CN104877910B - A kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its application - Google Patents

A kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its application Download PDF

Info

Publication number
CN104877910B
CN104877910B CN201410072690.1A CN201410072690A CN104877910B CN 104877910 B CN104877910 B CN 104877910B CN 201410072690 A CN201410072690 A CN 201410072690A CN 104877910 B CN104877910 B CN 104877910B
Authority
CN
China
Prior art keywords
mine
brefeldin
prepared
bfa
laying
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201410072690.1A
Other languages
Chinese (zh)
Other versions
CN104877910A (en
Inventor
潘华奇
胡江春
王书锦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institute of Applied Ecology of CAS
Original Assignee
Institute of Applied Ecology of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Applied Ecology of CAS filed Critical Institute of Applied Ecology of CAS
Priority to CN201410072690.1A priority Critical patent/CN104877910B/en
Publication of CN104877910A publication Critical patent/CN104877910A/en
Application granted granted Critical
Publication of CN104877910B publication Critical patent/CN104877910B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Abstract

The present invention relates to microbial technology field, specially a kind of new plant endogenesis epiphyte and its brefeldin A is prepared（Brefeldin A, BFA）Application.Plant endogenesis epiphyte is mine-laying penicillium bacterium F4a（Eupenicillium brefeldianum F4a）, China typical culture collection center, deposit number are preserved on December 18th, 2012：CCTCC M2012531.The invention provides the BFA that mine-laying penicillium F4a can produce high content, highest fermentation yield reaches 1.9g/L；Additionally provide the BFA that high-purity is prepared by HP20 SPEs and flash chromatography on silica gel or pure crystallization technique.This method production cost is low, and greatly reduces the processing and pollution of organic matter, and the invention has good industrial prospect.Prepared BFA has antimycotic and insecticidal activity, is preferable for animals or agricultural drug candidate.

Description

A kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its application
Technical field
The present invention relates to microbial technology field, specially a kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its should With.
Background technology
Endophyte of plant refers to that one kind survives in health plant organization internal in its part or all of history of life, without making Host plant shows the microorganism of obvious infection symptoms (at least temporarily without infection symptoms).In long-term evolutionary process with This its special habitats of host form the relation of specific mutualism, and its growth metabolism is by host, external environment factor etc. The restriction of many factors.Nowadays, the important physiology and Ecology Action and its led in agriculture, forestry and medicine that endophyte is played Huge applications potentiality in domain, have been increasingly becoming the focus studied both at home and abroad.Therefore, rich and varied endophyte of plant has turned into Finding the important sources of antitumor, anti-infective and anti-plant pest active material.The invention provides one plant of new plant Endogenetic fungus mine-laying penicillium bacterium F4a, there is very strong antibacterial and insecticidal activity, and it can ferment and produce the mine-laying of high content Luxuriant and rich with fragrance moral rhzomorph A (brefeldin A, BFA)
BFA was divided from penicillium decumbens (Penicillium decumbens) first early in 1958 by Singleton etc. From obtaining and be named as ducumbin. until Weber in 1971 etc. determines the absolute configuration of the compound, and uses Brefeldin A are as its title.So that this title is used till today.BFA is a kind of macrolides for including 13 yuan of rings Antibiotic, it can uncompetitive inhibitor protein be transported to golgiosome from endoplasmic reticulum, therefore with it is antimycotic, antitumor, The extensive biological activities such as antiviral, anti-nematode.The research of National Cancer research institute finds that BFA has selective depression and killed Dead person's activity of tumor cells.BFA independent of p53 Apoptosis mechanisms by inducing Human Prostate Cancer Cells apoptosis, and therefore, BFA is As effective alternative chemotherapeutics of the induction independent of p53 Apoptosis.Akira etc. is used in combination low dosage BFA and carried Homogemcitabines (gemcitabine) and the action effect to human pancreatic cancer cell MIA PaCa-2 cell lines.It can be seen that the chemical combination Thing has the larger market demand as candidate anti-tumor medicine, medicine and pesticide intermediate and important molecular tool reagent. BFA structural formulas are as follows：
BFA is because its various bioactivity and unique chemical constitution cause the interest of synthesis chemists.But by Contain multiple chiral centers in it, therefore chemical synthesis is more complicated and yield is relatively low.Simultaneously as many fungies can ferment Produce BFA, including Cladosporium (Cladosporium), Phoma (Phoma), paecilomyces (Paecilomyces), Phyllosticta (Phyllosticta), Penicillium (Penicillium), Eupenicillium sp (Eupenicillium), aspergillus (Aspergillus) etc..Therefore microbial fermentation, which produces BFA, turns into a kind of effective side Formula.But the microbial fermentation production BFA reported at present yield is relatively low.Such as United States Patent (USP) of Howard inventions The yield that U.S.3896002 discloses Phyllosticta medicaginis fermentations BFA is 300mg/L.Liu Wanyun reports are blue or green It is 151.6mg/L that BFA is produced after the optimized fermentation conditions of mould Penicillium sp.SHZK-15.In inventor Zheng Yu states etc. State patent CN 101445784A, which are disclosed, utilizes the mutagenic obtained mine-laying penicillium mutation of low energy ion beam implantation technology ZJB082702, which can ferment, produces up to 943.8mg/L BFA.Wang second place in 2012 etc. is further to mine-laying penicillium mutation ZJB082702 fermentation condition optimizes, and finally makes BFA yield up to 1304.7 mg/L.
The content of the invention
Present invention aims at provide a kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its application.
To achieve these goals, the technical solution adopted by the present invention is：
A kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a, plant endogenesis epiphyte are mine-laying penicillium bacterium F4a (Eupenicillium brefeldianum F4a), it is preserved on December 18th, 2012 in China typical culture collection The heart, deposit number：CCTCC M 2012531.
Plant endogenesis epiphyte mine-laying penicillium bacterium F4a application, its feature：It is just blue or green using the plant endogenesis epiphyte mine-laying Mould F4a is preparing brefeldin A.
The method for preparing brefeldin A using plant endogenesis epiphyte mine-laying penicillium bacterium F4a,
1) by mine-laying penicillium bacterium F4a fermentation seed liquids according to volume ratio 1:10-1:20 are inoculated in PSB fermentation mediums, 28 DEG C of culture 7-15d；
2) above-mentioned gained zymotic fluid is used into 4-6 layer filtered through gauze, separation of solid and liquid obtains supernatant and mycelium；In filtering Clear liquid uses HP20 macroporous absorbent resin SPEs, and crude extract is obtained with 70-100% ethanol elutions；Mycelium carries through acetone Obtain extract；Merge and be further refining to obtain BFA contents more than 50-65%'s through MeOH after two parts extract is concentrated under reduced pressure Crude extract；
3) above-mentioned crude extract is separated with decompression flash silica gel chromatography, uses 49:1-0:10 (v/v) dichloromethanes Alkane/methanol solvate system carries out gradient elution, and collected volume percentage is 47:3-44:6 methylene chloride/methanol eluent, i.e., Obtain the brefeldin A that purity is 90-99%；
Or, by the crude extract by acetone solution, produce the mine-laying phenanthrene moral that purity is 90-99% under normal temperature overnight Rhzomorph A.
Bacterial strain F4a is inoculated on PSA culture mediums by the step 1) with method of scoring, in 28 DEG C of incubated 4-6d；Then It is inoculated in using block method is dug in the 250mL triangular flasks equipped with 50mL PSB culture mediums, in 28 DEG C of 180rpm constant-temperature table cultures 72h As fermentation seed liquid.
Described compound can be used for the antifungal agent for being prepared into medical, for animals or agricultural non-treatment purpose.
Described compound can be used for being prepared into insecticide.
Described compound can as Candida albicans, Rhizoctonia solani Kuhn, sickle-like bacteria bacteriostatic agent.
Described compound can be prepared as killing artemia agent.
Advantage for present invention：The plant endogenesis epiphyte mine-laying penicillium bacterium F4a of the present invention, it has very strong resist Bacterium and insecticidal action, it, which can ferment, produces the BFA that content is up to more than 1.9g/L.Bacterial strain of the present invention is that production BFA highests are wild Strain.Fermentation medium components are used in the present invention simply and product is more single, can be achieved simple and efficiently extract with separating. The BFA of high-purity can be obtained using SPE and flash chromatography on silica gel or pure crystallization technique using resin.This method is given birth to It is low to produce cost, and greatly reduces the processing and pollution of organic matter.The invention has good industrial prospect.
Brief description of the drawings
Fig. 1 is mine-laying penicillium bacterium F4a provided in an embodiment of the present invention morphological feature.
Fig. 2 is the phyletic evolution that mine-laying penicillium bacterium F4a provided in an embodiment of the present invention is built based on its ITS gene order Tree.
The ESIMS that Fig. 3 is compound brefeldin A provided in an embodiment of the present invention schemes.
Fig. 4 is compound brefeldin A's provided in an embodiment of the present invention1H-NMR (Bruker AV 600, CD3OD) Spectrogram.
Fig. 5 is compound brefeldin A's provided in an embodiment of the present invention13H-NMR (Bruker AV 600, CD3OD) Spectrogram
Fig. 6 is compound brefeldin A provided in an embodiment of the present invention X-ray single crystal diffraction results.
Fig. 7 is mine-laying penicillium bacterium F4a provided in an embodiment of the present invention fermentation production brefeldin A time graph.
Embodiment
In order to be better understood from present disclosure, it is described further with reference to specific embodiment, but this patent Protection content is not limited only to this.
The endophyte of plant mine-laying penicillium bacterium F4a of embodiment 1 identification
Plant endogenesis epiphyte F4a, China typical culture collection center, depositary institution are preserved on December 18th, 2012 Address is Chinese Wuhan Wuhan Universitys, deposit number：CCTCC M 2012531, taxology are named as mine-laying penicillium bacterium F4a (Eupenicillium brefeldianum F4a)。
Bacterial strain F4a well-growns in PDA, martin substratum；Early stage bacterium colony is in pure white, and gradual bacterium colony center becomes Yellow green；Bacterium colony surface is in villiform, no diffusate and soluble pigment；Bacterium colony has radial ridges after maturation, and center is somewhat Protuberance, the significantly circular bacterial plaque of color is formed, the back side is in yellow.Microscopic observation, top is without the top capsule expanded, its conidium knot Structure is rare, and spore is born in conidiophore, in broom shape, stigma apical meristem spore into string-like, conidium it is subsphaeroidal or Pyriform, 2.5-2.0 × 2.2-1.6 μm of size (Fig. 1).
After bacterial strain F4a Liquid Cultures 48h, STb gene is extracted, uses universal primer to carry out ITS gene orders after purified PCR amplifications, PCR primer is sequenced after testing, after purification, is obtained ITS sequence and is submitted GenBank databases, obtains gene The number of logging in：KF682223.BLAST compares analysis result and shown, bacterial strain F4a and Eupenicillium brefeldianum A1163 homology highests, up to 100%.Phylogenetic analysis result shows F4a and Eupenicillium brefeldianum A1163 and Eupenicillium brefeldianum NRRL 710 are in same branch (Fig. 2).Comprehensive morphological feature, F4a is accredited as Eupenicillium brefeldianum.
>F4a ITS
TTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTCCGGCCGCCGGGGGGCATCCGCCCCCGGGCCCG CGCCCGCCGAAGACACCATTGAACGCTGTCTGAAGAATGCAGTCTGAGCGATTAGCTAAATCAGTTAAAACTTTCAA CAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTG AATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCC TCAAGCACGGCTTGTGTGTTGGGCCCCGCCCCCCGGCTACCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGT CCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATCT TTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA
The bacterial strain F4a of embodiment 2 fermentations prepare BFA
The preparation of 2.1 seed liquors：Bacterial strain F4a is inoculated on ready PSA culture medium flat plates with method of scoring first, 28 DEG C incubated 5d；Then diameter 5mm fungus blocks are taken with card punch at mycelial growth on flat board, it is bottled is inoculated in 250mL triangles Have in 50mL PSB culture mediums, 28 DEG C of 180rpm constant-temperature table cultures 72h；
The PSB culture mediums are：20.0g sucrose, 200g potato leachates, with distilled water trim to 1L, pH 5.0~ 8.0,115 DEG C of sterilizing 30min.
PSA then adds the solid medium of 18g agar for every liter of PSB.
2.2 big bottle fermentations：The triangular flask for being 3L with capacity, per bottled PSB culture mediums 0.70L, after 115 DEG C of sterilizing 30min It is standby.Every bottle of inoculation seed liquor 50mL, 28 DEG C of 180rpm constant-temperature tables culture 7-13d, common fermentation 10L；
The acquisition of 2.3 crude extracts：Zymotic fluid will be obtained and use 4-6 layer filtered through gauze, complete separation of solid and liquid.Filtering supernatant Using HP20 macroporous absorbent resin SPEs, the removal of impurities of 15% ethanol elution, 100% ethanol elution obtains 6.09g crude extracts A； Mycelium is through 3 13.23g extract Bs achieved above of acetone extraction.Merge the extract after two parts are concentrated under reduced pressure, and add Pure MeOH solution 200-250mL, ultrasonic 10-20min make it be completely dissolved as far as possible, and then static more than 10min, treats separation of solid and liquid The MeOH supernatants refined are drawn to another round-bottomed flask afterwards, are concentrated under reduced pressure to give BFA contents more than 50% crude extract 11.5g。
2.4 BFA purifying and preparation：
Crude extract above-mentioned first and silica gel mass ratio are about 1:2 ratio mixes sample, is evaporated under reduced pressure to being completely dried.Simultaneously Get out 500-600 mesh column chromatography silica gel posts.After completing dry method loading, gradient elution is carried out according to methylene chloride/methanol system Purify (v/v 49:1-0:10).Collected volume ratio is 45:Elution fraction under 5 methylene chloride-methanol (v/v) elution, is obtained The super 90%BFA5.729g of purity.Or 2.3 gained crude extract about 50mg are stored at room temperature and waved overnight through acetone ultrasonic dissolution Hair solvent can separate out BFA crystal 28mg of the purity more than 95%.
The BFA of embodiment 3 structure elucidation
BFA is clear crystal, and ESI-MS provides (Fig. 3) m/z 303.2 [M+Na]+(Calcd.for C16H24O4Na, 303.1572) to infer its molecular formula be C16H24O4.1H-NMR (600 MHz, CD3OD in) composing (table 1 and Fig. 4), low field area δH 7.46 (1H, dd, J=15.5,2.2 Hz) and 5.82 (1H, d, J=15.5 Hz) form a trans double bond, and one end connects On quaternary carbon；δH5.27 (H, dd, J=15.1,9.7 Hz) and 5.77 (1H, ddd, J=15.1,9.7,4.4 Hz) compositions are another One trans double bond, both ends connect CH and CH respectively2Group.Hydrogen δ on 3 company's oxygen carbonH4.04 (1H, brd, J=9.1 Hz), 4.80 (1H, m) and 4.21 (1H, m) and 1 methyl proton signal δ being connected on CHH1.24 (3H, d, J=6.2 Hz) 。13C-NMR (150 MHz, CD3OD 16 carbon signals (table 1 and Fig. 5) are provided in), wherein 1 ester carbonyl group carbon signal δC 166.96；4 unsaturated carbon signal δC153.69,136.70,129.99,116.37；3 company oxygen sp3The carbon δ of hydridizationC 75.21,71.8,71.56；1 methyl carbon signal δC19.66.It is 5 with reference to its degree of unsaturation is calculated, removes 1 carbonyl and 2 pairs Double bond, compound should be twin nuclei.Can to sum up speculate the compound should be with 2 pairs of trans double bonds, 2 hydroxyls, 1 Methyl, 1 methoxyl group and there is α, the bicyclic macrolide of beta unsaturated ketone.Compound can be primarily determined that with reference to its ESI-MS Planar structure it is identical with BFA.
Because the compound there are 5 chiral centres, therefore its relative configuration is further determined using X-Ray single crystal diffractions. The cell parameter of the chemical combination single crystal diffraction is respectively： Space group is P21 2121, is derived Crystal structure is as shown in Figure 6.The optical activity of the compound is finally determined, its specific rotatory power is obtained by calculating+95.4 ± 2.0 (c 1.40, MeOH).Therefore finally determine that its absolute configuration is (1R, 2E, 6S, 10E, 11aS, 13S, 14aR) -1,13- dihydroxy-6-methyl-6,7,8,9,12,13,14,14a-octahydro-H-cyclopenta[f][1] oxacyclotridecin-4(11aH)-one.I.e. the compound is BFA.Its NMR signal ownership is as shown in table 1.
Table 1.Brefeldin A NMR signal ownership and feature (CD3OD)
The fungi F4a of embodiment 4 produces BFA yield
HPLC quantitative analysis fungi F4a different times fermented supernatant fluids are through HP20 SPEs thing and thalline methanolic extract Middle BFA content.Establish standard curve using Dionex U3000 HPLC systems, using C18 YMC-Pack ODS-A (5 μm, The mm of φ 4.6 × 250) post, elution program is：Initial solvent is methanol：Water (7：3) it is, pure first during linear gradient elution 20min Alcohol, flow velocity 0.53ml/min, Detection wavelength 210nm.
Quantitative analysis results show, BFA since ferment 2d when produce, and gradually increase.Contain in initialization phase zymotic fluid Amount is higher than in thalline, but content is gradually reduced and tended towards stability in zymotic fluid after fermenting 7 days.And content is with hair in thalline The growth of ferment time gradually rises, and reaches peak value when 13d.Zymotic fluid yield highest in 7d, reaches 509.1mg/L, and Thalline highest in 13d, 1605.5mg is up to equivalent to the thalline yield in 1L zymotic fluids.Zymotic fluid and bacterium when amounting to its 13d Brefeldin A yield in body is up to 1939.6 mg/L (Fig. 7).This is the production brefeldin A highest bacterium reported at present Strain.
The measure of the BFA bioactivity of embodiment 5
Compound BFA is determined using paper-agar block diffusion experiment (paper-agar disk diffusion assay) To disease fungus and the inhibitory activity of bacterium.
For filamentous fungi, 9mm fungus blocks will be beaten with card punch after Rhizoctonia solani Kuhn and cucumber fusarium axysporum activation first, connect For kind to PSA flat boards center, 28 DEG C incubated, and when colony growth to diameter is more than 4cm, the BFA of purifying is configured into concentration Respectively 2mg/mL methanol solution.Antifungal activity is determined with filter paper enzyme, applied sample amount is 20 μ L, a diameter of 8mm of filter paper, Deng methanol volatilization on filter paper completely it is follow-up continue 28 DEG C it is incubated grown to disease fungus and be paved with whole flat board when record The diameter of inhibition zone, antibacterial circle diameter is more big, illustrates that antimycotic activity of the bacterial strain is stronger.
Test result indicates that BFA Rhizoctonia solanis and cucumber fusarium axysporum all show good antifungal activity, suppression Bacterium loop diameter is respectively 18mm and 6.4mm.Therefore BFA has the application prospect used as disinfectant use in agriculture.
For Candida albicans, Escherichia coli and bacillus subtilis, then above-mentioned target bacterium is activated first, and with sterilizing Physiological saline is configured to 2-5 × 104Cfu/ml concentration, takes 50ul to be spread evenly across on culture medium.Then will be pre-prepd 2mg/mL BFA solution, antifungal activity is determined with filter paper enzyme, applied sample amount is 20 μ L, a diameter of 8mm of filter paper, continues 28 DEG C Incubated 48h.Inhibitory activity result shows that BFA does not show inhibitory activity to Escherichia coli and bacillus subtilis, and Extremely strong inhibitory activity is shown to Candida albicans, its antibacterial circle diameter reaches 22mm.
Using artemia bioassay method (Brine Shrimp Assay, BSA) evaluation BFA insecticidal activity.Concrete operations： First by above-described embodiment prepare gained compound with the artificial seawater to sterilize be configured to final concentration be respectively 200,100,50, 25th, 12.5, the 6.23 μ g/ml aqueous solution, it is added separately to according to every μ l of hole 100 in 96 hole polystyrene plates of sterilizing, Mei Genong Spend three repetitions.Using the artificial seawater of sterilizing as blank control.Then the artemia liquid hatched in advance is added in each 96 orifice plate, It is 10-20 to make artemia number in every hole, and volume is 200 μ l.Room temperature places 24h, dissects sem observation with binocular, record artemia is dead Number.Concentration of artemia when all dead is set to the minimum of the compound and kills concentration.As a result show, BFA shows stronger Insecticidal activity, its minimum concentration of killing to artemia is 100 μ g/ml.

Claims (6)

  1. A kind of 1. method for preparing brefeldin A using plant endogenesis epiphyte mine-laying penicillium bacterium F4a, it is characterised in that：
    1) by mine-laying penicillium bacterium F4a fermentation seed liquids according to volume ratio 1:10-1:20 are inoculated in PSB fermentation mediums, 28 DEG C Cultivate 7-15d；
    2) above-mentioned gained zymotic fluid is used into 4-6 layer filtered through gauze, separation of solid and liquid obtains supernatant and mycelium；Filtering supernatant Using HP20 macroporous absorbent resin SPEs, crude extract is obtained with 70-100% ethanol elutions；Mycelium obtains through acetone extraction Extract；Merge and be further refining to obtain BFA contents slightly carrying more than 50-65% through MeOH after two parts extract is concentrated under reduced pressure Take thing；
    3) above-mentioned crude extract is separated with decompression flash silica gel chromatography, uses 49:1-0:10 (v/v) dichloromethane/first Alcohol solvent system carries out gradient elution, and collected volume percentage is 47:3-44:6 methylene chloride/methanol eluent, is produced pure Spend the brefeldin A for 90-99%；
    Or, by the crude extract by acetone solution, produce the brefeldin that purity is 90-99% under normal temperature overnight A；
    Plant endogenesis epiphyte was mine-laying penicillium bacterium F4a (Eupenicillium brefeldianum F4a), in 2012 12 The moon is preserved in China typical culture collection center, deposit number on 18th：CCTCC M 2012531；
    The PSB culture mediums are：20.0g sucrose, 200g potato leachates, with distilled water trim to 1L, pH 5.0~8.0,115 DEG C sterilizing 30min.
  2. 2. the side that brefeldin A is prepared using plant endogenesis epiphyte mine-laying penicillium bacterium F4a as described in claim 1 Method, it is characterised in that：
    Bacterial strain F4a is inoculated on PSA culture mediums by the step 1) with method of scoring, in 28 DEG C of incubated 4-6d；Then use Dig block method to be inoculated in the 250mL triangular flasks equipped with 50mL PSB culture mediums, in 28 DEG C of 180rpm constant-temperature table culture 72h conducts Fermentation seed liquid.
  3. 3. the side that brefeldin A is prepared using plant endogenesis epiphyte mine-laying penicillium bacterium F4a as described in claim 1 Method, it is characterised in that：Described compound can be used for the antifungal agent for being prepared into medical, for animals or agricultural non-treatment purpose.
  4. 4. the side that brefeldin A is prepared using plant endogenesis epiphyte mine-laying penicillium bacterium F4a as described in claim 1 Method, it is characterised in that：Described compound can be used for being prepared into insecticide.
  5. 5. the side that brefeldin A is prepared using plant endogenesis epiphyte mine-laying penicillium bacterium F4a as described in claim 4 Method, it is characterised in that：Described compound can as Candida albicans, Rhizoctonia solani Kuhn, sickle-like bacteria bacteriostatic agent.
  6. 6. the side that brefeldin A is prepared using plant endogenesis epiphyte mine-laying penicillium bacterium F4a as described in claim 4 Method, it is characterised in that：Described compound can be prepared as killing artemia agent.
CN201410072690.1A 2014-02-27 2014-02-27 A kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its application Active CN104877910B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410072690.1A CN104877910B (en) 2014-02-27 2014-02-27 A kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410072690.1A CN104877910B (en) 2014-02-27 2014-02-27 A kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its application

Publications (2)

Publication Number Publication Date
CN104877910A CN104877910A (en) 2015-09-02
CN104877910B true CN104877910B (en) 2017-12-19

Family

ID=53945591

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410072690.1A Active CN104877910B (en) 2014-02-27 2014-02-27 A kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its application

Country Status (1)

Country Link
CN (1) CN104877910B (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107827805B (en) * 2017-06-05 2021-01-22 海南师范大学 Indole diterpenoid compound derived from mangrove plant xylocarpus meliloti fungi as well as preparation method and application thereof
CN109111422A (en) * 2017-06-23 2019-01-01 沈阳药科大学 Macrolides compound and its application in preparation prevention and treatment plant-pathogenic pathogenic bacteria drug
CN114058516B (en) * 2020-08-01 2023-07-28 中国海洋大学 Penicillium fungus N29 capable of producing brefeldin A from ocean source and application thereof
CN113773287B (en) * 2021-08-30 2023-06-16 中国科学院沈阳应用生态研究所 Bioactive secondary metabolite and preparation and application thereof
CN113583881B (en) * 2021-09-13 2023-03-21 福建省微生物研究所 Penicillium strain for producing brefeldin A by fermentation and application thereof
CN114874915B (en) * 2022-01-24 2023-06-23 中国人民解放军陆军军医大学 Cordycepin A-producing endophytic fungus and application thereof
CN115074255A (en) * 2022-06-24 2022-09-20 自然资源部第三海洋研究所 Fusarium and application of fermentation compound thereof in preventing and treating necrosis apoptosis-related diseases

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4305249A1 (en) * 1993-02-20 1994-08-25 Hoechst Ag Galactosylbrefeldin A, a metabolite with pharmacological action, a process for its preparation and its use
CN101445784A (en) * 2008-12-31 2009-06-03 浙江工业大学 Eupenicillium brefeldianum variety ZJB082702 and application thereof in preparation of Brefeldin A by fermentation
CN101580805A (en) * 2009-03-31 2009-11-18 中国人民解放军第二军医大学 Brefeldin A-producing bacteria and method for preparing brefeldin A by fermentation
CN102399210A (en) * 2011-11-18 2012-04-04 浙江工业大学 Method for separating and extracting high-purity brefeldin A from fermentation liquor

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE4305249A1 (en) * 1993-02-20 1994-08-25 Hoechst Ag Galactosylbrefeldin A, a metabolite with pharmacological action, a process for its preparation and its use
CN101445784A (en) * 2008-12-31 2009-06-03 浙江工业大学 Eupenicillium brefeldianum variety ZJB082702 and application thereof in preparation of Brefeldin A by fermentation
CN101580805A (en) * 2009-03-31 2009-11-18 中国人民解放军第二军医大学 Brefeldin A-producing bacteria and method for preparing brefeldin A by fermentation
CN102399210A (en) * 2011-11-18 2012-04-04 浙江工业大学 Method for separating and extracting high-purity brefeldin A from fermentation liquor

Also Published As

Publication number Publication date
CN104877910A (en) 2015-09-02

Similar Documents

Publication Publication Date Title
CN104877910B (en) A kind of plant endogenesis epiphyte mine-laying penicillium bacterium F4a and its application
CN108165500A (en) One plant of marine fungi Aspergillus terreus C23-3, zymotic fluid activity extract and its preparation method and application
CN103555607B (en) A kind of endophyte H6 strain separation methods in silk tree blade and its application
CN109232493A (en) A kind of sesquiterpenoid and its preparation method and application
CN108315264A (en) A kind of polyketide in sea paint endogenetic fungus source and its application in preparing anti-inflammatory drug
CN108353906A (en) The application of indole -3-formaldehyde and its derivative in preventing the plant disease caused by plant pathogenic fungi
CN107974412B (en) Penicillium roqueforti for preparing anti-inflammatory active compound peniroquesine A and application thereof
CN108033905B (en) The preparation method and application of compound pencolide
CN103937678A (en) Marine fungi penicillium crustosum bacterial strain, quinolinone compounds derived from marine fungi penicillium crustosum, and preparation and applications of quinolinone compounds
WO2023019821A1 (en) Azaphilone polymer compound, and preparation method therefor and use thereof
CN108033877A (en) A kind of anti-MRSA naphthalene compounds and preparation method thereof
CN101274885A (en) Anthraquinone coumpound for inhibitating plant pathogenic fungi
CN104877925B (en) A kind of different wall actinomyces and three kinds of new antimycotic maclafungins classes compounds and its preparation and application
CN108101778A (en) A kind of 14 carbon chain fatty acid class antagonistic substances generated from bacillus amyloliquefaciens SQR9 and its application
CN109400444B (en) Sesquiterpenoids for inhibiting plant pathogenic fungi and preparation method thereof
CN100387609C (en) Novel antibiotic preparing process
CN110028500A (en) Apparent modification Aspergillus terreus secondary metabolites and its purposes in the preparation of antitumor drugs
CN108017528A (en) A kind of naphthalene compounds and preparation method and application
CN109971655B (en) Astragalus membranaceus endophytic Chaetomium sp HQ-1 and application thereof
CN109385380A (en) A kind of actinomyces chlorins compound and the preparation method and application thereof
Wang et al. Biotransformation of geniposide by Synechocystis sp. PCC 6803 into genipin and its inhibitory effects on BEL-7402, Escherichia coli, and cyanobacteria
Chen et al. Collection, purification and structure elucidation of allelochemicals in Streptomyces sp. 6803
CN110881466B (en) Application of ixomycin compound in resisting tobacco brown spot and extraction method
CN108002999B (en) Naphthalene compound and preparation method and application thereof
CN106727456B (en) A kind of chloro quinone is preparing the application in antibacterial agent or anti-tumor drug

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
EXSB Decision made by sipo to initiate substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant