CN104928367A - Shellfish distant hybridization offspring genetic identification method - Google Patents
Shellfish distant hybridization offspring genetic identification method Download PDFInfo
- Publication number
- CN104928367A CN104928367A CN201510264992.3A CN201510264992A CN104928367A CN 104928367 A CN104928367 A CN 104928367A CN 201510264992 A CN201510264992 A CN 201510264992A CN 104928367 A CN104928367 A CN 104928367A
- Authority
- CN
- China
- Prior art keywords
- shellfish
- pcr
- hybridization
- intron
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method suitable for shellfish distant hybridization offspring genetic identification. The method is based on an EPIC-PCR (polymerase chain reaction) method. The method comprises the following steps of firstly, selecting an object gene; secondly, comparing the length polymorphisms of introns in the object gene; thirdly, selecting the introns with different length polymorphisms; fourthly, designing primers on extrons at the two ends of the introns; finally, performing conventional DNA (deoxyribonucleic acid) extraction, PCR amplification, gel electrophoresis and dyeing imaging analysis on two distant hybridization shellfish parents and a hybridization shellfish hybridization offspring, wherein if one band in the hybridization offspring is from the male parent and the other band is from the female parent, that proves the hybridization offspring is parent hybridization offspring, and genetic identification of the distant hybridization shellfish offspring is realized. The method is simple in operation, high in resolution, rich in genetic marker, high in primer universality and low in price; a convenient and reliable molecule identification method is provided; the method is particularly suitable for the hybridization offspring which cannot be identified by the traditional genetic marker technique.
Description
Technical field
The present invention relates to a kind of method being applicable to the qualification of shellfish distant hybirdization progeny inherit, specifically a kind of method utilizing EPIC-PCR method to identify shellfish distant hybirdization filial generation, belongs to biology field.
Background technology
Hybridization is the important means of animals and plants genetic improvement, and according to the sibship of hybrid strain, hybridization can be divided into close hybridization and distant hybirdization.Close hybridization is cross-breeding ordinary method, workable, easily promotes.But due to the extensive expansion of animals and plants breeding, make the hybridization potentiality between sibling species more and more less, variation amplitude is restricted.And the offspring of distant hybirdization has very large potential heritable variation, distant hybirdization can be applicable to animals and plants improvement, gene and genomic mapping, the research field of each animals and plants genetic thremmatologies such as chromosome behavior research and Study on Evolution.
Shellfish distant hybirdization originates from the species hybridization of oyster, and species hybridization oyster shows certain hybrid vigour in resistance, growth survival etc. in some.Ibrra etc. have studied blue Bao (
haliotis fulgens Philippi) and red Bao (
h. rufescens Swainson) the gonad development situation of hybrid generation, result shows that hybridization first filial generation sexual gland can be reached maturity, and can normally breed.In addition, the distant hybirdization research report of scallop, Bao, mussel is of common occurrence, and can fully show remote hybrid advantage.
But in the work of actual shellfish distant hybridization breeding, often run into hybrid generation and parent from phenomenons such as numerous filial generation mix, cause breeding result to occur error.Gaffney (1993) adopts the method for isozyme to identify the distant hybirdization filial generation of oyster first, and points out that conclusive evidence does not prove the verity of the oyster hybrid generation of surviving in research in the past.Henceforth, scholars is carrying out oyster distant hybirdization research, and diverse ways all must be adopted to identify hybrid generation, therefore how to identify that the verity of hybrid generation is the very crucial step of distant hybridization breeding.The method of usual employing is rDNA ITS1, ITS2 and Mitochondrial DNA COI technical evaluation shellfish hybrid generation, but these methods are not also suitable for the hybrid generation of two kinds of close shellfishes of ITS or COI amplified fragments size, ITS2 fragment gap between the huge oyster in such as Hong Kong and Crassostrea rivularis is only 65 bp, is difficult to the hybrid generation of both differentiations by pcr amplification and gel electrophoresis imaging.Although RAPD, AFLP, RFLP, SSR, SNP Protocols in Molecular Biology has been widely used in the genetic marker of shellfish.But these marks are all developed based on exon DNA fragmentation, the specificity for shellfish distant hybirdization filial generation qualification is not high.
Summary of the invention
For solving the problem, the object of the invention be to provide a kind of simple to operate, resolving power is high, genetic marker is enriched, primer versatility is high, cheap is applicable to the method for shellfish distant hybirdization progeny inherit qualification, to make up the deficiencies in the prior art.
The present invention adopts EPIC (exon primer intron crossing)-PCR method to identify shellfish distant hybirdization filial generation, the method is by gene order conservative in selection function, at its exon region design primer, amplification intron fragment, comparison Intron Length Polymorphism.Namely the present invention designs primer on exon, amplification intron fragment, by the length polymorphism comparison of intron amplified fragments, and qualification shellfish distant hybirdization filial generation.
The concrete technical scheme that the present invention takes is:
A kind of shellfish distant hybirdization progeny inherit authentication method, it is characterized in that, the method is based on EPIC (exon primer intron crossing)-PCR method, first tool software is used to load the homologous genes sequence of two distant hybirdization shellfish parents as goal gene, then the length polymorphism of intron in this goal gene of comparison, select the intron that length there are differences, and on the exon at these intron two ends, design primer, finally conventional DNA extraction is taked to two distant hybirdization shellfish parents and the filial generation of hybridization shellfish, pcr amplification, gel electrophoresis and dyeing imaging analysis, judge that the electrophoretogram of hybridization shellfish filial generation has two bands, and all from two parents, namely the band in hybrid generation comes from male parent, another band comes from female parent, finally realize the Genetic identification of distant hybirdization shellfish filial generation, finally realize the Genetic identification of distant hybirdization shellfish filial generation.
The method concrete steps comprise:
(1) Intron Length Polymorphism examination in goal gene
In Gene bank database, download the homologous genes sequence of two shellfish parents, use the identical complete genome sequence of Atemis software loading two parent, carry out sequence alignment, the Intron Length Polymorphism difference of examination two shellfish parent homologous genes, the intron of difference in length will be had, as goal gene amplified fragments;
(2) design of primers
Use primer-design software, the exon of the intron both sides of examination in above-mentioned steps designs primer;
(3) genomic dna extracts
Extract the DNA of shellfish two parent and hybrid generation;
(4) examination of PCR amplimer annealing temperature
By the primer designed in (2) step, carry out grads PCR amplification; Pcr amplification reaction system and response procedures adopt ordinary method, and pcr amplification product is carried out gel electrophoresis analysis, and band experimental group screening is clearly the annealing temperature of amplimer;
(5) PCR goal gene intron fragment amplification
The annealing temperature of the pcr amplification primer (4) step screened is standard, and pcr amplification reaction system and PCR response procedures, with (4) step, carry out the amplification of goal gene fragment; Then get pcr amplified fragment product and carry out gel electrophoresis, finally electrophoretic image analysis is judged, the electrophoretogram of hybridization shellfish filial generation has two bands, and all from two parents, namely the band in hybrid generation comes from male parent, another band comes from female parent, then prove that this hybrid generation is the hybrid generation of two parents.
Described shellfish distant hybirdization progeny inherit authentication method also comprises many amplified band phenomenon terms of settlement of hybridization shellfish filial generation heteroduplex DNA: by pcr amplified fragment product dilution 10 times, then carry out pcr amplification to the PCR primer of dilution; PCR reaction system is with above-mentioned (4) step; PCR response procedures: sex change 5 minutes under 95 DEG C of conditions, under the annealing temperature of having screened in the step (4), renaturation anneal 1 point 30 seconds, extend at 72 DEG C, cycle index is 3.
Primer-design software in above-mentioned (2) step is oligo6.0 or primer5.0 software.
Conventional or kit method extraction DNA is adopted in above-mentioned (3) step.
Advantage of the present invention: the present invention is simple to operate, resolving power is high, genetic marker is abundant, primer versatility is high, cheap; Because shellfish exon has well-conserved, therefore on exon, design primer, versatility is high; And the Intron Length Polymorphism of shellfish is high, abundant EPIC-PCR molecular genetic marker therefore can be developed.It is close with Mitochondrial DNA COI amplified fragments size that the present invention is particularly useful for two shellfish parent rDNA ITS1, ITS2, cannot adopt the hybrid generation of traditional ITS1, ITS2 and COI Genetic Markers qualification; In addition, effective terms of settlement of many amplified band phenomenons of hybridization shellfish filial generation heteroduplex DNA is provided.The present invention is the hybrid generation Genetic identification in the distant hybirdization genetic breeding of shellfish, provides convenience, reliably molecular assay method.
Accompanying drawing explanation
Fig. 1 is Lycopene the 6th intron PCR electrophoretogram.
Fig. 2 is glutaminase synthetic enzyme First Intron PCR electrophoretogram.
Wherein: M, standard marker; 1-3, the huge oyster in Hong Kong; 4-6, Crassostrea rivularis; 7-9, Hong Kong huge oyster ♀ × Crassostrea rivularis ♂ hybrid generation; 10-12,7-9PCR amplified production go forward side by side after diluting 10 times performing PCR amplification after band.
Embodiment
Below with the huge oyster in Hong Kong (
crassostrea hongkongensis), Crassostrea rivularis (
c. ariakensis), the huge oyster in Hong Kong
♀be that embodiment further illustrates the present invention with Crassostrea rivularis ♂ hybrid generation, but following specific embodiment is not construed as limiting the invention.
embodiment 1:
(1) in Gene bank database, the huge oyster in Hong Kong is downloaded, the complete genome sequence of Crassostrea rivularis Lycopene, uses Atemis software loading complete genome sequence, carries out gene order comparison, found that, there is sequence length difference in Lycopene the 6th intron of two oyster parents;
(2) use Oligo 6.0 software at the both sides exon region of Lycopene the 6th intron, design primer, upstream primer GAATCCAACCCAGCAAGTCG, downstream primer is CGCTTGTACATCTTTGACACCT;
(3) use the raw work test kit in Shanghai, extract the DNA of the huge oyster in Hong Kong and Crassostrea rivularis and hybrid generation;
(4) primer will designed in (2) step, carries out grads PCR amplification; Pcr amplification reaction system is 14.4 μ lH2O, 0.4 μ ldNTP, 4.2 μ lOne Taq Standard PC R buffer, the described primer of 0.4 μ l10mM and 0.11 μ lOne Taq HS enzyme; PCR response procedures: sex change 5 minutes under 95 DEG C of conditions, under 48 DEG C, 50 DEG C, 52 DEG C, 54 DEG C, 56 DEG C, 58 DEG C temperature condition renaturation anneal 1 point 30 seconds, extend at 72 DEG C, cycle index is 35; Keep 5 minutes under 72 DEG C of conditions, make primer extension complete; Reduce the temperature to 4 DEG C of preservations; Get the different annealing temperature grads PCR amplified fragments product of 7 μ l, use 1% sepharose under 100v voltage, within electrophoresis 1-2 hour, detect, until DNA fragmentation sharp separation, add DNA ladder simultaneously; In pcr amplification product, band experimental group screening is clearly the annealing temperature of amplimer; Determine that optimum annealing temperature is 56 DEG C;
(5) to the huge oyster ♀ in the huge oyster in Hong Kong, Crassostrea rivularis and Hong Kong and Crassostrea rivularis
♂hybrid generation carries out pcr amplification, the results are shown in Figure 1, the pcr amplified fragment of Lycopene the 6th intron of the huge oyster in Hong Kong is 497bp, the amplified fragments of the PCR in the same site of Crassostrea rivularis is 1152bp, there are two bands in the pcr amplified fragment of its hybrid generation, is respectively 497bp and 1152bp.Namely prove that this hybrid generation is the distant hybirdization filial generation of the huge oyster in Hong Kong and Crassostrea rivularis.
embodiment 2:
(1) in Gene bank database, the huge oyster in Hong Kong is downloaded, the complete genome sequence of the glutaminase synthetic enzyme of Crassostrea rivularis, uses Atemis software loading gene order, carries out gene order comparison, found that, there is sequence length difference in glutaminase synthetic enzyme First Intron;
(2) use Oligo 6.0 software at the both sides exon region of glutaminase synthetic enzyme First Intron, design primer, upstream primer is GAGGGAGTCAGGTCCAAGTG; Downstream primer is GGAGCCGTCATAGTTCCAGA;
(3) use the raw work test kit in Shanghai, extract the DNA of the huge oyster in Hong Kong and Crassostrea rivularis and both hybrid generations;
(4) with the PCR reaction system in (4) step in embodiment 1 and program, determine that optimum annealing temperature is 55 DEG C;
(5) to the huge oyster in Hong Kong, the huge oyster of Crassostrea rivularis and Hong Kong
♀with Crassostrea rivularis
♂hybrid generation carries out pcr amplification, the results are shown in Figure 2, the pcr amplified fragment obtaining the glutaminase synthetic enzyme First Intron of the huge oyster in Hong Kong is 479bp, the pcr amplified fragment in the same site of Crassostrea rivularis is 606bp, its hybrid generation occurs that heteroduplex heterozygosity is high, and its pcr amplified fragment is three bands;
(6) hybridization oyster pcr amplification product is diluted 10 times, then carry out taking turns PCR, PCR reaction system is with above-mentioned (4) step; PCR response procedures: sex change 5 minutes under 95 DEG C of conditions, under the annealing temperature of screening in (4) step, renaturation anneal 1 point 30 seconds, extend at 72 DEG C, cycle index is 3; There are two band-479bp and 606bp in the pcr amplified fragment of its hybrid generation, one comes from female parent, and one comes from male parent.Namely prove that this hybrid generation is the distant hybirdization filial generation of the huge oyster in Hong Kong and Crassostrea rivularis.
<110> Chinese Marine University
The method of a <120> shellfish distant hybirdization progeny inherit qualification
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> artificial sequence
<400> 1
gaatccaacc cagcaagtcg 20
<210> 2
<211> 22
<212> DNA
<213> artificial sequence
<400> 2
cgcttgtaca tctttgacac ct 22
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
<400> 3
gagggagtca ggtccaagtg 20
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
<400> 4
ggagccgtca tagttccaga 20
Claims (5)
1. a shellfish distant hybirdization progeny inherit authentication method, is characterized in that, the method is based on EPIC-PCR method, first tool software is used to load the homologous genes sequence of two distant hybirdization shellfish parents as goal gene, then the length polymorphism of intron in this goal gene of comparison, select the intron that length there are differences, and on the exon at these intron two ends, design primer, finally conventional DNA extraction is taked to two distant hybirdization shellfish parents and the filial generation of hybridization shellfish, pcr amplification, gel electrophoresis and dyeing imaging analysis, judge that the electrophoretogram of hybridization shellfish filial generation has two bands, and all from two parents, namely the band in hybrid generation comes from male parent, another band comes from female parent, finally realize the Genetic identification of distant hybirdization shellfish filial generation.
2. shellfish distant hybirdization progeny inherit authentication method according to claim 1, it is characterized in that, concrete steps comprise:
(1) Intron Length Polymorphism examination in goal gene
In Gene bank database, download the homologous genes sequence of two shellfish parents, use the identical complete genome sequence of Atemis software loading two parent, carry out sequence alignment, the Intron Length Polymorphism difference of examination two shellfish parent homologous genes, the intron of difference in length will be had, as goal gene amplified fragments;
(2) design of primers
Use primer-design software, the exon of the intron both sides of examination in above-mentioned steps designs primer;
(3) genomic dna extracts
Extract the DNA of shellfish two parent and hybrid generation;
(4) examination of PCR amplimer annealing temperature
By the primer designed in (2) step, carry out grads PCR amplification; Pcr amplification reaction system and response procedures adopt standard PCR amplification method, and pcr amplification product is carried out gel electrophoresis analysis, and band experimental group screening is clearly the annealing temperature of amplimer;
(5) PCR goal gene intron fragment amplification
The annealing temperature of the pcr amplification primer (4) step screened is standard, and pcr amplification reaction system and PCR response procedures, with (4) step, carry out the amplification of goal gene fragment; Then get pcr amplified fragment product and carry out gel electrophoresis, finally electrophoretic image analysis is judged, the electrophoretogram of hybridization shellfish filial generation has two bands, and all from two parents, namely the band in hybrid generation comes from male parent, another band comes from female parent, then prove that this hybrid generation is the hybrid generation of two parents.
3. shellfish distant hybirdization progeny inherit authentication method according to claim 2, it is characterized in that, also comprise many amplified band phenomenon terms of settlement of hybridization shellfish filial generation heteroduplex DNA: by pcr amplified fragment product dilution 10 times, then pcr amplification is carried out to the PCR primer of dilution; PCR reaction system is with above-mentioned (4) step; PCR response procedures: sex change 5 minutes under 95 DEG C of conditions, under the annealing temperature of screening in (4) step, renaturation anneal 1 point 30 seconds, extend at 72 DEG C, cycle index is 3.
4. shellfish distant hybirdization progeny inherit authentication method according to claim 2, is characterized in that, the primer-design software in described (2) step is oligo6.0 or primer5.0 software.
5. shellfish distant hybirdization progeny inherit authentication method according to claim 2, is characterized in that, adopts conventional or kit method extraction DNA in described (3) step.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510264992.3A CN104928367A (en) | 2015-06-26 | 2015-06-26 | Shellfish distant hybridization offspring genetic identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510264992.3A CN104928367A (en) | 2015-06-26 | 2015-06-26 | Shellfish distant hybridization offspring genetic identification method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104928367A true CN104928367A (en) | 2015-09-23 |
Family
ID=54115791
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510264992.3A Pending CN104928367A (en) | 2015-06-26 | 2015-06-26 | Shellfish distant hybridization offspring genetic identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104928367A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106498086A (en) * | 2016-12-30 | 2017-03-15 | 青岛农业大学 | Purple scallop and bay scallop and its authentication method in the maternal source of backcross progeny |
| CN108048530A (en) * | 2018-01-23 | 2018-05-18 | 广州大学 | Method based on est sequence exploitation EPICs primers |
| CN109486958A (en) * | 2018-09-26 | 2019-03-19 | 浙江海洋大学 | A kind of EPIC molecular labeling for Sciaenidae fish Phylogenetic Analysis |
-
2015
- 2015-06-26 CN CN201510264992.3A patent/CN104928367A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| MARK D.CAMARA ETAL: "the kumamoto oyster crassostrea sikamea is neither rare nor threatened by hybridization in the northern ariake sea，JAPAN", 《JOURNAL OF SHELLFISH RESEARCH》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106498086A (en) * | 2016-12-30 | 2017-03-15 | 青岛农业大学 | Purple scallop and bay scallop and its authentication method in the maternal source of backcross progeny |
| CN106498086B (en) * | 2016-12-30 | 2019-10-29 | 青岛农业大学 | Purple scallop and bay scallop and its identification method in backcross progeny female parent source |
| CN108048530A (en) * | 2018-01-23 | 2018-05-18 | 广州大学 | Method based on est sequence exploitation EPICs primers |
| CN108048530B (en) * | 2018-01-23 | 2021-07-27 | 广州大学 | Method for developing EPICs primer based on EST sequence |
| CN109486958A (en) * | 2018-09-26 | 2019-03-19 | 浙江海洋大学 | A kind of EPIC molecular labeling for Sciaenidae fish Phylogenetic Analysis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Uitdewilligen et al. | A next-generation sequencing method for genotyping-by-sequencing of highly heterozygous autotetraploid potato | |
| Bajaj et al. | EcoTILLING-based association mapping efficiently delineates functionally relevant natural allelic variants of candidate genes governing agronomic traits in chickpea | |
| Solano et al. | When morphological identification meets genetic data: the case of Lucanus cervus and L. tetraodon (Coleoptera, Lucanidae) | |
| Seo et al. | Genetic diversity analysis of South and East Asian duck populations using highly polymorphic microsatellite markers | |
| Hoque et al. | Discrimination of Korean native chicken populations using SNPs from mtDNA and MHC polymorphisms | |
| Ejaz et al. | Genetic variation for markers linked to stem rust resistance genes in Pakistani wheat varieties | |
| Hansen et al. | Development of microsatellite markers in Abies nordmanniana (Stev.) Spach and cross‐species amplification in the Abies genus | |
| CN104928367A (en) | Shellfish distant hybridization offspring genetic identification method | |
| Zou et al. | Characterization of 18 polymorphic microsatellite loci in the red‐crowned crane (Grus japonensis), an endangered bird | |
| MY184632A (en) | A method of identifying parentage in freshwater prawn macrobrachium rosenbergii | |
| Nater et al. | New polymorphic tetranucleotide microsatellites improve scoring accuracy in the bottlenose dolphin Tursiops aduncus | |
| Gross et al. | Development and characterization of novel tetranucleotide microsatellite markers in the noble crayfish (Astacus astacus) suitable for highly multiplexing and for detecting hybrids between the noble crayfish and narrow-clawed crayfish (A. leptodactylus) | |
| NZ602418A (en) | Use of brown midrib-3 gene specific markers in maize for trait introgression | |
| CN104004750B (en) | A kind of SNP marker relevant to mitten crab sexual prematurity proterties and application thereof | |
| Foria et al. | InDel markers for monitoring the introgression of downy mildew resistance from wild relatives into grape varieties | |
| 林晓煜 et al. | Development and validation of sex-specific SNP markers in Larimichthys crocea | |
| De Lorenzis et al. | Genetic investigation of grapevine varieties ‘Ribolla Gialla’(Italy),‘Rebula’(Slovenia) and ‘Robola’(Ionian Islands) | |
| Sharma et al. | Efficacy of two dominant marker systems, ISSR and TE-AFLP for assessment of genetic diversity in biodiesel species Pongamia pinnata | |
| CN111560464A (en) | Molecular marker IWB59718 and application thereof in detection of wheat stripe rust resistance | |
| Khan et al. | TILLING and Eco-TILLING–A reverse genetic approach for crop improvement | |
| Wu et al. | Recombinant microsatellite amplification: a rapid method for developing simple sequence repeat markers | |
| Vollmer et al. | Developing genomic resources for the common bottlenose dolphin (Tursiops truncatus): isolation and characterization of 153 single nucleotide polymorphisms and 53 genotyping assays | |
| Yang et al. | Limitation of high-resolution melting curve analysis for genotyping simple sequence repeats in sheep | |
| CN103605913A (en) | Method applied to identification of pacific oyster family | |
| Pacioni et al. | Capturing genetic information using non-target species markers in a species that has undergone a population crash |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150923 |
|
| RJ01 | Rejection of invention patent application after publication |