CN104894242A - MTHFR gene polymorphism detection primer system and kit thereof - Google Patents
MTHFR gene polymorphism detection primer system and kit thereof Download PDFInfo
- Publication number
- CN104894242A CN104894242A CN201510237230.4A CN201510237230A CN104894242A CN 104894242 A CN104894242 A CN 104894242A CN 201510237230 A CN201510237230 A CN 201510237230A CN 104894242 A CN104894242 A CN 104894242A
- Authority
- CN
- China
- Prior art keywords
- situation
- site
- mthfr gene
- primer
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an MTHFR gene polymorphism detection primer. The MTHFR gene polymorphism detection primer comprises a forward primer used when an MTHFR gene c.1298 locus is in an A condition, a reverse primer used when the MTHFR gene c.1298 locus is in the A condition, a forward primer used when the MTHFR gene c.1298 locus is in a C condition, a reverse primer used when the MTHFR gene c.1298 locus is in the C condition, a forward primer used when an MTHFR gene c.677 locus is in the C condition, a reverse primer used when the MTHFR gene c.677 locus is in the C condition, a forward primer used when an MTHFR gene c.677 locus is in the T condition, a reverse primer used when the MTHFR gene c.677 locus is in the T condition, a forward primer for detecting a beta-actin gene and a reverse primer for detecting the beta-actin gene. An MTHFR gene polymorphism detection kit is rapid and convenient to detect, high in sensitivity, high in accuracy rate and low in cost.
Description
Technical field
The present invention relates to a kind of testing product of transgenation and the detection primer used by this product and detection system, belong to biological technical field.
Background technology
Methylene tetrahydrofolate reductase (methylenetetrahydrofolate reductase, MTHFR) be key enzyme in folic acid metabolism system, can 5 be made, 10-methylene tetrahydrofolate is reduced to 5-methyltetrahydrofolate, thus participate in the synthesis of purine, pyrimidine in body and DNA, RNA, the methylating of protein as the indirect donor of methyl, maintain normal homocysteine level in body simultaneously.Mthfr gene polymorphism can cause folic acid metabolism key enzyme activity to reduce, cause folate metabolism disorder, thus cause the generation of multiple heredopathia, the cerebral apoplexy wherein caused with hyperhomocysteinemiainjury and newborn infant's defect as the most serious in Down's syndrome (Down syndrome, DS) etc.It is the key project that folic acid Utilization ability is assessed that mthfr gene detects, and its detected result is that individuation (differentiation) augments folic acid, prevention Newborn Birth-defects provides scientific basis.
The method of carrying out mthfr gene polymorphic detection at present mainly contains chip technology, probe primer technology, enzyme are cut, pyrosequencing techniques and HRM analytical technology etc., and price, loaded down with trivial details or accuracy is not high.Therefore, develop a kind of product detecting mthfr gene polymorphism, be necessary with the mthfr gene polymorphic detection realizing more highly sensitive, more low cost, more convenient and quicker.
Summary of the invention
The invention discloses a kind of detection quick and convenient, highly sensitive, the mthfr gene polymorphic detection test kit that accuracy rate is high, and it detects primer and detection system.
The present invention is a kind of technical scheme solving the problems of the technologies described above proposition: a kind of mthfr gene polymorphic detection primer, comprise for mthfr gene c.1298 site be the forward primer of A situation, corresponding mthfr gene c.1298 site is the reverse primer of A situation, for mthfr gene c.1298 site be the forward primer of C situation, corresponding mthfr gene c.1298 site is the reverse primer of C situation, for mthfr gene c.677 site be the forward primer of C situation, corresponding mthfr gene c.677 site is the reverse primer of C situation, for mthfr gene c.677 site be the forward primer of T situation, corresponding mthfr gene c.677 site is the reverse primer of T situation, detect the forward primer of β-actin gene and detect the reverse primer of β-actin gene, described for mthfr gene c.1298 the site nucleotide sequence that is the forward primer of A situation as shown in SEQ ID No.1, described corresponding mthfr gene c.1298 the site nucleotide sequence that is the reverse primer of A situation as shown in SEQ ID No.2, described for mthfr gene c.1298 the site nucleotide sequence that is the forward primer of C situation as shown in SEQ ID No.3, described corresponding mthfr gene c.1298 the site nucleotide sequence that is the reverse primer of C situation as shown in SEQ ID No.4, described for mthfr gene c.677 the site nucleotide sequence that is the forward primer of C situation as shown in SEQ ID No.5, described corresponding mthfr gene c.677 the site nucleotide sequence that is the reverse primer of C situation as shown in SEQ ID No.6, described for mthfr gene c.677 the site nucleotide sequence that is the forward primer of T situation as shown in SEQ ID No.7, described corresponding mthfr gene c.677 the site nucleotide sequence that is the reverse primer of T situation as shown in SEQ ID No.8, the nucleotide sequence of the forward primer of described detection β-actin gene is as shown in SEQ ID No.9, the nucleotide sequence of the reverse primer of described detection β-actin gene is as shown in SEQ ID No.10.
Each primer final concentration be applied in PCR reaction system is 0.4 μM.
The present invention is another technical scheme solving the problems of the technologies described above proposition: a kind of mthfr gene polymorphic detection test kit adopting above-mentioned detection primer.
The present invention is a kind of technical scheme solving the problems of the technologies described above proposition: a kind of mthfr gene polymorphic detection system comprise for detect mthfr gene c.1298 site be the PCR reaction system A of A situation, for detect mthfr gene c.1298 site be the PCR reaction system B of C situation, for detect mthfr gene c.677 site be the PCR reaction system C of C situation, for detect mthfr gene c.677 site be the PCR reaction system D of T situation, and for detecting the PCR reaction system E of β-actin gene as internal reference; Described PCR reaction system A comprise for mthfr gene c.1298 site be the forward primer of A situation, corresponding mthfr gene c.1298 site be the reverse primer of A situation, SYBR Green mixed solution and DNA profiling; Described PCR reaction system B comprise for mthfr gene c.1298 site be the forward primer of C situation, corresponding mthfr gene c.1298 site be the reverse primer of C situation, SYBR Green mixed solution and DNA profiling; Described PCR reaction system C comprise for mthfr gene c.677 site be the forward primer of C situation, corresponding mthfr gene c.677 site be the reverse primer of C situation, SYBR Green mixed solution and DNA profiling; Described PCR reaction system D comprise for mthfr gene c.677 site be the forward primer of T situation, corresponding mthfr gene c.677 site be the reverse primer of T situation, SYBR Green mixed solution and DNA profiling; Described PCR reaction system E comprises the forward primer detecting β-actin gene, the reverse primer detecting β-actin gene, SYBR Green mixed solution and DNA profiling; Described for mthfr gene c.1298 the site nucleotide sequence that is the forward primer of A situation as shown in SEQ ID No.1; Described corresponding mthfr gene c.1298 the site nucleotide sequence that is the reverse primer of A situation as shown in SEQ ID No.2; Described for mthfr gene c.1298 the site nucleotide sequence that is the forward primer of C situation as shown in SEQ ID No.3; Described corresponding mthfr gene c.1298 the site nucleotide sequence that is the reverse primer of C situation as shown in SEQ ID No.4; Described for mthfr gene c.677 the site nucleotide sequence that is the forward primer of C situation as shown in SEQ ID No.5; Described corresponding mthfr gene c.677 the site nucleotide sequence that is the reverse primer of C situation as shown in SEQ ID No.6; Described for mthfr gene c.677 the site nucleotide sequence that is the forward primer of T situation as shown in SEQ ID No.7; Described corresponding mthfr gene c.677 the site nucleotide sequence that is the reverse primer of T situation as shown in SEQ ID No.8; The nucleotide sequence of the forward primer of described detection β-actin gene is as shown in SEQ ID No.9; The nucleotide sequence of the reverse primer of described detection β-actin gene is as shown in SEQ ID No.10.
The volume of each PCR reaction system is 10 μ l; Wherein, the volume of described SYBR Green mixed solution is 5 μ l, and the final concentration of each primer is 0.4 μM, and the working concentration of described DNA profiling is 10 ~ 50ng/ μ l, and all the other are pure water.
Above-mentioned SYBR Green mixed solution is the SYBR Green mixed solution of double strength.
The present invention is another technical scheme solving the problems of the technologies described above proposition: a kind of mthfr gene polymorphic detection test kit adopting above-mentioned detection system.
The present invention is the another kind of technical scheme solving the problems of the technologies described above proposition: a kind of result decision method adopting above-mentioned detection system, and concrete steps are as follows:
The first step, adopts PCR reaction system E to detect the β-actin gene of sample,
If sample amplification CT value is less than 23 or be greater than 25, is judged as that sample is invalid, again prepares sample and detect;
If sample amplification CT value scope, in 23 ~ 25 scopes, is judged as that sample is effective, carries out next step and judge;
Second step, PCR reaction system A and B detects the c.1298 site situation of this sample respectively,
If the CT value of two reaction system amplifications is all in 20 ~ 30 scopes, as the absolute value < 2 of both CT differences, sample is judged as heterozygous genotypes; When absolute value >=3 of both CT differences, sample is judged as that the allelotrope corresponding to a side that CT value is little is homozygous; When absolute value >=2 of both CT differences and < 3 time, sample is judged as that result is insincere, again prepares sample and detects;
If at least one is less than 20 or be greater than 30 in the CT value of two reaction systems amplification, sample is judged as that result is insincere, again prepares sample and detects;
3rd step, PCR reaction system C and D detects the c.677 site situation of this sample respectively,
If the CT value of two reaction system amplifications is all in 20 ~ 30 scopes, as the absolute value < 2 of both CT differences, sample is judged as heterozygous genotypes; When absolute value >=3 of both CT differences, sample is judged as that the allelotrope corresponding to a side that CT value is little is homozygous; When absolute value >=2 of both CT differences and < 3 time, sample is judged as that result is insincere, again prepares sample and detects;
If at least one is less than 20 or be greater than 30 in the CT value of two reaction systems amplification, sample is judged as that result is insincere, again prepares sample and detects.
The present invention has positive effect:
(1) mthfr gene polymorphic detection test kit of the present invention, pioneering by allele specific pcr in conjunction with the fluoroscopic examination application of policies of SYBR Green in the polymorphism detecting people's mthfr gene c.1298 site and c.677 site, there is detection quick and convenient, highly sensitive, the feature that accuracy rate is high, range of application is extremely wide.
(2) detected result of mthfr gene polymorphic detection test kit of the present invention and sequencing result are compared, and genotype coincidence rate >=99%, molecule parting accuracy is high.
(3) mthfr gene polymorphic detection test kit of the present invention breaches existing conventional sense hand wastes time and energy and spends high application limitation, especially, the very high and conventional fluorescent Probe-detection methods that preparation process is loaded down with trivial details of ingenious replacement cost, significant cost is reduced, its simplicity operating and design and the universality to instrument, make it to be beneficial to and apply, thus make mthfr gene polymorphic detection in batch detection, have Application Areas widely, can more promptly obtain Molecular Detection result, make personalized medicine process more smooth and easy.
Accompanying drawing explanation
fig. 1the test kit of embodiment 1 is adopted to detect the amplification curve in the mthfr gene c.1298 site of sample 1;
fig. 2the test kit of embodiment 1 is adopted to detect the amplification curve in the mthfr gene c.1298 site of sample 2;
fig. 3the test kit of embodiment 1 is adopted to detect the amplification curve in the mthfr gene c.1298 site of sample 3;
fig. 4the test kit of embodiment 1 is adopted to detect the amplification curve in the mthfr gene c.677 site of sample 4;
fig. 5the test kit of embodiment 1 is adopted to detect the amplification curve in the mthfr gene c.677 site of sample 5;
fig. 6the test kit of embodiment 1 is adopted to detect the amplification curve in the mthfr gene c.677 site of sample 6.
Embodiment
Below by embodiment, the present invention is specifically described; what be necessary to herein means out is that following examples are only used to further illustrate the present invention; can not be interpreted as limiting the scope of the invention, person skilled in art can make some nonessential improvement and adjustment according to the invention described above content to the present invention.In following embodiment, if not specially show, reagent used is analytical pure, and agents useful for same all can obtain from commercial channel.The experimental technique of unreceipted actual conditions in literary composition, the condition described in " Molecular Cloning: A Laboratory guide " book that the Science Press that conveniently condition is write as J. Pehanorm Brooker etc. usually publishes for 2002, or according to the condition that manufacturers advises.Unless otherwise defined, all specialties used in literary composition and scientific words and one skilled in the art the same meaning be familiar with.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.
Embodiment 1
One, the composition of test kit.
The mthfr gene polymorphic detection test kit of the present embodiment comprise for detect mthfr gene c.1298 site be the reaction solution A of A situation, for detect mthfr gene c.1298 site be the reaction solution B of C situation, for detect mthfr gene c.677 site be the reaction liquid C of C situation, for detect mthfr gene c.677 site be the reaction solution D of T situation, and for detecting the reaction solution E of β-actin gene as internal reference.
Reaction solution A, B, C, D, E are formulated as follows:
1, the preparation of reaction solution A (MIX A).
Reaction solution A is the reaction mixture detecting mthfr gene c.1298 site, and designed primer for mthfr gene c.1298 position be the situation of A, comprise for mthfr gene c.1298 site be the forward arm primer (Primer F A1298C For A) of A situation, corresponding mthfr gene c.1298 site be the reverse primer (Primer R A1298C For A) of A situation, SYBR Green mixed solution (2 × SYBR GREEN Mix) and pure water (H
2o).
Concrete component is asked for an interview
table 1.
table 1the component of reaction solution A
| Composition | Working concentration | 100×(μl) |
| H 2O | / | 320 |
| 2×SYBR GREEN Mix | 2× | 500 |
| Primer F A1298C For A | 10μM | 40 |
| Primer R A1298C For A | 10μM | 40 |
2, the preparation of reaction solution B (MIX B).
Reaction solution B is the reaction mixture detecting mthfr gene c.1298 site, and designed primer for mthfr gene c.1298 position be the situation of C, comprise for mthfr gene c.1298 site be the forward arm primer (Primer F A1298C For C) of C situation, corresponding mthfr gene c.1298 site be C situation
?reverse primer (Primer R A1298C For C), SYBR Green mixed solution (2 × SYBR GREEN Mix) and pure water (H
2o).
Concrete component is asked for an interview
table 2.
table 2the component of reaction solution B
| Composition | Working concentration | 100×(μl) |
| H 2O | / | 320 |
| 2×SYBR GREEN Mix | 2× | 500 |
| Primer F A1298C For C | 10μM | 40 |
| Primer R A1298C For C | 10μM | 40 |
3, the preparation of reaction liquid C (MIX C).
Reaction liquid C is detect the reaction mixture in mthfr gene c.677 site, and designed primer for mthfr gene c.677 position be the situation of C, comprise for mthfr gene c.677 site be the forward arm primer (Primer F C677T For C) of C situation, corresponding mthfr gene c.677 site be C situation
?reverse primer (Primer R C677T For C), SYBR Green mixed solution (2 × SYBR GREEN Mix) and pure water (H
2o).
Concrete component is asked for an interview
table 3.
table 3the component of reaction liquid C
| Composition | Working concentration | 100×(μl) |
| H 2O | / | 320 |
| 2×SYBR GREEN Mix | 2× | 500 |
| Primer F C677T For C | 10μM | 40 |
| Primer R C677T ForC | 10μM | 40 |
4, the preparation of reaction solution D (MIX D).
Reaction solution D is the reaction mixture detecting mthfr gene c.677 site, and designed primer for mthfr gene c.677 position be the situation of T, comprise for mthfr gene c.677 site be the forward arm primer (Primer F C677T For T) of T situation, corresponding mthfr gene c.677 site be T situation
?reverse primer (Primer R C677T For T), SYBR Green mixed solution (2 × SYBR GREEN Mix) and pure water (H
2o).
Concrete component is asked for an interview
table 4.
table 4the component of reaction solution D
| Composition | Working concentration | 100×(μl) |
| H 2O | / | 320 |
| 2×SYBR GREEN Mix | 2× | 500 |
| Primer F C677T For T | 10μM | 40 |
| Primer R C677T For T | 10μM | 40 |
5, the preparation of reaction solution E (MIX E)
Reaction solution E comprises the forward primer (Primer F β-actin) detecting β-actin gene, the reverse primer (Primer R β-actin) detecting β-actin gene, SYBR Green mixed solution (2 × SYBR GREEN Mix) and pure water (H
2o).
Reaction solution E is the reaction mixture detecting β-actin gene, and as the internal reference use of reaction template, concrete component is asked for an interview
table 5.
table 5the component of reaction solution E
| Composition | Working concentration | 100×(μl) |
| H 2O | / | 320 |
| 2×SYBR GREEN Mix | 2× | 500 |
| Primer Fβ-actin | 10μM | 40 |
| Primer Rβ-actin | 10μM | 40 |
SYBR Green mixed solution supplier: Zhuan Meng company.
Each primer synthesizes by Shanghai Sheng Gong biotechnology company limited.The nucleotide sequence of primer is shown in
table 6.
table 6primer feature
table
| Primer | Seq No. | Nucleotide sequence (5 '-3 ') |
| Primer F A1298C For A | 1 | GAGGAGCTGACCAGTGAAAA |
| Primer R A1298C For A | 2 | GAACGAAGACTTCAAAGACACTCT |
| Primer F A1298C For C | 3 | GAGGAGCTGACCAGTGAAAC |
| Primer R A1298C For C | 4 | GAACGAAGACTTCAAAGACACTGG |
| Primer F C677T For C | 5 | GAAGGAGAAGGTGTCTGCGGGTGC |
| Primer R C677T For C | 6 | AAGCTGCGTGATGATGAAATCAG |
| Primer F C677T For T | 7 | GAAGGAGAAGGTGTCTGCGGAAGT |
| Primer R C677T For T | 8 | TGGGGTGGAGGGAGCTTAT |
| Primer F β-actin | 9 | GGCACCCAGCACAATGAAG |
| Primer R β-actin | 10 | GCCGATCCACACGGAGTACT |
Reaction solution A, B, C, D, E every batch deposits for-20 DEG C after preparing by 100 reacting weights.
Two, the using method of test kit.
The concrete detecting step of the mthfr gene polymorphic detection test kit of the present embodiment is as follows:
1, DNA extraction.
Adopt test kit (Axygen Multisource Genomic DNA Miniprep Kit) to extract sample DNA, concrete operation is see reagent kit product specification sheets.
2, sample DNA quality examination.
After obtaining sample DNA, by measuring the Ratio control sample quality of concentration and OD260/OD280, finally add the sample in reaction system, the obtained peak optimization reaction result of ratio between 1.8 ~ 2.0 of OD260/OD280, concentration is 10 ~ 50ng/ μ l.
3, PCR reaction.
1) PCR reaction system is prepared,
Prepare PCR reaction system A, B, C, D and E respectively based on reaction solution A, B, C, D and E, namely get appropriate reaction solution and mix with DNA profiling, finally add appropriate pure water and supply reaction cumulative volume.The component of each PCR reaction system is shown in
table 7extremely
table 11.
table 7the component of PCR reaction system A
| Composition | Working concentration | 1×(μl) |
| H 2O | / | 3.2 |
| 2×SYBR GREEN Mix | 2× | 5 |
| Primer F A1298C For A | 10μM | 0.4 |
| Primer R A1298C For A | 10μM | 0.4 |
| DNA template | 10-50ng/μl | 1 |
| Single reaction total | / | 10 |
table 8the component of PCR reaction system B
| Composition | Working concentration | 1×(μl) |
| H 2O | / | 3.2 |
| 2×SYBR GREEN Mix | 2× | 5 |
| Primer F A1298C For C | 10μM | 0.4 |
| Primer R A1298C For C | 10μM | 0.4 |
| DNA template | 10-50ng/μl | 1 |
| Single reaction total | / | 10 |
table 9the component of PCR reaction system C
| Composition | Working concentration | 1×(μl) |
| H 2O | / | 3.2 |
| 2×SYBR GREEN Mix | 2× | 5 |
| Primer F C677T For C | 10μM | 0.4 |
| Primer R C677T For C | 10μM | 0.4 |
| DNA template | 10-50ng/μl | 1 |
| Single reaction total | / | 10 |
table 1the component of 0 PCR reaction system D
| Composition | Working concentration | 1×(μl) |
| H 2O | / | 3.2 |
| 2×SYBR GREEN Mix | 2× | 5 |
| Primer F C677T For T | 10μM | 0.4 |
| Primer R C677T For T | 10μM | 0.4 |
| DNA template | 10-50ng/μl | 1 |
| Single reaction total | / | 10 |
table 1the component of 1 PCR reaction system E
| Composition | Working concentration | 1×(μl) |
| H 2O | / | 3.2 |
| 2×SYBR GREEN Mix | 2× | 5 |
| Primer Fβ-actin | 10μM | 0.4 |
| Primer Rβ-actin | 10μM | 0.4 |
| DNA template | 10-50ng/μl | 1 |
| Single reaction total | / | 10 |
2) PCR response procedures:
On real-time fluorescence quantitative PCR instrument (Roche Light Cycler-Nano thermo cycler), carry out real-time fluorescence PCR response procedures subsequently, peak optimization reaction program is
as table 1touch down PCR response procedures shown in 2.
table 12 PCR response procedures
table
Wherein, in front 14 PCR cycling programs of " sex change-annealing-extension ", first cycle annealing temperature is 62 degree, and second cycle annealing temperature is 61.5 degree, and circulation below successively each annealing temperature reduces by 0.5 degree.
4, PCR detected result judges:
According to the interpretation standard that known laboratory sample (contrast) is formulated be:
The first step, adopts PCR reaction system E to detect the β-actin gene of sample, if sample amplification CT value is in 23 ~ 25 scopes, is judged as that sample is effective; Otherwise be judged as that sample is invalid, again need prepare sample, make concentration of specimens be 10 ~ 50ng/ μ l, the ratio of OD260/OD280 between 1.8 ~ 2.0, then detects with this test kit again.
Second step, adopts the PCR reaction system A of two kinds of polymorphism ARMS primers and B to detect the mthfr gene c.1298 site of same sample respectively.
If the CT value of two reaction system amplifications is all in 20 ~ 30 scopes, then:
1) the CT value when two kinds of ARMS primer amplifications is very close, and CT difference (absolute value of △ CT) < 2, sample is judged as heterozygous genotypes;
2) when two kinds of ARMS primer amplification CT differences (absolute value of △ CT) >=3, sample is judged as that the allelotrope corresponding to a side that CT value is little is homozygous.
3) when two kinds of ARMS primer amplification CT differences (absolute value of △ CT) >=2 and < 3 time, sample is judged as that result is insincere, again sample need be prepared, concentration of specimens is made to be 10 ~ 50ng/ μ l, the ratio of OD260/OD280 between 1.8 ~ 2.0, then detects with this test kit again.
If at least one is less than 20 or be greater than 30 in the CT value of the amplification of two reaction systems amplification, sample is judged as that result is insincere, again need prepare sample, makes concentration of specimens be 10 ~ 50ng/ μ l, the ratio of OD260/OD280 between 1.8 ~ 2.0, then detects with this test kit again.
3rd step, adopts the PCR reaction system C of two kinds of polymorphism ARMS primers and D to detect the mthfr gene c.677 site of same sample respectively.
If the CT value of two reaction system amplifications is all in 20 ~ 30 scopes, then:
1) the CT value when two kinds of ARMS primer amplifications is very close, and CT difference (absolute value of △ CT) < 2, sample is judged as heterozygous genotypes;
2) when two kinds of ARMS primer amplification CT differences (absolute value of △ CT) >=3, sample is judged as that the allelotrope corresponding to a side that CT value is little is homozygous.
3) when two kinds of ARMS primer amplification CT differences (absolute value of △ CT) >=2 and < 3 time, sample is judged as that result is insincere, again sample need be prepared, concentration of specimens is made to be 10 ~ 50ng/ μ l, the ratio of OD260/OD280 between 1.8 ~ 2.0, then detects with this test kit again.
If at least one is less than 20 or be greater than 30 in the CT value of the amplification of two reaction systems amplification, sample is judged as that result is insincere, again need prepare sample, makes concentration of specimens be 10 ~ 50ng/ μ l, the ratio of OD260/OD280 between 1.8 ~ 2.0, then detects with this test kit again.
Three, application example.
1, application examples.
A. the c.1298 site of the mthfr gene of sample is detected.
1) when adopting the c.1298 site of the mthfr gene of reaction solution A and B detection sample 1 in the test kit of embodiment 1, amplification curve
as Fig. 1shown in, detected result is MTHFR A1298A (hereinafter referred to as MTHFR AA) genotype.
When the sample detected is MTHFR AA genotype, A allelotype primer amplification CT value is less than C allelotype primer amplification CT value (the CT curve namely corresponding to A allelotype primer amplification keeps left), and difference >=3 of C allelotype primer amplification CT value and A allelotype primer amplification CT value.The amplification curve of MTHFR AA genotype sample is A allelotype primer amplification curve, C allelotype primer amplification curve from left to right successively.
2) when adopting reaction solution A and B in the test kit of embodiment 1 to detect the c.1298 site of the mthfr gene of sample 2, amplification curve
as Fig. 2shown in, detected result is MTHFR C1298C (hereinafter referred to as MTHFR CC) genotype.
When the sample detected is MTHFR CC genotype, C allelotype primer amplification CT value is less than the primer amplification CT value (the CT curve namely corresponding to C allelotype primer amplification keeps left) of A allelotype, and difference >=3 of A allelotype primer amplification CT value and C allelotype primer amplification CT value.The amplification curve of MTHFR CC genotype sample is the amplification curve of C allelotype primer, A allelotype primer amplification curve from left to right successively.
3) when adopting reaction solution A and B in the test kit of embodiment 1 to detect the c.1298 site of the mthfr gene of sample 3, amplification curve
as Fig. 3shown in, detected result is MTHFR A1298C (hereinafter referred to as MTHFR AC) genotype.
When the sample detected is MTHFR AC heterozygous, the CT value of A allelotype primer and C allelotype primer amplification is close, and the absolute value < 2 of the difference of A allelotype primer amplification CT value and C allelotype primer amplification CT value.The amplification curve of heterozygous genotypes sample, two amplification curves correspond to A allelotype primer and C allelotype primer amplification curve respectively.
B. the c.677 site of the mthfr gene of sample is detected.
1) when adopting the c.677 site of the mthfr gene of reaction liquid C and D detection sample 4 in the test kit of embodiment 1, amplification curve
as Fig. 4shown in, detected result is MTHFR C677C (hereinafter referred to as MTHFR CC) genotype.
When the sample detected is MTHFR CC genotype, C allelotype primer amplification CT value is less than T allelotype primer amplification CT value (the CT curve namely corresponding to C allelotype primer amplification keeps left), and difference >=3 of T allelotype primer amplification CT value and C allelotype primer amplification CT value.The amplification curve of MTHFR CC genotype sample is C allelotype primer amplification curve, T allelotype primer amplification curve from left to right successively.
2) when adopting the reaction liquid C in the test kit of embodiment 1 and D to detect the c.677 site of the mthfr gene of sample 5, amplification curve
as Fig. 5shown in, detected result is MTHFR T677T (hereinafter referred to as MTHFR TT) genotype.
When the sample detected is MTHFR TT genotype, T allelotype primer amplification CT value is less than the primer amplification CT value (the CT curve namely corresponding to T allelotype primer amplification keeps left) of C allelotype, and difference >=3 of C allelotype primer amplification CT value and T allelotype primer amplification CT value.The amplification curve of MTHFR TT genotype sample is the amplification curve of T allelotype primer, C allelotype primer amplification curve from left to right successively.
3) when adopting the reaction liquid C in the test kit of embodiment 1 and D to detect the c.677 site of the mthfr gene of sample 6, amplification curve
as Fig. 6shown in, detected result is MTHFR C677T (hereinafter referred to as MTHFR CT) genotype.
When the sample detected is MTHFR CT heterozygous, the CT value of C allelotype primer and T allelotype primer amplification is close, and the absolute value < 2 of the difference of C allelotype primer amplification CT value and T allelotype primer amplification CT value.The amplification curve of heterozygous genotypes sample, two amplification curves correspond to C allelotype primer and T allelotype primer amplification curve respectively.
2, PCR result verification
Adopt sequence measurement to detect the mutational site of the mthfr gene of each sample, sequencing result is completely the same with the detected result of this test kit of employing.
Three, test kit characteristic
Sensitivity analysis: adopt the test kit of the present embodiment 1 can detect the human gene group DNA being low to moderate 10ng.
Repeatability is analyzed: above-mentioned detection reaction all adopts multiple hole, and at every turn in triplicate, CT value difference is therebetween no more than 0.2 circulation.
Obviously, above-described embodiment is only for example of the present invention is clearly described, and is not the restriction to embodiments of the present invention.For those of ordinary skill in the field, can also make other changes in different forms on the basis of the above description.Here exhaustive without the need to also giving all embodiments.And these belong to spirit institute's apparent change of extending out of the present invention or change and are still among protection scope of the present invention.
SEQUENCE LISTING
<110> Shanghai Saian Biological Medical Technology Co., Ltd.
<120> mthfr gene polymorphic detection primer system and test kit thereof
<130> without
<160> 10
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> synthetic
<400> 1
gaggagctga ccagtgaaaa 20
<210> 2
<211> 24
<212> DNA
<213> synthetic
<400> 2
gaacgaagac ttcaaagaca ctct 24
<210> 3
<211> 20
<212> DNA
<213> synthetic
<400> 3
gaggagctga ccagtgaaac 20
<210> 4
<211> 24
<212> DNA
<213> synthetic
<400> 4
gaacgaagac ttcaaagaca ctgg 24
<210> 5
<211> 24
<212> DNA
<213> synthetic
<400> 5
gaaggagaag gtgtctgcgg gtgc 24
<210> 6
<211> 23
<212> DNA
<213> synthetic
<400> 6
aagctgcgtg atgatgaaat cag 23
<210> 7
<211> 24
<212> DNA
<213> synthetic
<400> 7
gaaggagaag gtgtctgcgg aagt 24
<210> 8
<211> 19
<212> DNA
<213> synthetic
<400> 8
tggggtggag ggagcttat 19
<210> 9
<211> 19
<212> DNA
<213> synthetic
<400> 9
ggcacccagc acaatgaag 19
<210> 10
<211> 20
<212> DNA
<213> synthetic
<400> 10
gccgatccac acggagtact 20
Claims (7)
1. a mthfr gene polymorphic detection primer, is characterized in that:
Comprise for mthfr gene c.1298 site be the forward primer of A situation, corresponding mthfr gene c.1298 site is the reverse primer of A situation, for mthfr gene c.1298 site be the forward primer of C situation, corresponding MTHFR gene c.1298 site is the reverse primer of C situation, for MTHFR gene c.677 site be the forward primer of C situation, corresponding MTHFR gene c.677 site is the reverse primer of C situation, for MTHFR gene c.677 site be the forward primer of T situation, corresponding MTHFR gene c.677 site is the reverse primer of T situation, detect the forward primer of β-actin gene and detect the reverse primer of β-actin gene,
Described for mthfr gene c.1298 the site nucleotide sequence that is the forward primer of A situation as shown in SEQ ID No.1;
Described corresponding mthfr gene c.1298 the site nucleotide sequence that is the reverse primer of A situation as shown in SEQ ID No.2;
Described for mthfr gene c.1298 the site nucleotide sequence that is the forward primer of C situation as shown in SEQ ID No.3;
Described corresponding mthfr gene c.1298 the site nucleotide sequence that is the reverse primer of C situation as shown in SEQ ID No.4;
Described for mthfr gene c.677 the site nucleotide sequence that is the forward primer of C situation as shown in SEQ ID No.5;
Described corresponding mthfr gene c.677 the site nucleotide sequence that is the reverse primer of C situation as shown in SEQ ID No.6;
Described for mthfr gene c.677 the site nucleotide sequence that is the forward primer of T situation as shown in SEQ ID No.7;
Described corresponding mthfr gene c.677 the site nucleotide sequence that is the reverse primer of T situation as shown in SEQ ID No.8;
The nucleotide sequence of the forward primer of described detection β-actin gene is as shown in SEQ ID No.9;
The nucleotide sequence of the reverse primer of described detection β-actin gene is as shown in SEQ ID No.10.
2. mthfr gene polymorphic detection primer according to claim 1, is characterized in that: each primer final concentration be applied in PCR reaction system is 0.4 μM.
3. one kind adopts the mthfr gene polymorphic detection test kit detecting primer as claimed in claim 1.
4. a mthfr gene polymorphic detection system, is characterized in that:
Comprise for detect mthfr gene c.1298 site be the PCR reaction system A of A situation, for detect mthfr gene c.1298 site be the PCR reaction system B of C situation, for detect mthfr gene c.677 site be the PCR reaction system C of C situation, for detect mthfr gene c.677 site be the PCR reaction system D of T situation, and for detecting the PCR reaction system E of β-actin gene as internal reference;
Described PCR reaction system A comprise for mthfr gene c.1298 site be the forward primer of A situation, corresponding mthfr gene c.1298 site be the reverse primer of A situation, SYBR Green mixed solution and DNA profiling;
Described PCR reaction system B comprise for mthfr gene c.1298 site be the forward primer of C situation, corresponding mthfr gene c.1298 site be the reverse primer of C situation, SYBR Green mixed solution and DNA profiling;
Described PCR reaction system C comprise for mthfr gene c.677 site be the forward primer of C situation, corresponding mthfr gene c.677 site be the reverse primer of C situation, SYBR Green mixed solution and DNA profiling;
Described PCR reaction system D comprise for mthfr gene c.677 site be the forward primer of T situation, corresponding mthfr gene c.677 site be the reverse primer of T situation, SYBR Green mixed solution and DNA profiling;
Described PCR reaction system E comprises the forward primer detecting β-actin gene, the reverse primer detecting β-actin gene, SYBR Green mixed solution and DNA profiling;
Described for mthfr gene c.1298 the site nucleotide sequence that is the forward primer of A situation as shown in SEQ ID No.1;
Described corresponding mthfr gene c.1298 the site nucleotide sequence that is the reverse primer of A situation as shown in SEQ ID No.2;
Described for mthfr gene c.1298 the site nucleotide sequence that is the forward primer of C situation as shown in SEQ ID No.3;
Described corresponding mthfr gene c.1298 the site nucleotide sequence that is the reverse primer of C situation as shown in SEQ ID No.4;
Described for mthfr gene c.677 the site nucleotide sequence that is the forward primer of C situation as shown in SEQ ID No.5;
Described corresponding mthfr gene c.677 the site nucleotide sequence that is the reverse primer of C situation as shown in SEQ ID No.6;
Described for mthfr gene c.677 the site nucleotide sequence that is the forward primer of T situation as shown in SEQ ID No.7;
Described corresponding mthfr gene c.677 the site nucleotide sequence that is the reverse primer of T situation as shown in SEQ ID No.8;
The nucleotide sequence of the forward primer of described detection β-actin gene is as shown in SEQ ID No.9;
The nucleotide sequence of the reverse primer of described detection β-actin gene is as shown in SEQ ID No.10.
5. mthfr gene polymorphic detection system according to claim 4, is characterized in that: the volume of each PCR reaction system is 10 μ l; Wherein, the volume of described SYBR Green mixed solution is 5 μ l, and the final concentration of each primer is 0.4 μM, and the working concentration of described DNA profiling is 10 ~ 50ng/ μ l, and all the other are pure water.
6. one kind adopts the mthfr gene polymorphic detection test kit of detection system as claimed in claim 4.
7. adopt a result decision method for detection system as claimed in claim 4, concrete steps are as follows:
The first step, adopts PCR reaction system E to detect the β-actin gene of sample,
If sample amplification CT value is less than 23 or be greater than 25, is judged as that sample is invalid, again prepares sample and detect;
If sample amplification CT value scope, in 23 ~ 25 scopes, is judged as that sample is effective, carries out next step and judge;
Second step, PCR reaction system A and B detects the c.1298 site situation of this sample respectively,
If the CT value of two reaction system amplifications is all in 20 ~ 30 scopes, as the absolute value < 2 of both CT differences, sample is judged as heterozygous genotypes; When absolute value >=3 of both CT differences, sample is judged as that the allelotrope corresponding to a side that CT value is little is homozygous; When absolute value >=2 of both CT differences and < 3 time, sample is judged as that result is insincere, again prepares sample and detects;
If at least one is less than 20 or be greater than 30 in the CT value of two reaction systems amplification, sample is judged as that result is insincere, again prepares sample and detects;
3rd step, PCR reaction system C and D detects the c.677 site situation of this sample respectively,
If the CT value of two reaction system amplifications is all in 20 ~ 30 scopes, as the absolute value < 2 of both CT differences, sample is judged as heterozygous genotypes; When absolute value >=3 of both CT differences, sample is judged as that the allelotrope corresponding to a side that CT value is little is homozygous; When absolute value >=2 of both CT differences and < 3 time, sample is judged as that result is insincere, again prepares sample and detects;
If at least one is less than 20 or be greater than 30 in the CT value of two reaction systems amplification, sample is judged as that result is insincere, again prepares sample and detects.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510237230.4A CN104894242A (en) | 2015-05-12 | 2015-05-12 | MTHFR gene polymorphism detection primer system and kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510237230.4A CN104894242A (en) | 2015-05-12 | 2015-05-12 | MTHFR gene polymorphism detection primer system and kit thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104894242A true CN104894242A (en) | 2015-09-09 |
Family
ID=54027194
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510237230.4A Pending CN104894242A (en) | 2015-05-12 | 2015-05-12 | MTHFR gene polymorphism detection primer system and kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104894242A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106916882A (en) * | 2015-12-28 | 2017-07-04 | 华联生物科技股份有限公司 | Method for dual allele-specific polymerase chain reaction of genotype identification chip for identifying polymorphism of nucleotide gene |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102808026A (en) * | 2012-08-16 | 2012-12-05 | 苏州旷远生物分子技术有限公司 | Primer, probe, fluorescent PCR kit and method for detecting polymorphism of human MTHFR (Methylene Tetrahydrofolate Reductase) gene |
| CN103757106A (en) * | 2014-01-07 | 2014-04-30 | 河南科技大学 | Kit and method for detecting gene polymorphism of human MTHFR (methylene tetrahydrofolate reductase) based on Taqman-MGB (Minor Groove Binder) probe |
-
2015
- 2015-05-12 CN CN201510237230.4A patent/CN104894242A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102808026A (en) * | 2012-08-16 | 2012-12-05 | 苏州旷远生物分子技术有限公司 | Primer, probe, fluorescent PCR kit and method for detecting polymorphism of human MTHFR (Methylene Tetrahydrofolate Reductase) gene |
| CN103757106A (en) * | 2014-01-07 | 2014-04-30 | 河南科技大学 | Kit and method for detecting gene polymorphism of human MTHFR (methylene tetrahydrofolate reductase) based on Taqman-MGB (Minor Groove Binder) probe |
Non-Patent Citations (1)
| Title |
|---|
| HATCHER L.L. ET AL.: "Rapid detection of MTHFR C677T+MTHFR A1298C and factor V Leiden plus prothrombin G20210 A SNPs by 4-plexed real-time PCR", 《MEETING OF THE ASSOCIATION FOR MOLECULAR PATHOLOGY》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106916882A (en) * | 2015-12-28 | 2017-07-04 | 华联生物科技股份有限公司 | Method for dual allele-specific polymerase chain reaction of genotype identification chip for identifying polymorphism of nucleotide gene |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Vannucchi et al. | A quantitative assay for JAK2V617F mutation in myeloproliferative disorders by ARMS-PCR and capillary electrophoresis | |
| Campan et al. | MethyLight | |
| CN104762408B (en) | Detect the kit and its detection method of EGFR genetic mutation | |
| Poláková et al. | High-resolution melt curve analysis: initial screening for mutations in BCR-ABL kinase domain | |
| Franczak et al. | Technical considerations for circulating tumor DNA detection in oncology | |
| JP2012040029A (en) | Method for detecting mutation and kit used in the same | |
| Campbell et al. | Methods for the detection of the JAK2 V617F mutation in human myeloproliferative disorders | |
| CN104404163A (en) | Probes and kit for detecting human CYP2C9 (Cytochrome P450 2C9) and VKORC1 (Vitamin K epoxide reductase complex subunit 1) gene polymorphism | |
| CN104830852A (en) | Multiplex real-time fluorescent PCR (polymerase chain reaction) method for detecting HLA-B*15:02 alleles | |
| CN104673891A (en) | Detection method and kit for spinal muscular atrophy related gene mutation | |
| CN113151440A (en) | Kit for predicting aspirin curative effect and adverse reaction, detection method and application thereof | |
| Morishita et al. | Alternately binding probe competitive PCR as a simple, cost-effective, and accurate quantification method for JAK2V617F allele burden in myeloproliferative neoplasms | |
| JP2010535501A (en) | Methods to identify individuals at risk of thiopurine drug resistance and thiopurine drug intolerance | |
| CN111154877A (en) | Composition for detecting unstable state of free microsatellite in blood plasma and application thereof | |
| Lindner et al. | Usefulness of SNPs as supplementary markers in a paternity case with 3 genetic incompatibilities at autosomal and Y chromosomal loci | |
| CN105018490A (en) | Primer pairs, probes and kit for detecting polymorphism of human MTHFR gene | |
| KR20160106041A (en) | Compositions and methods for multiplex analysis of nras and braf nucleic acids | |
| Lay et al. | Detection of the JAK2 V617F mutation by LightCycler PCR and probe dissociation analysis | |
| CN103103259A (en) | Method, kit and primers for determining whether two predetermined loci of nucleic acid sample mutate or not | |
| CN113151441A (en) | Gene detection kit for beta receptor antagonist medication and method and application thereof | |
| CN110295218B (en) | Method for quantifying mutant allele burden of target gene | |
| Kreutz et al. | Pyrosequencing: powerful and quantitative sequencing technology | |
| CN104894241A (en) | MTRR gene polymorphism detection primer system and reagent kit thereof | |
| CN104894242A (en) | MTHFR gene polymorphism detection primer system and kit thereof | |
| EP3660168A1 (en) | Method for detecting mutant gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150909 |