CN104877977A - Method for evolving enzyme based on synthetic single-stranded DNA (deoxyribonucleic acid) library - Google Patents
Method for evolving enzyme based on synthetic single-stranded DNA (deoxyribonucleic acid) library Download PDFInfo
- Publication number
- CN104877977A CN104877977A CN201510213131.2A CN201510213131A CN104877977A CN 104877977 A CN104877977 A CN 104877977A CN 201510213131 A CN201510213131 A CN 201510213131A CN 104877977 A CN104877977 A CN 104877977A
- Authority
- CN
- China
- Prior art keywords
- primer
- library
- strand
- mutant
- anchor point
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01036—Hyaluronoglucuronidase (3.2.1.36)
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
- C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for evolving an enzyme based on a synthetic single-stranded DNA (deoxyribonucleic acid) library and belongs to the technical field of gene engineering. The method comprises the following steps: on the basis of a PCR (polymerase chain reaction) technology, firstly obtaining a single-stranded mutant; obtaining a double-stranded mutant library with high diversity by employing the single-stranded mutant as a template; and reconstructing an expression vector by the mutant library, transforming the host and carrying out high-throughput screening to evolve mutant strains. By virtue of the technology, an enzyme gene is successfully subjected to in vitro transformation to obtain the mutant strains with excellent properties; according to the method, rapid in vitro evolution of the gene is realized; the method is simple to operate, and is especially suitable for introducing abundant mutation diversity into the gene; and rapid directed evolution is carried out.
Description
Technical field
The present invention relates to a kind of method based on synthesizing single-stranded DNA library evolution enzyme, belong to gene engineering technology field.
Background technology
Along with the development of Protocols in Molecular Biology and genetic engineering technique, the natural enzyme gene of existing thousands of kind is found, because the biocatalysis of enzyme mediation has environmentally friendly, the advantages such as efficient specificity and reaction conditions gentleness, as the leader of raw catalysis, be widely used in the synthesis of complicated medicine, intermediate, compound, the even synthesis of biofuel.In synthesising biological and metabolic engineering, enzyme is the participant of core, by building a series of metabolism route of synthesis, microbial metabolism can be realized and synthesize the complex compound that various organic synthesis cannot obtain, as aromatic hydrocarbons, carbohydrate, organic acid, alcohol and other secondary metabolites.But in majority of case, the limitation of the character of natural enzyme, significantly limit its use at various complex condition.
Nature, in the homeostasis process of genetic mutation and natural selection, evolve out very accurately and efficient enzyme again, but the speed of natural selection slowly, needs the very long time.People, in the urgent need to carrying out artificial evolution and transformation to natural enzyme, can meet the new enzyme with better function of people's demand to acquisition.Under current experimental technique condition, people are by methods such as physical chemistry, and such as ultraviolet, ray and nitrite etc. drastically increase the frequency of transgenation, for artificial tachytely gene provides possibility.But the sudden change that the methods such as physical chemistry cause is all often detrimental mutation, and randomness is comparatively large, also cannot meet large-scale evolution demand.Along with reaching its maturity of Protocols in Molecular Biology, genetic manipulation level, directly introduce specific or random mutational site to natural gene becomes possibility.Random mutation method replaces by introducing random base, and then screen desirable mutant.Such as fallibility round pcr at present uses one of wider gene evolution mode, introduces catastrophe point at random, the gene of the useful evolution of high flux screening by polymerase chain reaction (PCR) process in vitro.After too much turn operation, the new enzyme of zymologic property and function generation considerable change can be obtained.The various dependence round pcrs grown up the on this basis technology of introducing catastrophe point evolution genes such as rite-directed mutagenesis, gene are fitted together to and the method such as random chimeric of instantaneous template.But the catastrophe point diversity that aforesaid method produces is few, and the mutant of generation mostly also is detrimental mutation, workload is large and efficiency is extremely low.
1994, a kind of orthogenesis new technology DNA reorganizes (DNA shuffling) and is quietly born, Stemmer has delivered at Nature the article that a section is entitled as Rapid evolution of a p rotein in vitro by DNA shuffling, proposes DNA shuffling technology first.Investigator with beta-lactam enzyme system for subjects, use DNA reorganization, screen through three-wheel and backcross for twice and obtain a new strains, the minimum inhibitory concentration of its cefotaxime (cefotaxime) improves 16000 times than original strain, far above the screen mutation result of error-prone PCR.The various methods based on recombinant technology grown up subsequently, to improve the degree of gene recombination and screening efficiency for target, all obtain reasonable effect.But, the requirement of DNA shuffling technology to sequence homology higher (homology is greater than 75%) and need to obtain homologous gene material.These two maximum of condition limit the application of DNA shuffling technology, and the mutant that this technology produces simultaneously often has more phase shift mutant.
In addition, current synthetic biology and metabolic engineering are substantially all focused on the expression regulation to synthesis pathway gene to the transformation of route of synthesis, such as strengthen the expression of pathway gene, knock out or inhibitor and competition approach, such as optimal startup or ribosome bind site, the codon of optimized gene, the regulation and control region, interval etc. of rebuilding approach gene.In addition, the enzyme in route of synthesis is transformed and is also necessary, the speed limit problem of such as key enzyme, by product or substrate feedback inhibition.Because iff reinforcement expression level, waste and the Growth of Cells burden of cell synthesis capability may be caused, and fundamentally can not solve the problem of pathways metabolism flow equilibrium.
The present invention adopts based on external PCR recombinant technology, by synthetic single-stranded DNA banks, adopts round pcr to obtain the mutated library extremely enriched containing diversity, then adopts extracorporeal recombination to build screen mutation library.This technology overcomes the factors such as the restriction of above-mentioned random mutation diversity deficiency, DNA shuffling technology homologous sequence and homologous gene material, and operation is implemented simple, be easy to obtain abundant mutant library, for the outer tachytely of genosome is laid a good foundation, simultaneously, associated proteins Structure bioinformatics and synthetic biology, be particularly suitable for the slewing evolution application of enzyme gene and metabolism route of synthesis.Certainly, the present invention is equally applicable to the situation only having a targeted mutagenesis region.
Summary of the invention
The invention provides a kind of method based on synthesizing single-stranded DNA library evolution enzyme (Rapidly Efficient CombinatorialOligonucleotides for Direct Evolution, RECODE), mainly comprise prepare mutant library, screening mutant; Described mutant library comprises strand mutant library and double chain mutation body library, and strand mutant library and double chain mutation body library can separately build, and also synchronously can build and obtain.For building strand mutant library, primer is designed respectively in each targeted mutagenesis region for parental gene, each primer direction is identical, and by adding DNA ligase to connect the nucleotide fragments of respectively undergoing mutation in PCR system, obtains complete strand mutant; For building double chain mutation body library, extra anchor point sequence need be brought in the two ends of strand mutant, is convenient to when duplexed, is designed for the primer of specific amplification strand mutant.
Described targeted mutagenesis region can be on purpose select that obtain or random generation.Unrestricted in theory to a region quantity chain carrying out simultaneous mutation, can sets itself as required in actually operating, the gene within 2k can between 1-15 site.
Described direction is identical, refers to that each primer is 3 ' to 5 ' direction, or is 5 ' to 3 ' direction.When parental gene is double-stranded DNA, primer direction is identical can ensure PCR process only with the DNA chain of specific direction for template, finally obtain strand mutant.
What described parental gene was encoded is enzyme gene; The existence form of parental gene is unrestricted, can be plasmid, genome, double chain DNA fragment or strand cDNA.
Described strand mutant library and double chain mutation body library synchronously build, it is the primer adding specific combination strand mutant in the PCR system directly to structure strand mutant library, limit PCR obtains strand mutant, while with strand mutant for template carries out the amplified reaction of duplexed reaction and double chain mutation body.
When described strand mutant library and double chain mutation body library substep build, directly using the PCR mixture containing strand mutant library as template, do not change reaction system, carry out second directly to the primer wherein adding specific combination strand mutant and take turns PCR and prepare the complete double chain mutation body of total length; Or using the strand mutant library after reclaiming through column purification as template, again prepare reaction system and carry out second and take turns PCR and prepare the complete double chain mutation body of total length.
For building strand mutant library, for one or more targeted mutagenesis regions of parental gene, designing corresponding primer respectively, being called editor's primer.Described editor's primer contains mutating alkali yl that needs introduce to Sudden change region and 3 ' and 5 ' end has the sequence of mating with template strand of suitable length respectively; When relating to multiple Sudden change region, each editor's primer is equidirectional, all matches with same template strand and combines.Simultaneously, synthesize two and the equidirectional anchor point primer of editor's primer, wherein one is upstream anchor point primer, article one, be downstream anchor point primer, described upstream anchor point primer contains one section holds with template strand 3 ' nucleotide sequence mated, in addition, 5 ' end of this upstream anchor point primer also has the anchor point sequence of 15-25bp; Described downstream anchor point primer contains one section holds with template strand 5 ' nucleotide sequence mated, and in addition, 3 ' end of this downstream anchor point primer also has the anchor point sequence of 15-25bp.
For editor's primer, for saving synthesis expense, general recommendations editor primer length, lower than 59bp, can increase primer length if necessary, or can be divided into two short primers.The site of carrying out suddenling change is needed generally to be placed in the middle part of editor's primer, height degeneracy can be carried out as required, if parent's coding is protein sequence, occur for avoiding terminator codon TAA, TAG and TGA, codeword triplet can degeneracy be VNN or the probability reducing terminator appearance, and editor's primer synthesizes preferred PAGE way of purification.
Described anchor point primer, can also have the function of editor's primer concurrently, namely while as anchor point primer, and can also containing the mutating alkali yl needing to introduce to Sudden change region.
Described anchor point sequence, on the one hand can when building double chain mutation body library, and for designing the single-minded external primer is combined with strand mutant, another aspect also can be used as homologous recombination sequence, for the connection of mutant library and expression vector.When double chain mutation body is connected with carrier, does not advise using restriction enzyme site to carry out recombinant vectors, because the sudden change of height degeneracy is introduced, gene internal may be made to occur corresponding restriction enzyme site.
The mutating alkali yl that described needs are introduced in Sudden change region can be concrete base sequence, also can be degeneracy base sequence.
Described editor's primer and downstream anchor point primer, first adopt the 5 ' terminal hydroxy group of T4 polynueleotide kinase to primer to carry out phosphorylation reaction before use.
3 ' and 5 ' terminal sequence oligonucleotide sequences mated completely with template of retaining 15-30bp respectively of described editor's primer.
The reaction process preparing strand mutant library is that DNA extension is connected the reaction synchronously carried out with DNA: upstream and downstream anchor point primer, editor's primer and template DNA, with suitable mixed in molar ratio, add archaeal dna polymerase and DNA ligase, reaction buffer.Mg in reaction buffer
2+concentration is 1-10mM, PCR annealing temperature be 40-66 DEG C, PCR elongating temperature be 65-72 DEG C, PCR reaction cycle number is 1-35.PCR primer comprise not to be used as after sex change is unwind the single stranded DNA of template, a large amount of single stranded DNAs of undergoing mutation, with the conjugate DNA chain of undergoing mutation being in double-stranded state of template.
In one embodiment of the invention, when preparing strand mutant library, identical with the mole number of the primer that template strand different positions combines.
For building double chain mutation body library, using the PCR mixture containing strand mutant library or the strand mutant library after column purification reclaims as template, second can be carried out and take turns PCR and prepare the complete double chain mutation body gene product of total length; Or add the primer of specific combination strand mutant in the reaction system directly to structure strand mutant library, limit PCR obtains the amplified reaction (referred to as One_step PCR) that duplexed reaction and double chain mutation body are carried out in strand mutant limit.For building double chain mutation body library, with strand mutant for stencil design a pair external primer for the strand mutant full-length gene that increases.Described external primer matches with the anchor point sequence of anchor point primer or identical respectively.The single stranded DNA of anchor point sequence of bringing of only undergoing mutation can be combined with external primer, and thus amplified production is double chain mutation body library.The PCR primer prepared, after purifying reclaims, adopt extracorporeal recombination to clone, build high flux screening library, screening possesses the muton of required nature and characteristic.
Describedly carry out second using strand mutant library or the strand mutant library after column purification reclaims as template and take turns PCR when preparing the complete double chain mutation body gene product of total length, only need circulate through minority, just can obtain a large amount of double chain mutation body.Described strand mutant library, before the preparation carrying out double chain mutation body library, can adopt DpnI digestion with restriction enzyme template strand.Certainly, even if do not use DpnI restriction enzyme enzyme liberating template DNA, in the PCR process preparing double chain mutation library, because a pair external primer contains the sequence with anchor point sequences match, and template DNA is not containing the sequence with anchor point sequences match, therefore, template DNA can't increase.
The primer of specific combination strand mutant is added in the described reaction system directly to structure strand mutant library, limit PCR obtains strand mutant, while carry out in the One_step PCR of the amplified reaction of duplexed reaction and double chain mutation body, by upstream and downstream anchor point primer, editor's primer and template DNA with suitable mixed in molar ratio, simultaneously, add the upstream and downstream external primer of 2-5 times of anchor point primer amount respectively, add archaeal dna polymerase, DNA ligase and reaction buffer.Mg in reaction buffer
2+concentration is 1-10mM, PCR annealing temperature be 40-66 DEG C, PCR elongating temperature be 65-72 DEG C, PCR reaction cycle number is 1-35.PCR primer is containing a large amount of double chain mutation bodies, and the template DNA of minute quantity.
In the annealing process of described One_step PCR, for avoiding the combination of anchor point primer and external primer, in anchor point primer, the length of anchor point sequence accounts for 1/3rd of anchor point primer length.
In described One_step PCR, upper (lower) trip anchor point primer length can be 60bp, and wherein 40bp mates completely with parental templates, also has the anchor point sequence of 20bp; Upper (lower) trip external primer length is 20bp, identical with anchor point sequence or complementary.
In described One_step PCR, the adding proportion of upper (lower) trip anchor point primer and upper (lower) trip external primer can be 1:(2-5), excessive upper (lower) trip external primer can make the complete double-strand of strand mutant of generation change into double chain mutation body.
In one embodiment of the invention, the archaeal dna polymerase of employing is the hot resistant DNA polymerase of high-fidelity, preferably 5 '-3 ' high-fidelity DNA polymerase of 5 prime excision enzyme activity disappearance, as Phusion DNA polymerase (NEB).
In one embodiment of the invention, the DNA ligase of employing is heat-resistant dna ligase enzyme, as Taq DNA ligase (NEB), 9N DNA ligase (NEB) and Ampligase (EPI), preferred Ampligase.
For screening mutant, mutant library and carrier can be integrated with external package technique.
Described assembled in vitro technology can be yeast package technique in fusion DNA vaccine, Gibson assembling, the polymerase-mediated recombinant technology of T4DNA or body.The principle of Gibson package technique is in assembling reaction system, T5 exonuclease can cut inward from 5 ' end of double chain DNA fragment, produce the cohesive terminus that 3 ' distal process goes out, owing to there is homology arm sequence between each fragment, the cohesive terminus fragment of two adjoining complete complementary pairings combines, the breach produced is filled by archaeal dna polymerase and has been connected with Taq DNA ligase, thus realizes the seamless integration of recombinant fragment.
Fig. 1 can help to understand principle of the present invention, and Fig. 1 does not represent unique embodiment of the present invention.The present invention mainly comprises and adopts the two-wheeled PCR that carries out of different primers respectively and take turns to second the process that PCR primer screens.First round PCR relates to the primer in 55 ' to 3 ' directions of Fig. 1 upper end display, two primers wherein with dotted line are anchor point primer, part is anchor point sequence shown in dotted line, respectively with ★, ▲, ◆ be the editor's primer designed for different target Sudden change region; At the denaturation stage of PCR process, parent DNA unwinds and obtains two single stranded DNAs, due to 5 primers all can only with the DNA chain combination in 3 ' to 5 ' direction, therefore, only have the parent DNA chain in 3 ' to 5 ' direction can as template strand in whole PCR process, correspondingly, this takes turns the strand mutant that can obtain a large amount of 5 ' to 3 ' direction after PCR terminates, the single stranded DNA not being used as template on a small quantity, a small amount of and conjugate DNA chain of undergoing mutation being in double-stranded state of template.Using first round PCR mix products as template, or the pure mode of DNA solution post is adopted to reclaim strand mutant as template, to reduce other influence factor.Correspondingly, second takes turns PCR can not change reaction system, adds upstream and downstream external primer directly in first round PCR mix products, or again prepares PCR reaction system.Second takes turns PCR relates to a pair external primer, the anchor point sequences match or identical of this external primer and the anchor point primer in first round PCR, therefore this external primer is only combined with the single stranded DNA with anchor point sequence and carries out amplified reaction, and parent DNA due to lack can with the sequence of anchor point sequences match and can not get increasing.Finally, desirable mutant is obtained by carrying out screening to abundant double chain mutation body storehouse.
Fig. 4 is the One_step PCR obtained after simplifying on the basis of Fig. 1, directly can prepare double chain mutation body library.One_step PCR just with the addition of upstream and downstream external primer in first round PCR reaction system, like this, in the process of reaction, newly-generated strand mutant is combined with upstream or downstream outer end primer, and amplification forms double chain mutation body, and parent's chain is owing to can not combine with external primer, can not be amplified.In the process, the mutant of formation increases with the form of index, and compare two-wheeled PCR reaction system, the mutant of generation is more.Meanwhile, operationally convenient, consuming time short.
The present invention is based on external PCR recombinant technology, synthetic strand mutant library, by the editor primer of design for multiple target area, after PCR, obtain the mutated library extremely enriched containing diversity, after duplexed, adopt extracorporeal recombination to build screening mutant library again.Instant invention overcomes the shortcoming that existing random mutation diversity is not enough, DNA shuffling technology limits by homologous sequence and homologous gene material, and operation is implemented simple, be easy to obtain abundant mutant library, for the outer tachytely of genosome is laid a good foundation.The enzyme of leech Unidasa is successfully lived and is improve 2.5 times by the present invention.
Accompanying drawing explanation
Figure 1 shows that the method schematic diagram of synthesizing single-stranded DNA library Rapid Combination evolution enzyme and pathways metabolism; Two ends dotted line position is anchor point sequence.
Figure 2 shows that the different enzyme activity schematic diagram that hyaluronic acid enzyme mutant shows.
Figure 3 shows that the amino acid mutation site schematic diagram of the hyaluronic acid enzyme mutant of performance enzyme difference alive.
Figure 4 shows that RECODE technology adopts the method schematic diagram of One_step PCR reactive system combination evolution DNA; Two ends dotted line position is anchor point sequence.
Embodiment
Embodiment 1 One_step PCR builds double chain mutation body library and carries out engineered ex vivo to Unidasa
With leech Unidasa gene LHyal for transformation object, nucleotide sequence, as shown in SEQ ID NO.1, according to sequence alignment, chooses the site that 10 places are conservative, design 10 editors's primer (JPS/7HF-P1F to JPS/7HF-P10F), primer information is as follows:
JPS/7HF-P1F:TCTCCGAAAGTTTCCATVNNVNNVNNNNNGATGSGVNNVNNTTTTCACCGAAAGGGTTG
JPS/7HF-P2F:ATCACATCACCGARATTGNNNVNNCTCVNNVNNVNNCTCTCTCCAGSTTWTTTCCGCGT
JPS/7HF-P3F:GTCGGAGGGACGNNNVNNVNNTKGTTAVNNTTTRRCCYCGATGAAAACAACAAATGGAA
JPS/7HF-P4F:GTCAAAYTCRCCAAMKGATCTVNNVNNVNNNTGMTGNTTNATTTAAACGCTGAAGTCAG
JPS/7HF-P5F:AAGGCTATGGAGATNACVNNRRCTGGGAAVNNVNNVNNVNNCCGGATCATACGTCCGCA
JPS/7HF-P6F:CATAAAGTGCTGGAAAAMNATVNNVNNVNNVNNVNNVNNNCATTANTGGGCCCTGACGT
JPS/7HF-P7F:ACGCTTCACCASTACKDSNTTRACGGCMRWNCCKCARMTRDGAGCACATACCTGGACGC
JPS/7HF-P8F:GCACCAAAGATSTTTCGNVVNVVNNTVNNVNNGGTTTTNTTWSGCTTGACAAACTGGGT
JPS/7HF-P9F:AGCCGAATCCAGATTATTGGCTGVNNVNNVNNVNNVNNTCGTTAGTAGGGMVTACGGTC
JPS/7HF-P10F:GAGTGTACGCACAMTGCNCCAAMVNNVNNNCAVNNVNNVNNCAGAGTCGTTWCTACAAG
JPS/7HF-HM-F:GAGGCTGAAGCTTACGTAGAATTCCACCACCACCACCACCACATGAAAGAGATCGCGGTGACAATAGACG
JPS/7HF-HM-R:TGTAGTCAGCGATGCAAATGTTGAAGCGTGCAAAAAGTAAGCGGCCGCGAATTAATTCGC
LHyal-F:GAGGCTGAAGCTTACGTAGAATTC
LHyal-R:GCGAATTAATTCGCGGCCGC
Article two, anchor point primer Jps/7HF-HM-F and Jps/7HF-HM-R and editor's primer are equidirectional, and match with same single-stranded template, and the outer end of two anchor point primers, with the anchor point sequence of bp more than 20, can be used for homologous recombination clone.Cloning vector pPIC9K adopts EcoRI and NotI restriction enzyme to carry out two cutting for linearizing cutaway carrier.According to anchor point sequence, design a pair external primer LHyal-F and LHyal-R for the total length mutator gene that increases, to match with anchor point complete complementary or consistent.
The operation steps building mutated library is as follows: first by 10 editor's primers and the mixing of end downstream anchor point primer JPS/7HF-HM-R equimolar ratio, after phosphatizing treatment, 70 DEG C of 10min fermentoids.In 25 μ l reaction systems: 2.5 μ l 10x reaction buffers, upstream anchor point primer Jps/7HF-HM-F, the downstream anchor point primer Jps/7HF-HM-R of phosphorylation and editor's primer of phosphorylation are in right amount (according to phosphorylation system computing, every bar editor primer 1-5pmol), DNA profiling add-on is about 10-50ng (be 1:100 with primer ratio), upstream outer end primer LHyal-F, downstream outer end primer LHyal-R adds relative to downstream anchor point primer 2 amount doubly respectively, add Phusion DNA polymerase (NEB) 0.5 μ l, Ampligase (EPI) ligase enzyme 1 μ l.Run by following PCR program after mixing: 94 DEG C of 2min, [94 DEG C of 30s, 50 DEG C of 1min, 66 DEG C of 5min] x32,72 DEG C of 5min, 4 DEG C of hold on.PCR primer is mutant library.
PCR primer is cut glue with 1% agarose gel electrophoresis and is reclaimed.Adopt gel to reclaim test kit by specification recommend method and reclaim PCR primer.The mutation library product of recovery and carrier are recombinated, linearized vector adds 50ng, the amount of mutated library fragment and carrier equimolar ratio.The rear 50 DEG C of reaction 60min of recombining reaction system mixing.Total overall reaction liquid transforms Pichia pastoris GS115 competence, operates by normal step of converting, and after cultivating 1h after 30 DEG C, all coating is dull and stereotyped containing the antibiotic MD of 2mg/ml g418, is inverted 30 DEG C and cultivates 48h.
The random picking of the clone grown 1000 is inoculated in 96 deep-well plates, containing (yeast extract 10g/L, peptone 20g/L, 3g/L K in abduction delivering substratum BMMY
2hPO
4, 11.8g/L KH
2pO
4, add water to 895mL, 121 DEG C of sterilizings 20 minutes, then add 100 × YNB 100mL (13.4g/L), 500 × vitamin H 1mL (4 × 10
-4g/L), methyl alcohol 5mL).30 DEG C of 200rpm cultivate, and every 24h adds 1% final concentration and carries out abduction delivering in substratum, abduction delivering 72h.
Carry out batch to the mutant mensuration that just enzyme is lived to carry out in 96 orifice plates, 96 orifice plate nutrient solutions carry out the centrifugal 5min of 3500rpm, after fermented supernatant fluid suitably dilutes, add in 96 orifice plates, add suitable hyaluronic acid substrate (2mg/ml).At 38 DEG C, react 10min, 95 DEG C of applicable 2min, then add the DNS of 2 times of volumes, after abundant mixing, 100 DEG C are boiled 10min, after reaction terminates, add after deionized water suitably dilutes, adopt microplate reader to scan light absorption value under 540nm, then calculate the enzyme activity of mutant according to typical curve.As shown in Figure 2, hyaluronidase activity shows larger difference to result, and the enzyme of mutant is lived and is increased to nearly 2.5 times.Simultaneously, sequencing result analysis shows, the mutational site random combine of Unidasa internal sequence presents abundant diversity combination, mutational site substantially covers 10 regions, and the number of combinations introducing Sudden change region has 1-5 position not simultaneously, maximum amino acid simultaneous mutations reaches more than 30, shown in Fig. 3.Above-described embodiment significantly demonstrates the inventive method and can to evolve efficiently transformation to enzyme gene fast in vitro.
Although the present invention with preferred embodiment openly as above; but it is also not used to limit the present invention, any person skilled in the art, without departing from the spirit and scope of the present invention; all can do various changes and modification, what therefore protection scope of the present invention should define with claims is as the criterion.
Claims (10)
1. a method for efficient evolution enzyme, is characterized in that, mainly comprises and prepares strand mutant library, prepares double chain mutation body library, screening mutant, and strand mutant library and double chain mutation body library step by step or build simultaneously; For building strand mutant library, primer is designed respectively in each targeted mutagenesis region for parental gene, each primer direction is identical, and by adding DNA ligase to connect the nucleotide fragments of respectively undergoing mutation in PCR system, obtains complete strand mutant; For building double chain mutation body library, extra anchor point sequence need be brought in the two ends of strand mutant, is convenient to when duplexed, is designed for the primer of specific amplification strand mutant.
2. method according to claim 1, is characterized in that, the existence form of described parental gene is unrestricted, can be plasmid, genome, double chain DNA fragment or strand cDNA.
3. method according to claim 1 and 2, is characterized in that, for building strand mutant library, for one or more targeted mutagenesis regions of parental gene, designing corresponding primer respectively, being called editor's primer; Described editor's primer contains mutating alkali yl that needs introduce to Sudden change region and 3 ' and 5 ' end has the sequence of mating with template strand of suitable length respectively; When relating to multiple Sudden change region, each editor's primer is equidirectional, all matches with same template strand and combines; Design two and the equidirectional anchor point primer of editor's primer in addition, wherein one is upstream anchor point primer, article one, be downstream anchor point primer, described upstream anchor point primer contains one section holds with template strand 3 ' nucleotide sequence mated, in addition, 5 ' end of this upstream anchor point primer also has the anchor point sequence of 15-25bp; Described downstream anchor point primer contains one section holds with template strand 5 ' nucleotide sequence mated, and in addition, 3 ' end of this downstream anchor point primer also has the anchor point sequence of 15-25bp.
4. method according to claim 3, is characterized in that, needs the site of carrying out suddenling change to be placed in the middle part of editor's primer, can carry out height degeneracy as required.
5. method according to claim 3, is characterized in that, described anchor point primer, also has the function of editor's primer concurrently, namely while as anchor point primer, also containing the mutating alkali yl needing to introduce to Sudden change region.
6. method according to claim 1 and 2, it is characterized in that, described strand mutant library and double chain mutation body library build simultaneously, it is the primer adding specific combination strand mutant in the PCR system directly to structure strand mutant library, limit PCR obtains strand mutant, while with strand mutant for template carries out the amplified reaction of duplexed reaction and double chain mutation body; When described strand mutant library and double chain mutation body library substep build, directly using the PCR mixture containing strand mutant library as template, do not change reaction system, carry out second directly to the primer wherein adding specific combination strand mutant to take turns PCR and prepare the complete double chain mutation body of total length, or using the strand mutant library after reclaiming through column purification as template, again prepare reaction system and carry out second and take turns PCR and prepare the complete double chain mutation body of total length; For building double chain mutation body library, using strand mutant as template, design a pair and match or the identical external primer for specific amplified strand mutant with anchor point sequence, the single stranded DNA of only undergoing mutation can be combined with external primer.
7. method according to claim 1 and 2, is characterized in that, after prepared by described strand mutant library, before the preparation carrying out double chain mutation body library, adopts DpnI digestion with restriction enzyme template strand.
8. method according to claim 1 and 2, is characterized in that, during screening mutant, double-mutant is connected with carrier by application assembled in vitro technology.
9. method according to claim 8, is characterized in that, described assembled in vitro technology is yeast package technique in fusion DNA vaccine, Gibson assembling, the polymerase-mediated recombinant technology of T4DNA or body.
10. method according to claim 1, is characterized in that, described enzyme is leech Unidasa.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510213131.2A CN104877977A (en) | 2015-04-29 | 2015-04-29 | Method for evolving enzyme based on synthetic single-stranded DNA (deoxyribonucleic acid) library |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510213131.2A CN104877977A (en) | 2015-04-29 | 2015-04-29 | Method for evolving enzyme based on synthetic single-stranded DNA (deoxyribonucleic acid) library |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104877977A true CN104877977A (en) | 2015-09-02 |
Family
ID=53945656
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510213131.2A Pending CN104877977A (en) | 2015-04-29 | 2015-04-29 | Method for evolving enzyme based on synthetic single-stranded DNA (deoxyribonucleic acid) library |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104877977A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805508A (en) * | 2015-04-29 | 2015-07-29 | 江南大学 | Method for evolving metabolic pathways based on synthetic single-stranded DNA library |
| CN106544331A (en) * | 2016-10-26 | 2017-03-29 | 中国农业科学院生物技术研究所 | A kind of new directed evolution technologies SNDS and obtained heat-resisting efficient parathion-methyl hydrolyze heterozyme |
| CN108424907A (en) * | 2018-05-09 | 2018-08-21 | 北京大学 | A kind of high throughput DNA multidigit point exact base mutation methods |
| CN109868271A (en) * | 2019-03-21 | 2019-06-11 | 江苏师范大学 | DNA is carried out using chip synthetic oligonucleotide library to shuffle the method for library de novo formation |
| WO2021136194A1 (en) * | 2019-12-30 | 2021-07-08 | 南京金斯瑞生物科技有限公司 | Method for constructing gene mutation library |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1566341A (en) * | 2003-06-12 | 2005-01-19 | 北京安波特基因工程技术有限公司 | In vitro molecular directed evolution method for reshaping antibody |
| US20080233616A1 (en) * | 2005-08-08 | 2008-09-25 | Geneart Ag | Method for Carrying Out the Selective Evolution of Proteins in Vitro |
-
2015
- 2015-04-29 CN CN201510213131.2A patent/CN104877977A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1566341A (en) * | 2003-06-12 | 2005-01-19 | 北京安波特基因工程技术有限公司 | In vitro molecular directed evolution method for reshaping antibody |
| US20080233616A1 (en) * | 2005-08-08 | 2008-09-25 | Geneart Ag | Method for Carrying Out the Selective Evolution of Proteins in Vitro |
Non-Patent Citations (2)
| Title |
|---|
| PENG JIN ETAL: "Combinatorial Evolution of Enzymes and Synthetic Pathways Using One-Step PCR", 《ACS SYNTH. BIOL.》 * |
| SEYFANG A AND JIN JH: "Multiple site-directed mutagenesis of more than 10 sites simultaneously and in a single round", 《ANALYTICAL BIOCHEMISTRY》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104805508A (en) * | 2015-04-29 | 2015-07-29 | 江南大学 | Method for evolving metabolic pathways based on synthetic single-stranded DNA library |
| CN104805508B (en) * | 2015-04-29 | 2017-07-14 | 江南大学 | A kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway |
| CN106544331A (en) * | 2016-10-26 | 2017-03-29 | 中国农业科学院生物技术研究所 | A kind of new directed evolution technologies SNDS and obtained heat-resisting efficient parathion-methyl hydrolyze heterozyme |
| CN106544331B (en) * | 2016-10-26 | 2020-04-28 | 中国农业科学院生物技术研究所 | New directed evolution technology SNDS and obtained heat-resistant high-efficiency methyl parathion hydrolysis heterozygote enzyme |
| CN108424907A (en) * | 2018-05-09 | 2018-08-21 | 北京大学 | A kind of high throughput DNA multidigit point exact base mutation methods |
| CN108424907B (en) * | 2018-05-09 | 2021-10-15 | 北京大学 | High-throughput DNA multi-site accurate base mutation method |
| CN109868271A (en) * | 2019-03-21 | 2019-06-11 | 江苏师范大学 | DNA is carried out using chip synthetic oligonucleotide library to shuffle the method for library de novo formation |
| WO2021136194A1 (en) * | 2019-12-30 | 2021-07-08 | 南京金斯瑞生物科技有限公司 | Method for constructing gene mutation library |
| CN114901820A (en) * | 2019-12-30 | 2022-08-12 | 南京金斯瑞生物科技有限公司 | Method for constructing gene mutation library |
| CN114901820B (en) * | 2019-12-30 | 2024-01-19 | 南京金斯瑞生物科技有限公司 | Method for constructing gene mutation library |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104789556A (en) | Method of carrying out rapid and efficient DNA combination and evolution based on synthesis of single-chain DNA library | |
| CN104877977A (en) | Method for evolving enzyme based on synthetic single-stranded DNA (deoxyribonucleic acid) library | |
| CN100460515C (en) | Improved overlap extension PCR process and mutation gene obtained thereby | |
| CN104593354A (en) | Method for rapid directed evolution of DNA on basis of in vitro combined assembly | |
| CN111548979B (en) | Recombinant escherichia coli for synthesizing lactoyl N-neotetraose and construction method and application thereof | |
| CN107201352A (en) | A kind of beta galactosidase combination mutant with high transglycosylation and its preparation method and application | |
| CN109321552A (en) | A kind of novel Pullulanase and its gene, engineering bacteria and preparation method | |
| CN110229804A (en) | A kind of limonene synzyme SynLS1 and its application | |
| CN106282208B (en) | Crocus sativus and crocus sativus endophytic fungus GGPPS gene, gene cloning method and application | |
| CN104805508B (en) | A kind of method based on synthesizing single-stranded DNA library evolution metabolic pathway | |
| WO2019136618A1 (en) | Gene engineering bacterium for producing uridine at high yield, construction method therefor and application thereof | |
| CN106754987A (en) | A kind of polysaccharide cracks monooxygenase LPMO M1 encoding genes and its enzyme and preparation method and application | |
| CN111041013B (en) | Algin lyase or pectinase and application thereof in cooperative degradation of brown algae | |
| CN104404077A (en) | Method for simultaneously cloning multiple exogenous genes to microbial genome | |
| Lee et al. | A new approach to directed gene evolution by recombined extension on truncated templates (RETT) | |
| CN104531637A (en) | Beta-glucosaccharase, beta-glucosaccharase mutant and application | |
| JP3777158B2 (en) | Method for producing recombinant DNA library using unidirectional single-stranded DNA section | |
| CN101250539B (en) | Method for preparing recombinant heat-proof beta-glucuronic acid enzyme | |
| CN107779443B (en) | Cellobiohydrolase mutants and uses thereof | |
| CN108103049B (en) | Thermophilic L-asparaginase mutant and screening and fermenting method thereof | |
| CN110106154A (en) | A kind of limonene synzyme SynLS2 and its application | |
| CN104789555A (en) | Method of expressing regulatory element based on evolution gene by synthesizing single-chain DNA library | |
| CN105950613B (en) | Method for rapidly assembling non-phosphorylated DNA (deoxyribonucleic acid) fragments in vitro | |
| CN101372694B (en) | Expression of high temperature resistant xylanase gene in Kluyveromyces lactis | |
| CN106755011A (en) | A kind of polysaccharide cracks monooxygenase LPMO M2 encoding genes and its enzyme and preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150902 |