.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510295749.8A CN104928372B (en) | 2015-06-02 | 2015-06-02 | Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting methods and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510295749.8A CN104928372B (en) | 2015-06-02 | 2015-06-02 | Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting methods and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104928372A true CN104928372A (en) | 2015-09-23 |
| CN104928372B CN104928372B (en) | 2017-08-08 |
Family
ID=54115796
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510295749.8A Active CN104928372B (en) | 2015-06-02 | 2015-06-02 | Philips's cyst roundworm Taqman MGB probe for real-time fluorescence quantitative PCR detecting methods and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104928372B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105331704A (en) * | 2015-11-17 | 2016-02-17 | 南京农业大学 | Duplex PCR (polymerase chain reaction) detection method of heterodera avenae and heterodera filipjevi and application |
| CN114507743A (en) * | 2022-01-28 | 2022-05-17 | 中国农业科学院植物保护研究所 | RPA primer, probe and kit for rapidly detecting Heterodera filipjevi and application of RPA primer, probe and kit |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102329793A (en) * | 2011-10-31 | 2012-01-25 | 中国农业科学院植物保护研究所 | Specific sequence characterized amplified region (SCAR) marker and rapid polymerase chain reaction (PCR) detection method for Heterodera filipjevi |
| CN102605048A (en) * | 2011-12-09 | 2012-07-25 | 河南农业大学 | Specific primer sequence and probe sequence for simultaneous detection on Heterodera avenae and Heterodera filipjevi, and detection method with specific primer sequence and probe sequence |
| CN103103285A (en) * | 2013-02-18 | 2013-05-15 | 中国农业科学院植物保护研究所 | LAMP rapid detection method for Heterodera filipjevi and its application |
| CN103290000A (en) * | 2013-03-01 | 2013-09-11 | 中国水稻研究所 | SCAR marker of biocontrol Hypocrea virens, its application and quantitative detection method |
-
2015
- 2015-06-02 CN CN201510295749.8A patent/CN104928372B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102329793A (en) * | 2011-10-31 | 2012-01-25 | 中国农业科学院植物保护研究所 | Specific sequence characterized amplified region (SCAR) marker and rapid polymerase chain reaction (PCR) detection method for Heterodera filipjevi |
| CN102605048A (en) * | 2011-12-09 | 2012-07-25 | 河南农业大学 | Specific primer sequence and probe sequence for simultaneous detection on Heterodera avenae and Heterodera filipjevi, and detection method with specific primer sequence and probe sequence |
| CN103103285A (en) * | 2013-02-18 | 2013-05-15 | 中国农业科学院植物保护研究所 | LAMP rapid detection method for Heterodera filipjevi and its application |
| CN103290000A (en) * | 2013-03-01 | 2013-09-11 | 中国水稻研究所 | SCAR marker of biocontrol Hypocrea virens, its application and quantitative detection method |
Non-Patent Citations (1)
| Title |
|---|
| PENG D.ET AL: "Heterodera filipjevi RAPD marker OPK16 genomic sequence", 《GENBANK:KC529338》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105331704A (en) * | 2015-11-17 | 2016-02-17 | 南京农业大学 | Duplex PCR (polymerase chain reaction) detection method of heterodera avenae and heterodera filipjevi and application |
| CN105331704B (en) * | 2015-11-17 | 2019-01-04 | 南京农业大学 | A kind of cereal cyst nematode and Philips's cyst roundworm dual PCR detection method and application |
| CN114507743A (en) * | 2022-01-28 | 2022-05-17 | 中国农业科学院植物保护研究所 | RPA primer, probe and kit for rapidly detecting Heterodera filipjevi and application of RPA primer, probe and kit |
| CN114507743B (en) * | 2022-01-28 | 2022-11-25 | 中国农业科学院植物保护研究所 | RPA primer, probe and kit for rapidly detecting heterodera filipjevi and application of RPA primer, probe and kit |
| NL2033977B1 (en) * | 2022-01-28 | 2023-07-04 | Institute Of Plant Prot Ipp Chinese Academy Of Agricultural Sciences Caas | Recombinase Polymerase Amplification Primers and Probe, Kit for Rapid Detection of Heterodera filipjevi and Applications |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104928372B (en) | 2017-08-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102286637B (en) | Method for detecting tobacco viruses by reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology | |
| CN105779652B (en) | A kind of multiplex RT-PCR method of 4 kinds of capsicum virus of quick detection | |
| CN101691614B (en) | Method for rapidly identifying rice black-streaked dwarf virus and southern rice black-streaked dwarf virus | |
| CN102329793B (en) | Specific sequence characterized amplified region (SCAR) marker and rapid polymerase chain reaction (PCR) detection method for Heterodera filipjevi | |
| CN103103285B (en) | LAMP rapid detection method for Heterodera filipjevi and its application | |
| CN103045751B (en) | Rapid detection method of heterodera avenae wollenweber LAMP and application of detection method | |
| Salehi et al. | Association of ‘Candidatus Phytoplasma phoenicium’with GF-677 witches’ broom in Iran | |
| CN108949916B (en) | Rape black shank bacterium specific sequence, LAMP detection primer and application | |
| Du et al. | LAMP Detection and Identification of the Blackleg Pathogen Leptosphaeria biglobosa ‘brassicae’ | |
| CN108060267A (en) | PCR primer and its detection method used in a kind of detection Brassica 2 et 4 | |
| Li et al. | Incidence of sugarcane ratoon stunting disease in the major cane-growing regions of China | |
| CN104928372A (en) | Heterodera filipjevi Taqman MGB probe real-time quantitative PCR detection method and application thereof | |
| CN102796825B (en) | Specificity polymerase chain reaction (PCR) method for detecting heterodera elachista ohshima | |
| CN107287316B (en) | Specific SCAR marker of beet cyst nematode and rapid SCAR-PCR molecular detection method | |
| CN104120170B (en) | Potato early blight bacterium detection kit and detection method | |
| CN104498593A (en) | Primer pair and kit for identification or assisted identification of stored bean weevils | |
| CN103740857B (en) | Rapid PCR (Polymerase Chain Reaction) molecular detection method for ditylenchus destructor thorne and application of rapid PCR molecular detection method | |
| CN103451298B (en) | Kit for detecting physiological races of brussels sprouts wilt pathogens I and II and detection method thereof | |
| KR101577529B1 (en) | Primer set for detection of Pseudomonas syringae pv. actinidiae, diagnositc kit using the same and diagnosis method of bacterial canker of kiwifruit using the same | |
| CN102690824B (en) | Rapid molecular detection method of heterodera elachista by specific RAPD (Randomly Amplified Polymorphic DNA) and SCAR (Sequence-characterized Amplified Region) markers | |
| CN112266979A (en) | RPA detection primer based on watermelon mosaic virus conserved region, detection method and application thereof | |
| CN111363832A (en) | Primer composition and kit for qPCR quantitative detection of meloidogyne graminicola in paddy field soil and application of primer composition and kit | |
| CN110951923A (en) | Multiplex PCR method for simultaneously detecting four sugarcane seed-borne viruses, primers and kit thereof | |
| Basavaraj et al. | Molecular characterization of CMV infecting banana from Karnataka based on complete coat protein gene sequence | |
| CN1482254A (en) | Primer and method for rapid molecular detection of eelworm |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |