CN104906125A - Application of microRNA-326 inhibitor to the preparation of medicament for treating cataract - Google Patents

Abstract

The present invention relates to application of a microRNA-326 inhibitor to the preparation of medicaments for treating cataract. By experiments, the present invention proves that microRNA-326 can inhibit the expression of FGF1 to further achieve down-regulation of expression of betaB2 crystal protein; and the content change if betaB2 crystal protein is a key factor in cataract, and the down-regulation of expression of betaB2 crystal protein causes cataract. The invention suggests that inhibition of microRNA-326 can be used for the treatment of cataract, and microRNA-326 can be used as marker for cataract diagnosis.

Description

The application of inhibitor in the cataractous medicine of preparation treatment of microRNA-326

Technical field

The present invention relates to technical field of molecular biology, specifically, relate to the application of inhibitor in the cataractous medicine of preparation treatment of microRNA-326.

Background technology

Every a variety of causes is as aging, hereditary, local malnutrition, immunity and Developmental and Metabolic Disorder, wound, poisoning, radiation etc., crystalline lens metabolism disorder can be caused, cause crystallins degeneration and muddiness occurs, be called cataract, now light is obstructed by muddy crystalline lens and cannot project on the retina, causes blurred vision.Be more common in more than 40 years old, and sickness rate increases with age growth.

MicroRNAs (miRNAs) is the endogenic non-coding RNA with adjusting function of a class found in eukaryote.Ripe miRNAs is produced by the shearing of longer primary transcript through a series of nuclease, be assembled into silencing complex (the RNA-induced silencing complex of RNA induction subsequently, RISC), by the mode identification said target mrna of base pair complementarity, and instruct silencing complex degraded said target mrna according to the difference of complementarity or check the translation of said target mrna.Research shows that miRNAs participates in various adjustment approach, comprises growth, virus defense, hematopoiesis, orga-nogenesis, cell proliferation and apoptosis, lipid metabolism etc.

MicroRNA-326 plays an important role in the morbidity of regulation and control kinds of tumors, and have bibliographical information, the expression of microRNA-326 is relevant to the prognosis of the esophageal carcinoma; Also play a significant role in the tumor such as colorectal cancer, glioma, up-regulated in MS patient and playing a role by acting on CD47, in pulmonary fibrosis patient, regulate and control the short Fibrosis parameters of the TGF-β factor, also have and report that microRNA-326 can as the couple candidate detection target spot of clinical drug therapy.

BetaB2 crystallin (CRYBB2) is in close relations with cataractous generation, there are some researches show, in cataract patient's crystalline lens, it expresses (the Huang CH that declines, Wang YT, Tsai CF, Chen YJ, Lee JS, Chiou SH.Phosphoproteomics characterization of novel phosphorylated sites of lens proteins from normal and cataractous human eye lenses.Molecular Vision 2011, 17:186-198.), CRYBB2 gene mutation often occurs on exon 6, cause amino acids fold abnormal, thus cause lens structure abnormal, reduce the stability under its water-soluble state, the crystalline lens transparency is caused to change, finally cause generation (the Chen W of congenital cataract, Chen X, Hu Z, Lin H, Zhou F, Luo L, Zhang X, Zhong X, Yang Y, Wu C, Lin Z, Ye S, Liu Y.A Missense Mutation in CRYBB2Leads to Progressive Congenital Membranous Cataract by Impacting the Solubility and Function of bB2-Crystallin.PLoS One.2013, 8 (11): e81290.).This seminar construct CRYBB2 gene knock-out mice model (Zhang Jun, Huang Caiguo, Li Wenjie, Wei Weng, Wang Jiaqi. the foundation of β B2 crystal protein gene knock-out mice model. The 2nd Army Medical College journal .2006; 27 (11): 1246-1248.), and carry out the correlational study of CRYBB2 always, and find CRYBB2 knock out mice several months interior generation cortical cataract after birth under study for action, its degree increases with the age and increases the weight of (Zhang J, Li J, Huang C, Xue L, Peng Y, Fu Q, Gao L, Zhang J, Li W.Targeted Knockout of the Mouse β B2-crystallin Gene (BetaB2) Induces Age-Related Cataract.Invest Ophthalmol Vis Sci, 2008; 49 (12): 5476-5483.).

Summary of the invention

The object of the invention is, for deficiency of the prior art, to provide the purposes of the inhibitor of microRNA-326.

Of the present invention again one object be that a kind of DNA sequence being used for the treatment of cataract or lenticular opacities is provided.

Another object of the present invention provides a kind of genophore being used for the treatment of cataract or lenticular opacities.

4th object of the present invention is, is provided for the purposes of the reagent detecting microRNA-326 content.

For realizing above-mentioned first object, the technical scheme that the present invention takes is:

First aspect, the application of inhibitor in the cataractous medicine of preparation treatment of microRNA-326.

Second aspect, the application of inhibitor in the medicine of preparation treatment lenticular opacities of microRNA-326.

The third aspect, the inhibitor of microRNA-326 is preparing the application in medicine, and described medicine is used for the treatment of betaB2 crystallin and lowers the disease caused.

The inhibitor of described microRNA-326 is selected from siRNA, dsRNA, shRNA, Microrna, the antisensenucleic acids that can reduce microRNA-326 content; Maybe can express or be formed the construction of described siRNA, dsRNA, Microrna, antisensenucleic acids.

Preferably, the inhibitor of described microRNA-326 is the DNA sequence shown in SEQ ID NO.10 6-25bp or SEQ ID NO.11 6-25bp.

Preferably, the inhibitor of described microRNA-326 is for comprising the genophore of DNA sequence shown in SEQ ID NO.10 6-25bp or SEQ ID NO.11 6-25bp.

For realizing above-mentioned second object, the technical scheme that the present invention takes is:

Be used for the treatment of a DNA sequence for cataract or lenticular opacities, described DNA sequence is as shown in SEQ ID NO.10 6-25bp or SEQ ID NO.11 6-25bp.

For realizing above-mentioned 3rd object, the technical scheme that the present invention takes is:

A kind of genophore, described genophore is containing, for example the DNA sequence shown in SEQ ID NO.10 6-25bp or SEQ ID NO.11 6-25bp.

For realizing above-mentioned 4th object, the technical scheme that the present invention takes is:

For detecting the application of reagent in the reagent preparing diagnosis cataract or lenticular opacities of microRNA-326 content.

The invention has the advantages that:

1, the present invention confirms that microRNA-326 can suppress the expression of FGF1 by experiment, thus lower the expression of betaB2, and the change of betaB2 crystalline protein content is the key factor that cataract occurs, the downward of betaB2 crystalline protein expression will cause cataract.The present invention's prompting treats cataract by suppressing microRNA-326, and microRNA-326 can be used as the mark of Diagnosis of Cataract simultaneously;

2, the invention provides the inhibitor of a kind of microRNA-326, its inhibitory action is very remarkable, can be used for the treatment of cataract or opacity of lens.

Accompanying drawing explanation

Fig. 1. luciferase reporter gene carrier pmirGLO collection of illustrative plates.

Fig. 2. expression vector pLKO.1 collection of illustrative plates.

Fig. 3. green fluorescence protein expression carrier pEGFP-N1 collection of illustrative plates.The restriction map of pEGFP-N1 carrier and multiple clone site (MCS).(single restriction site is by overstriking).After Not I site is positioned at EGFP terminator.The DNA in Xba I site (*) is methylated by CLONTECH company.If you want with this carrier of enzymic digestion, you need that this vector is entered dam-type escherichia coli and prepare new DNA.

Fig. 4 .miRNA cDNA microarray figure, picture display miR-326, miR-204, miR-330-5p specificity in newborn rat low expression, and in adult rats high expressed, and relevant to mice visual system.

MiRNA examination in Fig. 5 .betaB2 knock out mice serum, after result display CRYBB2 gene knockout, the expression of miR-326 and miR-204 all declines, and miR-326 differential expression is the most obvious.

Fig. 6. transgenic mice genotype identification, what ABC tri-bar segment all increased out is heterozygote, only amplify B band for wild type, only amplify A, C two bar segment be homozygote.

Fig. 7. in the serum of cataract patient, detect the miR-326 of high level.

Fig. 8. luciferase reporter gene experiment confirms that the target gene of miR-326 is FGF1.

Fig. 9 .HLEC-B3 cell transfecting miR-326 analogies, significantly can suppress the expression of FGF1 through RT-PCR and western blot experimental verification display miR-326.

Figure 10 .Anti-miR-326 plasmid transfection HLEC-B3 cell, adopts RT-PCR and western blot to verify, after result display transfection miR-326 suppresses carrier, the expression of FGF1 and CRYBB2 is significantly raised.

Detailed description of the invention

Below in conjunction with accompanying drawing, detailed description of the invention provided by the invention is elaborated.

Embodiment 1

1 materials and methods

1.1 material

1.1.1 object of study

Human lens epithelial cells HLEC-B3 cell line is purchased from the primary primary biological medicine Science and Technology Ltd. in Wuhan.

Mice C57BL/C, Lycoperdon polymorphum Vitt, purchased from The 2nd Army Medical College Experimental Animal Center.

1.1.2 used carrier

Luciferase reporter gene carrier pmirGLO purchased from Promega company, article number Cat.#E1330, Vector map as shown in Figure 1; Expression vector pLKO.1 is purchased from Addgene company, and Vector map as shown in Figure 2; Green fluorescence protein expression carrier pEGFP-N1 purchased from Addgene company, Vector map as shown in Figure 3, plasmid in contrast in this research.

1.1.3PCR primer sequence

Primer	Sequence(5′→3′)	SEQ ID NO.
			R-H-FGF1-F	GCTCACACATTTGCCCCAAG	1
R-H-FGF1-R	GGAGCCAAGAATGTCAGCCT	2
			R-H-CRYBB2-F	ACGATGTACCCAGCTTCCAC	3
R-H-CRYBB2-R	AAAGTCGCTGCTGTCCTTGT	4

1.1.4 object fragment sequence

1) sequence of miR-326 analogies

CCUCUGGGCCCUUCCUCCAG(SEQ ID NO.5)

2) the FGF1 fragment in the wild carrier of pmirGLO-FGF1

A-H-FGF1-miR326-WT-F：

AAACTAGCGGCCGC aAAGATACCCAGAGAGGAAATt (SEQ ID NO.6), wherein underlining font is FGF1 fragment, and two ends are restriction enzyme site.

A-H-FGF1-miR326-WT-R：

CTAGA aTTTCCTCTCTGGGTATCTTTgCGGCCGCTAGTTT (SEQ ID NO.7), wherein underlining font is FGF1 fragment, and two ends are restriction enzyme site.

3) the FGF1 mutant fragments in pmirGLO-FGF1 mutational vector

A-H-FGF1-miR326-Mut-F：

AAACTAGCGGCCGC aAAGATACCAGTAGAGGAAATt (SEQ ID NO.8), wherein underlining font is FGF1 mutant fragments, and two ends are restriction enzyme site.

A-H-FGF1-miR326-Mut-R：

CTAGA aTTTCCTCTACTGGTATCTTTgCGGCCGCTAGTTT (SEQ ID NO.9), wherein underlining font is FGF1 mutant fragments, and two ends are restriction enzyme site.

4) the suppression body sequence of Anti-miR326 and miR326

A-H-Anti-miR326-F:CCGGT cTGGAGGAAGGGCCCAGAGGg (SEQ ID NO.10), wherein underline font for suppressing body sequence, two ends are restriction enzyme site.

A-H-Anti-miR326-R:AATTC cCTCTGGGCCCTTCCTCCAgA (SEQ ID NO.11), wherein underline font for suppressing body sequence, two ends are restriction enzyme site.

1.1.5 main agents

1.1.6 key instrument

CO 2Cell culture incubator (Forma 310)	Thermo company of the U.S.
		Biohazard Safety Equipment (1300Series A2)	Thermo company of the U.S.
Desk centrifuge (Herarus Fresco 21)	Thermo company of the U.S.
		Cryogenic refrigerator (Forma 700Series)	Thermo company of the U.S.
PCR instrument (ABI 7500)	Applied Biosystems company of the U.S.
		Bio-Rad combination type electrophoresis system	Bio-Rad company of the U.S.
Gel imaging system (Tanon GIS 2010)	Shanghai Tian Neng Science and Technology Ltd.
		Fluorescence microscope (LEICA DMRA2)	Nikon company
Intelligence inverted microscope (LEICA DMI 4000B)	Nikon company
		The long multi-functional microplate reader (Tean-safire) of all-wave	TACAN company of Austria
Luminometer (2020n)	Beijing Yuanpinghao Biological Technology Co., Ltd.
		Electronic balance (FA1604S)	Shanghai balance equipment factory
PH meter (PHB-3)	Shanghai instrument three factory
		Electric-heated thermostatic water bath (XMTE-8112)	The grand experimental facilities company limited of upper Nereid

1.2 method

1.2.1miRNA screening and microRNA target prediction

By these bioinformatic databases of PicTar, Sanger miRBase and TargetScan algorithms, Preliminary screening is carried out to the dependency of miRNA and betaB2, find miR-326, miR-204, there is targeting relation between miR-330-5p, miR-491-5p and betaB2, then we apply existing mouse model and verify the miRNA screened.

(1) miRNA extracts

1) get WT group and KO group (betaB2 gene knockout) mice serum 200 μ l respectively, add 1ml Trizol reagent, after vibration mixing, leave standstill 5min;

2) add 200 μ l chloroforms, thermal agitation mixing 15s, leaves standstill 5min;

3) 4 DEG C of centrifugal 15min of 12000g, careful absorption upper strata aqueous phase, is transferred in new centrifuge tube;

4) add isopyknic isopropyl alcohol, put upside down mixing ,-20 DEG C of hold over night;

5) 4 DEG C of centrifugal 10min of 12000g, abandon supernatant; 75% washing with alcohol precipitation, air-dry in super-clean bench;

6) add appropriate DEPC water dissolution precipitation ,-80 DEG C save backup.

(2) miRNA reverse transcription

Employing TaKaRa company primeScript ^tMmiRNA RT-PCR Kit test kit.

1) according to following component preparation reactant liquor (carrying out on ice):

2) reaction condition

37 DEG C of 60min (Poly A tailing and reverse transcription reaction)

85 DEG C of 5s (inactivation reaction of reverse transcription)

(3)PCR

1) according to following component preparation reactant liquor (carrying out on ice):

2) reaction condition

Denaturation: 95 DEG C of 30s

PCR reacts: 40cycles

95℃ 15s

60℃ 30s

1.2.2 cell culture with go down to posterity

Human lens epithelial cells (HLEC-B3) is incubated in the DMEM culture medium containing 10% hyclone, at 37 DEG C, 5%CO ₂cellar culture is carried out under condition.Secondary Culture is carried out when cell density reaches 70%-80%, first discard archeocyte culture fluid, PBS adds the trypsinization 2-3min of 1ml 0.25% after cleaning 2 times, microscopic examination discards trypsin when cell rounding starts to come off, add complete culture solution and stop digestion, and blow and beat into single cell suspension gently with suction pipe, reach in another culture bottle after dilution in proportion, 37 DEG C, 5%CO ₂continue under condition to cultivate, routine observation cell growth status.

1.2.3 luciferase reporter gene experiment

MiRNA and the mRNA binding sequence record doped by TargetScan also synthesizes, load in luciferase reporter gene carrier pmirGLO, then the pmirGLO plasmid of binding sequence and miRNA cotransfection will be comprised in HLEC-B3 cell, if this miRNA really can by being structured in the expression of that section of sequence suppressor gene on pmirGLO, then the luminous intensity of LUC Photinus pyralis LUC Photinus pyralis FL can decline, and the fluorescence intensity of renilla luciferase then can remain unchanged.

(1) miR-326 target-gene sequence Design and synthesis

Based on the method for bioinformatics, by the target-gene sequence of miRBase Targets database lookup Has-miR-326, its DNA sequence of synthetic and complementary series.

(2) anneal

Synthetic single-stranded DNA sequence is diluted to 10 μMs/μ l, annealing forms double chain DNA fragment.Reaction system is as follows:

Mix rear 95 DEG C of heating 3min, then slow coolings to 37 DEG C ,-20 DEG C save backup.

(3) pmirGLO plasmid enzyme restriction and qualification

PmirGLO plasmid enzyme restriction system is as follows:

Mix rear 37 DEG C of reaction 40min.

1) agarose gel electrophoresis

1. join glue: with the agarose gel of TAE buffer 1% concentration, heating makes it abundant dissolving, adds nucleic acid dye by 1:10000, to pour in glue template and to insert comb, natural cooling molding;

2. in above-mentioned DNA sample, the Loading Buffer of 1/6 volume is added, loading after mixing;

3. electrophoresis: 110V electrophoresis 25min;

4. electrophoresis result is observed with gel imaging instrument.

2) glue reclaims

Sugar gel DNA reclaims the operation of test kit TIANgel Midi Purification Kit (DP209) description.

1. in adsorption column CA2, add 500 μ l balance liquid BL, the centrifugal 1min of 12000rpm, outwells the waste liquid in collecting pipe, is placed back in by adsorption column in collecting pipe;

2. single target DNA band is cut (excising unnecessary part) from agarose gel as far as possible, put into clean centrifuge tube, take weight;

3. in blob of viscose, add equimultiple volume sol solutions PN, 10min is placed in 50 DEG C of water-baths, constantly leniently spins upside down centrifuge tube therebetween, to guarantee that blob of viscose fully dissolves;

4. add in an adsorption column CA2 by previous step gained solution, room temperature places the centrifugal 1min of 2min, 12000rpm, outwells the waste liquid in collecting pipe, adsorption column CA2 is put into collecting pipe;

5. in adsorption column CA2, add 600 μ l rinsing liquid PW, the centrifugal 1min of 12000rpm, outwells the waste liquid in collecting pipe, and adsorption column CA2 is put into collecting pipe, repeats once;

6. put back in collecting pipe by adsorption column CA2, the centrifugal 2min of 12000rpm, eliminates rinsing liquid as far as possible; Adsorption column CA2 is placed in room temperature and places several minutes thoroughly to dry;

7. adsorption column CA2 is placed in a clean centrifuge tube, in the middle of adsorbed film, drips appropriate elution buffer EB, room temperature is placed the centrifugal 2min of 2min, 12000rpm and is collected DNA solution.

(4) connect

1) reaction system is as follows:

2) reaction condition: 30min on ice

16℃ 1h

(5) transform

1) take out 2 pipe competent cells (50 μ l/ manage), be placed on thawed on ice;

2) add 5 μ l in every 50 μ l competent cells and connect product, wherein 1 pipe adds connection product, and 1 pipe, as negative control (not adding any DNA), is blown and beaten mixing gently with pipettor, placed 30min on ice;

3) heat shock: 42 DEG C of water-bath 90s;

4) cooled on ice 3-5min is transferred to rapidly;

5) often pipe adds LB culture medium 800 μ l, and 37 DEG C of shaking table incubation 45min, make bacteria resuscitation;

6) the centrifugal 2min of 4000rpm, retains about 100 μ l supernatant, is again spread evenly across by bacterium liquid on the LB Agar Plating containing AMP after mixing, after 37 DEG C of incubators hatch 20min, is inverted dull and stereotyped continuation and cultivates 12-16h;

7) picking monoclonal colony inoculation is in 5ml LB fluid medium (containing antibiotic), 37 DEG C of shaking table incubation 16-18h.

(6) plasmid extraction

The operation of test kit TIANgel Mini Plasmid Kit (DP103) description is taken out with reference to plasmid is little.

1) in adsorption column CP3, add 500 μ l balance liquid BL, the centrifugal 1min of 12000rpm, outwells the waste liquid in collecting pipe, is placed back in by adsorption column in collecting pipe;

2) get the bacterium liquid 1-5ml of above-mentioned cultivation, add in centrifuge tube, the centrifugal 1min of 12000rpm, absorbs supernatant as far as possible;

3) in the centrifuge tube leaving bacterial sediment, add 250 μ l solution P1, use pipettor or turbula shaker that precipitation is thoroughly suspended; Add 250 μ l solution P2, leniently spin upside down and make the abundant cracking of thalline for 6-8 time; Add 350 μ l solution P3, leniently spin upside down 6-8 time immediately, fully mix, now will occur white flock precipitate; The centrifugal 10min of 12000rpm;

4) all transferred to by supernatant in adsorption column CP3, the centrifugal 1min of 12000rpm, outwells the waste liquid in collecting pipe, is put back to by adsorption column in collecting pipe;

5) add 600 μ l rinsing liquid PW, the centrifugal 1min of 12000rpm, outwells waste liquid, and adsorption column CP3 is put into collecting pipe, repeats once;

6) adsorption column CP3 is put into collecting pipe, the centrifugal 2min of 12000rpm, remove rinsing liquid remaining in adsorption column as far as possible;

7) adsorption column CP3 is placed in a clean centrifuge tube, in the middle of adsorbed film, drip 50-100 μ l elution buffer EB, room temperature is placed 2min, 12000rpm centrifugal 2min and is collected in centrifuge tube by plasmid solution.

(7) order-checking and sequence alignment

The carrier of structure is delivered to Shanghai Sheng Gong biological engineering company limited to check order, and carry out sequence alignment.

(8) cell transfecting

Operational approach is see 1.2.4.

(9) reporter gene detects miR-326 to the effect of its target gene

With reference to the operation of luciferase reporter gene activity detection kit (Promega) description.

1) cell harvesting: absorb cell culture fluid, PBS cleans 2 times, adds 1 × PLB cell pyrolysis liquid 500 μ l, room temperature places 15min, gently collecting cell suspension after piping and druming;

2) LUC Photinus pyralis LUC Photinus pyralis FL Activity determination: get 100 μ l LAR II (Luciferase Assay Reagent) and add bottom fluoremetry pipe, then add 20 μ l testing samples, gently after mixing, put into instrument and detect, reading is R1;

3) renilla luciferase Activity determination: get the Stop Reagent that 100 μ l have diluted and add step 2) mensuration pipe in, gently after mixing, put into instrument and detect, reading is R2;

4) R1/R2 represents relative luciferase activity.

1.2.4 cell transfecting

Adopt cationic liposomal transfection method by above-mentioned Transfected Recombinant Plasmid in HLEC-B3 cell, with reference to the operation of Invitrogen company Lipofectamine 2000 transfection reagent box description.

(1) day before transfection, trypsinization HLEC-B3 cell also counts, and is inoculated in 6 orifice plates, adds the DMEM cell culture fluid containing 10%FBS, in 37 DEG C, 5%CO ₂cultivate under condition, start transfection when cell density reaches 70%-80%;

(2) obtain solution A:60 μ l Lipofectamine 2000+1500 μ l Opti-MEM (serum-free, antibiotic-free), after mixing, room temperature leaves standstill 5min gently;

(3) obtain solution B: 1. 20 μ l pmirGLO-miR-326-WT+500 μ l Opti-MEM

②20μl pmirGLO-miR-326-Mut+500μl Opti-MEM

③20μl pmirGLO-Control+500μl Opti-MEM

(4) mix solution A, B gently, solution A be dispensed in solution B, often pipe 500 μ l, after mixing, room temperature leaves standstill 20min gently;

(5) waiting time starts to process cell, absorbs the archeocyte culture fluid in culture plate, washs 2 times with the Opti-MEM culture fluid of serum-free, and then every hole adds 2ml serum-free Opti-MEM culture fluid;

(6) 20min then, drips respectively in 6 orifice plates by above-mentioned 3 pipe mixed liquors, and often pipe point 2 holes (500 μ l/ hole) drip, and waggle culture plate gently, makes transfection cocktail uniform fold in cell surface, 37 DEG C, 5%CO ₂cultivate under condition;

(7) change liquid after cultivating 6h, add the new antibiotic-free DMEM complete culture solution containing 10%FBS and continue to cultivate;

(8), after transfection 48h, collecting cell carries out reporter gene activity detection.

1.2.5Anti-miR-326 the structure of adenovirus expression carrier

Suppressing the adenovirus expression carrier of body by building miR-326, probing into the regulating and controlling effect of miR-326 to betaB2 crystalline protein further in vivo and in vitro.MiR-326 suppresses the carrier that adopts of body to be pLKO.1, the subsidiary U6 promoter of this carrier, can in eukaryotic cell stably express miRNA.Because this carrier is with part slow virus recombinase gene, therefore its expression stability is higher than general carrier, and its recombinase framework carried can also be assembled into slow virus use smoothly.

(1) design and synthesize miR-326 and suppress body oligonucleotide sequence

Design and synthesize miR-326 and suppress body oligonucleotide sequence SEQ ID NO.10 and SEQ ID NO.11.

(2) anneal

Operational approach is the same.

(3) pLKO.1 plasmid enzyme restriction and qualification

1) pLKO.1 plasmid enzyme restriction system is as follows:

Mix rear 37 DEG C of reaction 40min.

2) agarose gel electrophoresis and glue reclaim

Operational approach is the same.

(4) connection, conversion, plasmid extraction, order-checking and sequence alignment

Operational approach is the same.

(5) adenovirus packaging

Shanghai and first Bioisystech Co., Ltd is transferred to carry out adenovirus packaging in the Anti-miR-326 carrier successfully constructed.

1.2.6 real-time fluorescence quantitative PCR

(1) extraction of total serum IgE

1) by Anti-miR-326 Adenovirus Transfection HLEC-B3 cell, cell culture, to exponential phase, discards cell culture fluid, add 1ml Trizol reagent, uniform fold cell surface, standing 5min makes the complete cracking of cell, repeatedly blow and beat cell, then all transfer in the EP pipe of 1.5ml;

2) add 200 μ l chloroforms, thermal agitation mixing 15s, leaves standstill 5min;

3) 4 DEG C of centrifugal 15min of 12000g, careful absorption upper strata aqueous phase, is transferred in new centrifuge tube;

4) add isopyknic isopropyl alcohol, put upside down mixing, leave standstill 10min;

5) 4 DEG C of centrifugal 10min of 12000g, abandon supernatant; 75% washing with alcohol precipitation, air-dry in super-clean bench;

6) add appropriate DEPC water dissolution precipitation ,-80 DEG C save backup.

(2)RT-PCR

1) reverse transcription synthesis cDNA

Adopt the PrimeScript of TaKaRa company ^tMrT Reagent Kit test kit.

1. according to following component preparation reactant liquor (carrying out on ice):

2. reaction condition:

37 DEG C of 15min (reverse transcription reaction),

85 DEG C of 5s (inactivation reaction of reverse transcription).

2)PCR

1. according to following component preparation reactant liquor (carrying out on ice):

2. reaction condition:

Denaturation: 95 DEG C of 30s

PCR reacts: 40cycles

95℃ 5s

60℃ 30s

1.2.7Western blot detects the expression of FGF1 and betaB2 crystalline protein

(1) extraction of total protein of cell

After Anti-miR-326 adenovirus infection HLEC-B3 cell 48h, abandon culture medium, PBS washs 2 times, adds RIPA lysate, places 30min on ice and makes the abundant cracking of cell; All be transferred to by cell pyrolysis liquid in 1.5ml EP pipe, 4 DEG C of centrifugal 20min of 12000rpm, careful Aspirate supernatant is in new EP pipe, and-80 DEG C save backup.

(2) BCA method protein quantification

1) quantity per sample, adds 1 volume BCA reagent B (50:1) by 50 volume BCA reagent A and prepares appropriate BCA working solution, fully for subsequent use after mixing;

2) treat that protein standard substance dissolves completely, get 10 μ l and be diluted to 100 μ l, make final concentration of protein be 0.5mg/ml;

3) standard substance are added in the standard sample wells of 96 orifice plates by 0,1,2,4,8,12,16,20 μ l, add standard dilutions and supply 20 μ l;

4) add 10 μ l protein examples in the sample well of 96 orifice plates, add standard dilutions to 20 μ l, 2 parallel multiple holes established by each sample;

5) every hole adds BCA working solution 200 μ l, hatches 30min for 37 DEG C;

6) measure the absorbance at 562nm place by microplate reader, calculate the concentration of sample according to standard curve.

(3) SDS-PAGE protein electrophoresis

1) in above-mentioned protein example, add 5 × SDS sample-loading buffer of 1/4 volume, after mixing, boil 10min, of short duration centrifugal rear for subsequent use;

2) prepare 15% separation gel 10ml, formula is as follows:

3) carefully separation gel is injected ready glue plate space, every block is about 4ml, drives bubble away with deionized water, leaves standstill 20min, after glue solidifies completely, outwells deionized water above, blotted by water with filter paper;

4) prepare 5% concentrated glue 5ml, formula is as follows:

5) careful injection concentrates glue, and every block is about 2ml, inserts comb rapidly, avoids producing bubble;

6) after glue solidifies completely, carefully pull out comb, prepare application of sample; Two ends add 1 × SDS sample-loading buffer, and the second hole adds Maker, and centre adds protein example, application of sample amount opsin's concentration and determining;

7) electrophoresis: change 120V into after constant voltage 60V electrophoresis to separation gel, treats that bromophenol blue electrophoresis is to separation gel lower limb, stops electrophoresis;

(4) transferring film

First activate pvdf membrane with methanol, foam-rubber cushion-2 metafiltration paper-glue-pvdf membrane-2 metafiltration paper-foam-rubber cushion is followed successively by positive pole from the negative pole of transfer folder, note not producing bubble, whole operating in transferring film buffer is carried out, close clip and put into transfer groove, make the black flour of the black flour corresponding groove of clip, red of flour corresponding groove; Constant current 200mA transferring film 40-50min, in During migration, meeting heat production, need put ice cube to lower the temperature around transfer groove.

(5) immunoreation

1) close: after transferring film terminates, pvdf membrane is put into the plate filling 5% skim milk, close more than 3h or spend the night;

2) primary antibodie: dilute primary antibodie (1:1000 dilutes FGF1,1:500 and dilutes CRYBB2,1:1000 dilution β-actin) with confining liquid or BSA, 4 DEG C of shaking table overnight incubation;

3) film is washed: TBST washs 3 times, each 10min;

4) two resist: 1:2000 dilution two resists, incubated at room 1-2h;

5) film is washed: TBST washs 3 times, each 10min;

(6) exposure imaging

By the two kinds of reagent equal-volume mixing of A, the B in ECL luminescence reagent box, be made into working solution; Pvdf membrane drains by filter paper, drips appropriate working solution and film is infiltrated, put into automatic visualizer and carry out developing and taking pictures.

(7) compound method of agents useful for same

1) 5 × electrophoretic buffer

Tris 15.1g

Glycine 94g

SDS 5.00g

Distilled water is settled to 1000ml

Room temperature preservation after dissolving, the used time dilutes 5 times.

2) 10 × transferring film buffer

Tris 30.3g

Glycine 151.1g

Distilled water is settled to 1000ml

Room temperature preservation after dissolving, the used time dilutes 10 times, and adds methanol to 20% (first add methanol and easily produce precipitation).3) 10 × TBS buffer

Tris 24.2g

NaCl 80.0g

Distilled water is settled to 1000ml

Concentrated hydrochloric acid adjusts pH to 7.6, room temperature preservation after dissolving.

4) 1TBST buffer

10 × TBS buffer 100ml

Distilled water 900ml

Tween-20 1ml

Room temperature preservation after dissolving.

5) confining liquid (5% skim milk)

1 × TBST buffer 95-100ml

Defatted milk powder 5g

Dissolve rear 4 DEG C of preservations, can use in Yu Yizhou.

6) 10% Ammonium Persulfate 98.5 (AP)

Ammonium Persulfate 98.5 0.1g

Distilled water 1ml

Matching while using, after dissolving, 4 DEG C of preservations, the holding time is 1 week.

1.2.8 statistical analysis

All statistical datas represent with means standard deviation, SPSS 20.0 software is adopted first to carry out Normality Analysis and homogeneity of variance analysis to data, then carry out average t inspection, P<0.05 (two-sided test) has statistical significance for difference.

2 results

After 2.1betaB2 gene knockout, miR-326 expresses and significantly reduces

By the analysis to data base, we have found the miRNA of many specificity overexpressions after mice birth, and its signal path is analyzed, finally we have filtered out miR-326 etc. 8 kinds expression after mice birth and have risen, and are considered to the miRNA relevant to mice visual system and carry out verifying (Fig. 4).

The mice that we adopt betaB2 crystal protein gene to knock out is studied, and this mice is betaB2 gene by specific knockdown, age in week can cataract occurred frequently about 6-8.Found by PCR checking, in these transgenic mices, miR-326 is specific low expression status (Fig. 5).The betaB2 gene of these mices, owing to lacking first and second exon, can only express insignificant protein sequence (Fig. 6).Therefore we infer, when body betaB2 gene expression occurs abnormal, can start some mechanism to express miR-326, and miR-326 then can by the expression of some approach regulation and control betaB2.

In addition, we do in the serum of the cataract patient checked coming my institute, detected the miR-326 of high level, and this has also implied that the high expressed of miR-326 may relevant to cataract (Fig. 7).

2.2 Reporter Gene Experiments confirm that the target gene of miR-326 is FGF1

For illustrating the regulating and controlling effect of miR-326 to betaB2, we have carried out bioinformatic analysis to miR-326, find that the possible target gene of miR-326 has 6.The prediction binding sequence of these 6 target genes and miR-326 installs in Reporter gene vector pmirGLO by respectively, then with miR-326 cotransfection in HLEC-B3 cell, the Strength Changes of examining report gene after 24h.Experimental result shows, compared to the matched group of transfection pmirGLO-mock, transfection there occurs significant change containing relative fluorescence element enzyme intensity (Luc/Rlu) of the pmirGLO-miR-326-FGF1 group of FGF1 forecasting sequence (i.e. underlined fragment in SEQ ID NO.6 and SEQ ID NO.7).

For clear and definite relation between the two further, we construct miR-326 predicts binding sequence mutant miR-326-FGF1-Mut (mutant nucleotide sequence is as shown in SEQ ID NO.8 and SEQ ID NO.9) for FGF1, and load in Reporter gene vector pmirGLO.PmirGLO-miR-326-FGF1-Mut and pmirGLO-miR-326-FGF1-WT is transfected in HLEC-B3 respectively, then detects the change of its fluorescence intensity.Result we find, transfection pmirGLO-miR-326-FGF1-WT group significantly declines (Fig. 8) compared to the luciferase intensity of transfection pmirGLO-miR-326-FGF1-Mut group.Therefore can confirm that the target gene of miR-326 is FGF1.

2.3miR-326 suppresses the expression of FGF1

For checking miR-326 is to the inhibitory action of FGF1, we construct the analogies (sequence is as shown in SEQ ID NO.5) of miR-326, by these analogies, (mock sequence is R-H-miR-204-F with miRNA-mock in contrast, TTCCCTTTGTCATCCTATGCCT, SEQ ID NO.12) be transfected into respectively in HLEC-B3.After found that transfection miR-326 analogies, the expression of FGF1 significantly declines, and is tested simultaneously also confirm that miR-326 can suppress the expression (Fig. 9) of FGF1 by western blot.

2.4miR-326 by the expression suppressing FGF1 to regulate and control betaB2 crystalline protein

For checking miR-326 is by the mechanism of action of FGF1 regulation and control betaB2 crystalline protein, we design and construct the suppression carrier pLKO-anti-miR-326 of miR-326.With U6 promoter on the framework of this carrier, can RNA sequence in eukaryotic cell in stably express multiple clone site, we insert the suppression body oligonucleotide sequence of miR-326 in its multiple clone site, its expression product can form local double-strand with miR-326, thus induced silencing complex (RNA-induced silencing complex, RISC) identify and degrade by RNA.

The pLKO-anti-miR-326 plasmid transfection of structure in HLEC-B3, is then detected the content of miR-326 by us.We find that the content of miR-326 significantly declines in this cell, proves that this carrier effectively can suppress the expression of miR-326.On this basis, we have detected the expression of FGF1, and after finding transfection pLKO-anti-miR-326, the expression of FGF1 raises, and its expressing quantity also obviously raises.

Afterwards, we have detected again the expression of betaB2, and after the expression rising of FGF1, the expression of betaB2 also significantly rises.And directly with the plasmid process cell of high expressed FGF1, also draw same result.Therefore, we think that miR-326 suppresses the expression (Figure 10) of betaB2 by FGF1.

On this basis, pLKO-anti-miR-326 is packaged into slow virus by further, then proceeds in HLEC-B3.Found that after miR-326 is suppressed, the expression of FGF1 significantly rises, and synchronous change also appears in the expression of betaB2.

Thus, we confirm that the miR-326 of high-load existence in peripheral blood in patients can suppress the expression of FGF1, thus lower the expression of betaB2.And the change of betaB2 crystalline protein content is the key factor that cataract occurs, the downward of betaB2 crystalline protein expression will cause cataract.The present invention's prompting treats cataract by suppressing miR-326, and miR-326 can be used as the mark of Diagnosis of Cataract.

The above is only the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the prerequisite not departing from the inventive method; can also make some improvement and supplement, these improve and supplement and also should be considered as protection scope of the present invention.

Claims (9)

1.microRNA-326 inhibitor preparation treatment cataractous medicine in application.

2.microRNA-326 inhibitor preparation treatment lenticular opacities medicine in application.

The inhibitor of 3.microRNA-326, preparing the application in medicine, is characterized in that, described medicine is used for the treatment of betaB2 crystallin and lowers the disease caused.

4., according to the arbitrary described application of claim 1-3, it is characterized in that, the inhibitor of described microRNA-326 is selected from siRNA, dsRNA, shRNA, Microrna, the antisensenucleic acids that can reduce microRNA-326 content; Maybe can express or be formed the construction of described siRNA, dsRNA, Microrna, antisensenucleic acids.

5. application according to claim 4, is characterized in that, the inhibitor of described microRNA-326 is the DNA sequence shown in SEQ ID NO.10 6-25bp or SEQ ID NO.11 6-25bp.

6. application according to claim 4, is characterized in that, the inhibitor of described microRNA-326 is for comprising the genophore of DNA sequence shown in SEQ ID NO.10 6-25bp or SEQ ID NO.11 6-25bp.

7. be used for the treatment of a DNA sequence for cataract or lenticular opacities, it is characterized in that, described DNA sequence is as shown in SEQ ID NO.10 6-25bp or SEQ ID NO.11 6-25bp.

8. a genophore, is characterized in that, described genophore is containing, for example the DNA sequence shown in SEQ ID NO.10 6-25bp or SEQ ID NO.11 6-25bp.

9. for detecting the application of reagent in the reagent preparing diagnosis cataract or lenticular opacities of microRNA-326 content.