CN104911161B - A kind of neutral phytase and its applied in aquatic feeds - Google Patents
A kind of neutral phytase and its applied in aquatic feeds Download PDFInfo
- Publication number
- CN104911161B CN104911161B CN201510405775.1A CN201510405775A CN104911161B CN 104911161 B CN104911161 B CN 104911161B CN 201510405775 A CN201510405775 A CN 201510405775A CN 104911161 B CN104911161 B CN 104911161B
- Authority
- CN
- China
- Prior art keywords
- phytase
- phytic acid
- enzyme activity
- mutant
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
- C12Y301/03008—3-Phytase (3.1.3.8)
Abstract
The invention provides a kind of novel neutral phytase, phytase PHYA is transformed by the method for random mutation, obtain a kind of mutant protein, its amino acid sequence is SEQ ID NO：5.The phytic acid enzyme mutant PHYAT5 optimal reactions pH that the present invention is screened is 6.5, in the range of pH6.5 7.0, can keep more than 80% enzyme activity, when pH is 8.0, remains to keep 35% enzyme activity, achieves unexpected technique effect.Compared with wild type, enzyme activity levels of the phytic acid enzyme mutant PHYAT5 in neutral range is significantly improved, and optimal reactive temperature does not occur significant change.The phytic acid enzyme mutant can be widely applied in aquatic feeds, so as to advantageously reduce the addition of inorganic phosphate in feed, aquaculture cost be reduced, while pollution of the aquatic livestock fecal phosphorus to environment can also be reduced effectively.
Description
Technical field
The invention belongs to gene engineering technology field, particular content is related to a kind of neutral phytase mutant and its in aquatic products
Application in feed.
Technical background
Phosphorus is one of important mineral element necessary to fish, fish body to phosphorus the need for amount be higher than other mineral elements but feeding
Excessive phosphorus is considered as one of the key factor for causing body eutrophication in material.Therefore, by improving fish in raw material
The utilization rate of phosphorus, the content of phosphorus in appropriate adjustment feed makes it closer to measuring the need for fish to reduce the discharge of cultured fishes phosphorus
Amount, is the important channel for reducing water environment pollution.
Phytase as a kind of enzyme preparation produced by microbial fermentation, decomposable asymmetric choice net phytic acid and phytate, in promoting feed
The decomposition of phytic acid and phytate, makes phosphorus, the endogenous enzyme of phosphate radical combination and other nutrients be released and utilize, and reduces excrement
Pollution of the phosphorus to environment, saves the addition of inorganic phosphate.Multinomial research has shown that, the phytic acid enzymes extraction part phosphorus in aquaculture
Acid dihydride calcium shows preferable culture efficiency and environmental benefit.Luo Lin etc. (2007) shows to use in the perch experimental study of basic flower
It is feasible that neutral phytase part substitutes calcium dihydrogen phosphate, and show that neutral phytase 1000U/kg substitutes 80% or so
Calcium dihydrogen phosphate synthesis growth result it is optimal, also demonstrate that neutral phytase has certain wide spectrum application.Recent research is also
Show that neutral phytase is having stomach and without stomach aquatic livestock showing preferable performance, can discharge big in aquatic livestock intestines and stomach
The available phosphorus of amount.
But currently marketed phytase is based on Phytase, the active highest under the conditions of pH 2.5 and 5.5, and
In without stomach digestive canal of aquatic animal, due to the secretion without hydrochloric acid in gastric juice, pH is unfavorable for that Phytase is sent out about in neutrality in alimentary canal
The effect of waving.Therefore it is badly in need of a kind of phytase that there is high enzyme to live in neutral pH range of exploitation at present.
The content of the invention
The present invention is solution prior art problem, there is provided a kind of novel neutral phytase and its application.The present invention passes through
The method of random mutation is transformed phytase PHYA, obtains a kind of mutant protein, and its pH scope of application is more biased towards neutrality
Condition, is conducive to its extensive use in aquatic feeds.
One aspect of the present invention provides a kind of phytase, and its amino acid sequence is SEQ ID NO：1.
A kind of nucleotides sequence of encoding gene of the phytase is classified as SEQ ID NO：2.
Another aspect of the present invention provides a kind of phytic acid enzyme mutant, is that amino acid sequence is SEQ ID NO：1 phytic acid
What the mutation of enzyme was obtained, a kind of its amino acid sequence is SEQ ID NO：3 or 5, corresponding coding nucleotide sequence is SEQ ID
NO：4、6.
Another aspect of the present invention is provided and carries coded sequence for SEQ ID NO：3 or 5 phytic acid enzyme mutant gene
Plasmid.
Further aspect of the present invention provides a kind of recombinant aspergillus niger, is to be transferred to above-mentioned plasmid to be built in aspergillus niger to obtain
's.
Applied in aquatic feeds present invention also offers above-mentioned phytic acid enzyme mutant.
The phytic acid enzyme mutant PHYAT5 optimal reactions pH that the present invention is screened is 6.5, in the range of pH6.5-7.0, energy
More than 80% enzyme activity is kept, when pH is 8.0, remains to keep 35% enzyme activity, achieve unexpected technique effect.With
Wild type is compared, and enzyme activity levels of the phytic acid enzyme mutant PHYAT5 in neutral range is significantly improved, optimal reactive temperature
Generation significant change.The phytic acid enzyme mutant can be widely applied in aquatic feeds, so as to advantageously reduce nothing in feed
The phosphatic addition of machine, reduces aquaculture cost, while pollution of the aquatic livestock fecal phosphorus to environment can also be reduced effectively.
Brief description of the drawings
Fig. 1 is the pH- of phytase PHYA, PHYAT3 and PHYAT5 with respect to enzyme activity curve map；
Fig. 2 is the temperature-relative enzyme activity curve map of phytase PHYA, PHYAT3 and PHYAT5.
Specific embodiment
The present invention has used routine techniques and the method that genetic engineering and biology field are used, for example
MOLECULAR CLONING:A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT
Described method in PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003).These general bibliography
There is provided definition well known by persons skilled in the art and method.But, those skilled in the art can be described in the present invention
Technical scheme on the basis of, other conventional method, experimental program and reagents using this area, and be not limited to of the invention specific
The restriction of embodiment.
With reference to specific embodiment, the present invention will be described in detail.
The acquisition of the phytase gene of embodiment 1
According to the gene order in public gene database, optimize the codon of synthetic gene and artificial synthesized derive from
(sequence is SEQ ID NO to the phytase gene PHYA of aspergillus niger (Aspergillus niger)：2), the amino acid sequence of its coding
It is classified as SEQ ID NO：1.
PCR primer and reaction condition are as follows：
Primer 1 (F)：GCGCGAATTCATGAGCTTCCGGTCCCTG
Primer 2 (R)：TAAAGCGGCCGCTTAGGCGAAGCACTCGGC
Reaction condition is：94 DEG C of denaturation 5min；Then 94 DEG C are denatured 30s, 56 DEG C of renaturation 30s, and 72 DEG C extend 1.5min, 30
After individual circulation, 72 DEG C of insulation 10min.Agarose electrophoresis result shows that PHYA gene sizes are 1395bp.
The structure of the phytic acid enzyme mutant of embodiment 2 and screening
In order to improve the enzyme activity level in neutral conditions of phytase PHYA, applicant is by directed evolution technologies to this
Enzyme has carried out the screening of mass mutation.
With PHYA genes as template, with the GeneMorph II random mutation PCR kits of primer described in embodiment 11,2
(Stratagene) enter performing PCR amplification, glue reclaim PCR primer, EcoRI, NotI carry out after digestion treatment with after same digestion
The connection of pET21a carriers, to LB+Amp flat boards in e. coli bl21 (DE3), are coated, 37 DEG C are inverted culture for conversion, wait to turn
After beggar occurs, chosen one by one with toothpick to 96 orifice plates, the LB+Amp cultures that 150ul contains 0.1mM IPTG are added in each hole
Base, 37 DEG C of 220rpm cultivate 6h or so, and supernatant is abandoned in centrifugation, and thalline is resuspended with the buffer solution of pH 5.0, multigelation broken wall, is obtained
Bacillus coli cells lysate containing phytase muton.
40 μ l lysates to two pieces of 96 new orifice plates are taken out respectively, it is one of to be diluted in the buffer solution of pH 5.0, separately
One piece is diluted in the buffer solution of pH 7.0, is separately added into 20 μ l substrates of same pH, after reacting 30min in 37 DEG C, adds
40ul terminate liquids are mixed with terminating reaction, and room temperature places 10min colour developings, and light absorption value is determined at spectrophotometer 415nm.Experiment knot
Fruit shows：Enzyme activity of most of phytic acid enzyme mutant under the conditions of pH 5.0 is only few higher than the enzyme activity under the conditions of pH 7.0
Numerical mutation body enzyme activity under the conditions of pH 7.0 is higher than the enzyme activity under the conditions of pH 5.0, and also some mutant are in the Hes of pH 5.0
Enzyme activity level under the conditions of pH7.0 before mutation than declining to a great extent.Applicant is by the enzyme activity level under the conditions of pH 7.0
The mutant for being significantly higher than the enzyme activity under the conditions of pH 5.0 carries out DNA sequencing, and being finally obtained can improve phytase PHYA in
The mutation combination of enzyme activity level in the range of property pH：The point mutation body of S87R, G159K, S198D tri- and A66P, N102R, S189R,
The point mutation body of S190P, T270K five.
The point mutation body of S87R, G159K, S198D tri- is named as PHYAT3, its amino acid sequence is SEQ ID NO：3, its
Coding nucleotide sequence is SEQ ID NO：4.
The point mutation body of A66P, N102R, S189R, S190P, T270K five is named as PHYAT5, its amino acid sequence is
SEQ ID NO：5, its coding nucleotide sequence is SEQ ID NO：6.
The structure of the recombinant expression carrier of embodiment 3
Expand the genetic fragment of phytic acid enzyme mutant PHYAT3 and PHYAT5 respectively using PCR, primer two ends introduce XbaI
Site.Primer sequence is as follows：
Primer 3 (F)：GCTCTAGAATGAGCTTCCGGTCCCTG
Primer 4 (R)：GCTCTAGATTAGGCGAAGCACTCGGC
PCR reaction conditions are：94 DEG C of denaturation 5min；Then 94 DEG C are denatured 30s, 56 DEG C of renaturation 30s, 72 DEG C of extensions
1.5min, after 30 circulations, 72 DEG C of insulation 10min.Agarose gel electrophoresis result shows that PHYAT3, PHYAT5 gene are big
The fragment of small 1395bp.
Phytic acid enzyme mutant PHYAT3 and the PHYAT5 genetic fragment of above-mentioned acquisition is carried out respectively with expression vector pGAU
Restriction enzyme XbaI single endonuclease digestions, digestion condition is as follows：
37 DEG C of water-bath digestions process 2h, and two purpose fragments are separately recovered after electrophoresis, are dissolved in 20ul ddH2O.Use T4DNA
Ligase is attached, and linked system is as follows：
22 DEG C of connection 1h, convert escherichia coli DH5a competence, are coated with LB+AMP flat boards, and list is grown after 37 DEG C of overnight incubations
Bacterium colony, the bacterium colony PCR checking correct transformants of connection extract plasmid and send sequencing, after sequencing correctly, i.e., are contained phytic acid respectively
The recombinant vector pGAU-PHYAT3 and pGAU-PHYAT5 of enzyme mutant PHYAT3 and PHYAT5 gene.
Built using above-mentioned same method and obtain the recombinant vector pGAU-PHYA containing phytase PHYA genes.
The recombination expression of the phytic acid enzyme mutant of embodiment 4
It is prepared by protoplast：Inoculated aspergillus niger host is in PDA+U flat boards, 30 DEG C of culture 5-7d；Extract 2cm × 2cm sizes
Bacterium block, be inoculated in 100ml liquid PDA+U culture mediums, 30 DEG C culture 24h growth mycelium, for converting.The bacterium that will have been grown
It is resuspended with 20ml 1.2M Adlerikas after filament filtering, add 0.2g lysozymes.30 DEG C, 100rpm cultures 2-3h.To split
The mycelia for having solved is filtered with 2 layers of lens wiping paper, and 3000rpm centrifugations 10min obtains protoplast.
Conversion：Protoplast is cleaned 2 times with 1.2M sorbitol solutions, then resuspended with appropriate sorbitol solution, is made primary
Plastid concentration reaches 108.The ready recombinant vectors of 10ul are added in 200ul protoplasts, adds 50ul's 25%
PEG6000, ice bath 20min, the PEG6000 room temperatures for adding 2ml 25% place 5min, add 4ml sorbitol solutions reverse mixed
It is even.After pouring into 50ml conversion upper strata culture mediums, in pouring into 4 conversion lower floor flat boards, after after the culture medium solidifying of upper strata, in 30 DEG C
Culture 5d is inverted in incubator.
Transformant screening：After culture 5d, the bacterium colony that picking grows, dibbling carries out secondary screening, 30 DEG C of trainings to conversion lower floor flat board
Support 2d.The transformant of normal growth is inoculated into fresh PDA plate, 30 DEG C of culture 5-7d respectively.Each transformant extracts 2cm
The bacterium block of × 2cm sizes, is inoculated in fermentation in 50ml liquid submerged culture bases respectively, and 32 DEG C of culture 5d add appropriate amounts of ammonia daily
Water, pH is 4.5 or so for control.After culture 5d, centrifugation thalline obtains supernatant and is crude enzyme liquid, carries out protein electrophoresis detection, sieves
Select the positive transformant for having obvious protein band expression.One of recombination expression phytase PHYA that applicant will screen
Positive transformant be named as aspergillus niger Phya (Aspergillus niger Phya), a recombination expression phytic acid enzyme mutant
The positive transformant of PHYAT3 is named as aspergillus niger Phyat3 (Aspergillus niger Phyat3), and a recombination expression is planted
The positive transformant of sour enzyme mutant PHYAT5 is named as aspergillus niger Phyat5 (Aspergillus niger Phyat5).
The fermented supernatant fluid of aspergillus niger Phya, aspergillus niger Phyat3 and aspergillus niger Phyat5 is carried out into phytase activity inspection
Survey, while being compareed with aspergillus niger Host Strains fermented supernatant fluid.Result shows：The fermented supernatant fluid enzyme activity of aspergillus niger Host Strains is only
It is 8.4U/ml, and the fermented supernatant fluid enzyme activity of aspergillus niger Phya, aspergillus niger Phyat3 and aspergillus niger Phyat5 is respectively 168U/
Ml, 136U/ml and 110U/ml.So as to further illustrate, recombinant bacterium aspergillus niger Phya, aspergillus niger Phyat3 that the present invention builds
Phytase PHYA, PHYAT3 and PHYAT5 can be respectively recombinantly expressed with aspergillus niger Phyat5.
(1) definition of phytase activity unit
It is per minute to discharge 1 μm of ol from the sodium phytate solution that concentration is 5mg/ml under conditions of 37 DEG C, pH value are for 5.0
Enzyme amount required for Phos is an enzyme activity unit U.
(2) enzyme activity determination method
The sodium phytate solution (preparation of pH5.00.25mol/L acetate buffers) that 4ml concentration is 7.5mmol/L is taken, is added to
In colorimetric cylinder, 37 DEG C of balance 5min add 2ml through the suitably dilution of pH5.00.25mol/L acetate buffers and through 37 DEG C of balances
Good phytase enzyme liquid, mixes in 37 DEG C of accurate insulation reaction 30min.After reaction terminates, (2 parts of nitric acid are molten to add 4ml terminate liquids
Liquid (nitric acid：Water=1:2), 1 part of 100g/L ammonium molybdate solution, 1 part of 2.35g/L Ammonium Vanadate Solution), mix with terminating reaction.So
Room temperature places 10min colour developings afterwards, and light absorption value is determined at spectrophotometer 415nm.
Enzyme activity computing formula：
U=(A-A0-0.0016)×F/(0.0415×30)
In formula：A is the light absorption value of sample；A0It is the light absorption value of blank sample；F is the total dilution times before actual sample liquid reaction
Number；30 is enzyme digestion reaction time, min.
The characterization analysis of embodiment 6
1st, most suitable action pH analysis
2.0,2.5,3.0,4.0,5.0,5.5,6.0,6.5,7.0,8.0 buffer solution is respectively using pH value, respectively will
Aspergillus niger Phya, aspergillus niger Phyat3 and aspergillus niger Phyat5 fermented supernatant fluids are diluted measure, and sodium phytate is also respectively with right
The buffer of pH value is answered, phytase activity measure is carried out at 37 DEG C, calculate enzyme activity, be 100% with highest enzyme activity, calculated
With respect to enzyme activity, pH- is with respect to enzyme activity curve.
Result as shown in figure 1, the optimal reaction pH of wild type phytase PHYA is 5.5, the phytase PHYA when pH is 6.5
Relative enzyme activity be rapidly reduced to 30%, and when pH is higher than 7.0, its enzyme activity is almost reduced to 0；And phytic acid enzyme mutant PHYAT3
Optimal reaction pH with PHYAT5 is 6.5, in the range of pH6.5-7.0, more than 80% enzyme activity level can be kept, when pH is
When 8.0, PHYAT3 and PHYAT5 remains to keep respectively 20% and 35% enzyme activity, achieves unexpected technique effect.
2nd, optimum temperature analysis
Respectively at 30 DEG C, 35 DEG C, 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, 65 DEG C, 70 DEG C, under the conditions of pH5.0, determine black
The phytase activity of aspergillus Phya, aspergillus niger Phyat3 and aspergillus niger Phyat5 fermented supernatant fluids, is 100% with highest enzyme activity,
Relative enzyme activity is calculated, temperature-relative enzyme activity curve is done.Result is as shown in Fig. 2 the optimal reactive temperature of wild type phytase PHYA
It is 55 DEG C, and the optimal reactive temperature of phytic acid enzyme mutant PHYAT3 and PHYAT5 is consistent with wild type phytase PHYA.
To sum up, compared with wild type phytase, two phytic acid enzyme mutants PHYAT3 and PHYAT5 that the present invention is screened
Enzyme activity level in neutral range is significantly improved, and optimal reactive temperature does not occur obvious change.The phytase is dashed forward
Variant can be widely applied in aquatic feeds, so as to advantageously reduce the addition of inorganic phosphate in feed, reduce aquaculture cost,
Can also effectively reduce pollution of the aquatic livestock fecal phosphorus to environment simultaneously.
Claims (6)
1. a kind of phytic acid enzyme mutant, it is characterised in that the amino acid sequence of the phytic acid enzyme mutant is SEQ ID NO：5.
2. a kind of gene, it is characterised in that the phytic acid enzyme mutant described in described gene code claim 1.
3. gene as claimed in claim 2, it is characterised in that the nucleotides sequence of described gene is classified as SEQ ID NO：6.
4. a kind of recombinant plasmid, described recombinant plasmid carries the gene described in claim 2.
5. a kind of recombinant aspergillus niger, it is characterised in that the weight that described recombinant aspergillus niger conversion/transfection is had the right described in requirement 4
Group plasmid.
6. application of the phytic acid enzyme mutant described in claim 1 in aquatic feeds are prepared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510405775.1A CN104911161B (en) | 2015-07-10 | 2015-07-10 | A kind of neutral phytase and its applied in aquatic feeds |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510405775.1A CN104911161B (en) | 2015-07-10 | 2015-07-10 | A kind of neutral phytase and its applied in aquatic feeds |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104911161A CN104911161A (en) | 2015-09-16 |
| CN104911161B true CN104911161B (en) | 2017-06-13 |
Family
ID=54080605
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510405775.1A Active CN104911161B (en) | 2015-07-10 | 2015-07-10 | A kind of neutral phytase and its applied in aquatic feeds |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104911161B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011101B (en) * | 2016-07-06 | 2019-03-26 | 中国农业科学院饲料研究所 | Phytic acid enzyme mutant YkAPPA-L162V and its encoding gene and application |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101457210B (en) * | 2008-05-28 | 2011-09-07 | 武汉新华扬生物股份有限公司 | Neutral phytase PHYMJ11 and gene and application thereof |
| CN103468660B (en) * | 2013-09-26 | 2016-01-20 | 盐城工学院 | High reactivity neutral phytase mutant and gene thereof and purposes |
-
2015
- 2015-07-10 CN CN201510405775.1A patent/CN104911161B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| Phytase gene [Aspergillus niger].;Mullaney, E.J.,等;《Genbank登录号：AAA32705.1》;19930427;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104911161A (en) | 2015-09-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104911160B (en) | A kind of neutral phytase mutant and its application | |
| EP3438253B1 (en) | Phytase mutant | |
| CN102787130B (en) | Acid and high temperature resistant alpha-amylase, and its gene, engineering bacterium and preparation method | |
| CN103261409B (en) | Mannanase, coding gene and production thereof | |
| CN102002487B (en) | Optimized and improved high temperature resistance phytase PHYTH as well as gene and application thereof | |
| CN104263710B (en) | A kind of beta galactosidase combination mutant with high transglycosylation and its preparation method and application | |
| CN110029120B (en) | Phytase high-yield strain and application thereof | |
| CN101240285A (en) | Cephalosporin C acrylase and its vector and application | |
| CN104560920B (en) | A kind of acidic xylan enzyme mutant and its application | |
| CN103305536A (en) | Laccase gene, engineering bacteria and application | |
| CN107164344A (en) | One class heat-resistance phytase mutant and its encoding gene and application | |
| CN105936910A (en) | Optimized glucose oxidase gene GOD, expression vector and applications thereof | |
| CN103627686B (en) | Xylanase mutant and application thereof | |
| CN104911161B (en) | A kind of neutral phytase and its applied in aquatic feeds | |
| CN106119219A (en) | Glucoseoxidase mutant that enzymatic activity improves and expression vector and application | |
| CN111424048B (en) | Gene for expressing acidic beta-mannase, vector and application thereof | |
| CN109022396A (en) | The alpha-amylase mutant and its application that a kind of enzyme activity improves | |
| CN103352031A (en) | Glycosyltransferase gene and application thereof | |
| CN114736881B (en) | Glucose oxidase GoxM10 mutant A4D with improved acid stability and derivative mutant and application thereof | |
| CN104404012B (en) | A kind of novel phytase | |
| CN108517329A (en) | A kind of recombination Yarrowia lipolytica lipase and its expression bacterial strain and application | |
| CN114736880A (en) | Mutant D497N of glucose oxidase GoxM10 with improved acid stability as well as derivative mutant and application thereof | |
| CN109161489B (en) | Aspergillus niger strain with high yield of acid protease | |
| CN114395544A (en) | High specific activity phytase mutant | |
| CN106381273B (en) | The Aspergillus niger strain of one plant height production zytase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Xu Xiaodong Inventor after: Zhang Xia Inventor after: Li Shuxun Inventor after: Yu Hong Inventor after: Zhang Jifu Inventor after: Wu Xiuxiu Inventor after: Wang Huaming Inventor before: Xu Xiaodong Inventor before: Zhang Xia Inventor before: Wu Xiuxiu Inventor before: Wang Huaming |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |