CN104862324B - Applications of the '-hydroxylase gene Dr2473 in microorganism catalysis synthesis - Google Patents
Applications of the '-hydroxylase gene Dr2473 in microorganism catalysis synthesis Download PDFInfo
- Publication number
- CN104862324B CN104862324B CN201510296770.XA CN201510296770A CN104862324B CN 104862324 B CN104862324 B CN 104862324B CN 201510296770 A CN201510296770 A CN 201510296770A CN 104862324 B CN104862324 B CN 104862324B
- Authority
- CN
- China
- Prior art keywords
- gene
- compound
- deinococcus radiodurans
- genes
- strain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The present invention is found that a kind of gene with hydroxylase function from Deinococcus radiodurans Deinococcus radiodurans.The present invention constructs the recombinant vector containing the gene, by it in prokaryotic host cell expression in escherichia coli.It is demonstrated experimentally that after the gene is expressed in prokaryotic host cell, carotenoid can be catalyzed and carry out hydroxylating, available for microorganism catalysis biosynthesis.
Description
Technical field
The invention belongs to microbial technology field, it is related to one kind in carotenoidses secondary metabolite building-up process
Play the novel gene of hydroxylase function.
Background technology
Secondary metabolite is produced by secondary metabolism, the class cell activities life by precursor of metabolite
Long development normally runs nonessential small molecular organic compounds.Secondary Metabolites of Microorganisms because its structure with activity it is various
Property have and have been widely used on medicine and agricultural production.
Carotenoidses compound is that a class is main by plant or the secondary metabolite of Microbe synthesis, with antioxygen
Change activity, quenching singlet oxygen is shown as in organism, remove free radical, prevent the functions such as lipid peroxidation.Carotenoid
Class compound, the anti-oxidation characteristics having by it by as the activity in food colour, feed addictive and medicine cosmetics into
Divide and use.It can also be used for the material composition resistance degradation disease in functional food and medicine, such as cancer, skin simultaneously
Associated conditions and heart disease etc..
Deinococcus radiodurans are acknowledged as the life with most dense ionization radioresistance and oxidation resistance found so far
Thing.It can the special carotenoid of composite structure-exception lutein ((2R) -2,1 '-dihydroxy -3 ', 4 '-two dehydrogenations -1 ',
2 '-dihydro-β,-carrotene -4- ketone).Compound Beta- rings end adds C-2 hydroxyl substitutions.What is determined at present
In carotenoid compounds, this C-2 hydroxyl mono-epoxide carotenoid is that abnormal cocci belongs to distinctive, and is different from
The C-3 hydroxylating carotenoids of other reports.
In Deinococcus radiodurans, it has been found that and identify a series of participation carrotene building-up process function enzymes
Encoding gene, but the crucial '-hydroxylase genes of C-2, Beta rings have not been reported.
The content of the invention
The purpose of the present invention is to find that one kind is used for virtue from Deinococcus radiodurans Deinococcus radiodurans
The fragrant hydroxylated '-hydroxylase gene of ring.
The present invention has found Deinococcus radiodurans Dr2473 genes (GeneID first by studying as follows：1800296；
ProteinID：NP_296193.1 it) can be used for microbial compounds biosynthesis.Specific research work is as follows：
1st, the recombinant strain containing Dr2473 genes is obtained
1) Dr2473 genes are gone out from Deinococcus radiodurans genome amplification by PCR, gene order number is：GeneID：
GeneID：1800296.Its size is 1146bp, and 382 amino acid of the gene code are cloned on carrier pJET, is built
Contain the recombinant plasmid pJET-2473 of complete Dr2473 genes；
2) Dr2473 genes are connected on pRADZ3 shuttle plasmids, the plasmid, which contains, all to be worked in Escherichia coli
GroEL promoters, build the complete Dr2473 gene recombination plasmids pRADZ3-2473 containing groEL promoters；
3) the recombinant plasmid pRADZ3-2473 for importing Dr2473 genes is transferred in recipient E. coli JM109, obtains work
Journey bacterial strain JM-2473 (detailed in Example 1)；
2nd, the compound synthesis test experience containing Dr2473 genetic recombination engineered strains
It is experimentally confirmed that being added into culture medium after carotenoidses substrate compounds, contain thermophilic abnormal cocci Dr2473
Substrate compounds can be processed further by the JM-2473 recombinant bacterial strains of gene, and it is anti-to carry out hydroxylating in the site of Beta rings 2 or 2 '
Should.
This experiment shows：Deinococcus radiodurans Dr2473 genes have is catalyzed carotenoidses chemical combination in microorganism
The site of thing Beta rings 2 or 2 ' carries out the effect of hydroxylating.
Sequence table information
SEQ ID NO.1：The DNA sequence dna of Dr2473 genes.
SEQ ID NO.2：Dr2473 amino acid sequence.
Brief description of the drawings：
The HPLC of Fig. 1 engineered strains JM-2473 and control strain JM-Z3 product Compound is analyzed.In figure, A control bacterium
Strain JM-Z3 product peak type figure；B engineered strains JM-2473 product peak type figure；
The mass spectral analysis of Fig. 2 substrate compounds.A is No. 1 compound interpretation of mass spectra figure of substrate；
The mass spectral analysis of Fig. 3 product Compounds.B is No. 2 compound interpretation of mass spectra figures of product.
Embodiment
The hydroxylated object of plasmid, bacterial strain and microorganism catalysis lifted in following examples is served only for present invention work
It is further described, the substantive content to the present invention is not any limitation as.All unreceipted specific experiment conditions, be according to
Normal condition well known to those skilled in the art or according to the condition proposed by manufacturer.The plasmid lifted in embodiment, bacterium
Strain source is as follows：
Cloning vector pJET：For ThermoFisher companies market products；
Shuttle plasmid pRADZ3：Preserved for this laboratory；
Escherichia coli JM 109：For Beijing Quan Shi King Companies commercially available prod.
Carotenoid substrate is isolated from Deinococcus radiodurans by the applicant laboratory；
Title is 2-deoxy deinoxanthin, and structure is as follows：
Expression of the Deinococcus radiodurans Dr2473 gene orders of embodiment 1 in Escherichia coli
First, experimental method
1. the Dr2473 gene orders in the Deinococcus radiodurans genome announced design 1 pair of PCR specificity
Primer：
0395-F：5′ACCACTAGT ATGCTTTCCTCTCTGCACGATTTGCCC 3′
0395-R：5′ACCCATATG CTAGCGCCGCTCCACGACCA 3′
2. objective gene sequence is amplified from Deinococcus radiodurans genomic DNA by PCR method.
Reaction condition：94 DEG C of 10min, [94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 1.5min] 35 circulations, 72 DEG C
10min。
3.PCR products are cloned on carrier pJET after glue reclaim, are named as pJET-2473, and sequence verification；Then
Dr2473 genes containing cohesive end and the pRADZ3 carriers containing groEL promoters are obtained by SpeI/NdeI double digestions,
Dr2473 genes are connected on pRADZ3 carriers, coli expression carrier pRADZ3-2473 is built.
4. the expression vector is converted into e. coli jm109, through PCR, digestion, sequence verification insetion sequence is correct, by this
Strain Designation is JM-2473.JM-Z3 is named as containing the pRADZ3 E.coli JM109 for compareing empty plasmid.
2nd, experimental result
Successfully construct expression Dr2473 recombination bacillus coli engineered strain.
The catalytic activity experiment of the Dr2473 genetic recombination engineered strains of bacterial strain containing Deinococcus radiodurans of embodiment 2
First, experiment material
Recombinant strain：The JM-2473 bacterial strains containing Dr2473 genes that embodiment 1 is obtained
Control strain：JM-Z3 bacterial strains containing empty plasmid described in embodiment 1.
2nd, experimental method
1. control strain and recombinant strain are activated in the flat lining out of LB solid mediums；
2. picking single bacterium colony is inoculated in the LB liquid medium added with corresponding antibiotic, after 37 DEG C of cultures are into index
Phase；
3. adding carotenoid substrate compounds into culture medium, 37 DEG C are continued to cultivate 24 hours.
4. centrifuge 10min；Supernatant discarding, collects thalline.Operating process is tried one's best lucifuge.
5. 3mL sterilized waters, washing thalline are added into pipe.Thalline is shifted into 15mL centrifuge tubes.4 DEG C, centrifuge 10min；
Supernatant discarding.
6. thalline, concussion extracting 10min is resuspended with 2mL acetone solns.10min is centrifuged, supernatant extract is transferred to newly
Guan Zhong.
7. adding 2mL ethyl acetate solutions into former pipe, continue to vibrate extracting 10min.10min is centrifuged, supernatant is extracted
Liquid is mixed with last extract, and adds 3mL sterilized waters thereto, and vibration is mixed.
8. extract is centrifuged into 20min with maximum (top) speed, Aspirate supernatant is used for HPLC and analyzes detection or -80 DEG C of refrigerators guarantors
Deposit standby.
Efficient liquid phase chromatographic analysis is carried out using the Series HPLC System of Hewlett-Packard 1050.Chromatographic column is.Sample applied sample amount is 100
μ L, carotenoidses compound is diluted analysis by using the graded of mobile phase.Mobile phase solution B variable gradient
For in 30min from 10%-60%.(A：Acetonitrile：Water：Triethylamine, 90:10:0.1；B：100% ethyl acetate), flow velocity is 1mL/
min.Collect and mass spectral analysis is carried out to difference product, and carry out NMR analyses.
3rd, experimental result
Such as Fig. 1 shows that expression Deinococcus radiodurans bacterial strain Dr2473 genetic recombination engineered strain JM-2473 are free with containing
The control strain JM-Z3 of plasmid product peak type is dramatically different.The primary product peak of control strain is No. 1 peak in Figure 1A, is retained
Time is at 7 minutes；And the primary product peak in Dr2473 genetic recombination engineered strains JM-2473 is expressed in Figure 1B for No. 2 peaks,
Retention time is at 5 minutes.Mass spectral analysis is carried out to No. 1 peaking compound and No. 2 peaking compounds, as a result such as Fig. 2 is shown, No. 1 peak
The 2-deoxy that compound is 566 for the carotenoid substrate compounds molecular weight that we add into culture medium
deinoxanthin；No. 2 peaking compounds are the product Compound (Fig. 3) that molecular weight is 582, are added compared with substrate compounds
One oh group；1H NMR analysis results are parsed to No. 2 product structures, and No. 2 product Compounds enter to No. 1 compound
Hydroxylating is gone, hydroxylated sites are C2, carotenoid Beta rings, product is exception lutein deinoxanthin
(table 1, Fig. 3).
4th, experiment conclusion
It can be catalyzed on the ring of carotenoidses compound in Dr2473 albumen and occur hydroxylation.
Because gene of the present invention comes from Deinococcus radiodurans, the class Hu trailing plants obtained using the metabolic intermediate of abnormal cocci
Foretelling chlorins compound has 1 ring.2, the ring there occurs hydroxylating in this experiment.Prove that Dr2473 albumen can be catalyzed class Hu trailing plants
Foretell the hydroxylating of chlorins compound ring.
Thereby it can be assured that work as the carotenoidses compound with two rings under Dr2473 proteins carries, two
Hydroxylating may all occur for 2 (commonly referred to as 2 or 2 ' positions) of ring.
The product 2 of table 11H nuclear magnetic resonance datas
4th, experiment conclusion
Deinococcus radiodurans Dr2473 genes have is catalyzed carotenoidses compound progress ring hydroxyl in microorganism
Change the effect of reaction.It is a kind of new hydroxylase, has in medicine, industry and the compound biosynthesis of agricultural important
Application potential.
Claims (3)
1.SEQ ID NO:The gene of sequence shown in 1 is catalyzed the position of Beta rings 2 or 2 ' of carotenoidses compound in microorganism
Point carries out the application of ring hydroxylating.
2. the application described in claim 1, the microorganism is prokaryotes.
3.SEQ ID NO:The hydroxylase of sequence shown in 2 is carried out in the site of Beta rings 2 or 2 ' of catalysis carotenoidses compound
The application of hydroxylating.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510296770.XA CN104862324B (en) | 2015-06-02 | 2015-06-02 | Applications of the '-hydroxylase gene Dr2473 in microorganism catalysis synthesis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510296770.XA CN104862324B (en) | 2015-06-02 | 2015-06-02 | Applications of the '-hydroxylase gene Dr2473 in microorganism catalysis synthesis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104862324A CN104862324A (en) | 2015-08-26 |
| CN104862324B true CN104862324B (en) | 2017-10-27 |
Family
ID=53908500
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510296770.XA Active CN104862324B (en) | 2015-06-02 | 2015-06-02 | Applications of the '-hydroxylase gene Dr2473 in microorganism catalysis synthesis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104862324B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106636244A (en) * | 2016-10-13 | 2017-05-10 | 中国农业科学院生物技术研究所 | Application of polyketone synthase gene DrA0326 |
-
2015
- 2015-06-02 CN CN201510296770.XA patent/CN104862324B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| CYP287A1 is a carotenoid 2-β-hydroxylase required for deinoxanthin biosynthesis in Deinococcus radiodurans R1;Zhengfu Zhou 等;《Appl Microbiol Biotechnol》;20150831(第99期);10539-10546 * |
| WP_010889098.1;无;《GENBANK》;20130515;1 * |
| 耐辐射球菌类胡萝卜素活性基团合成酶的研究;孙宗涛;《中国博士学位论文全文数据库》;20101215(第12期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104862324A (en) | 2015-08-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tang et al. | Microbial conversion of glycerol to 1, 3-propanediol by an engineered strain of Escherichia coli | |
| Luo et al. | Activation and characterization of a cryptic polycyclic tetramate macrolactam biosynthetic gene cluster | |
| Jung et al. | Bioconversion of p-coumaric acid to p-hydroxystyrene using phenolic acid decarboxylase from B. amyloliquefaciens in biphasic reaction system | |
| CN104099379B (en) | A kind of method and application of the biosynthesis tyrosol in Escherichia coli | |
| Karande et al. | Continuous cyclohexane oxidation to cyclohexanol using a novel cytochrome P450 monooxygenase from Acidovorax sp. CHX100 in recombinant P. taiwanensis VLB120 biofilms | |
| Qadri et al. | An insight into the secondary metabolism of Muscodor yucatanensis: small-molecule epigenetic modifiers induce expression of secondary metabolism-related genes and production of new metabolites in the endophyte | |
| CN102787135B (en) | Method for improving phloroglucinol synthetic capability of engineering escherichia coli | |
| Rasoul-Amini et al. | Biotransformation of monoterpenes by immobilized microalgae | |
| Suyama et al. | Photosynthetic apparatus in Roseateles depolymerans 61A is transcriptionally induced by carbon limitation | |
| Matroodi et al. | Genotyping-guided discovery of persiamycin A from sponge-associated halophilic Streptomonospora sp. PA3 | |
| CN103509816B (en) | Produce the construction process of Coenzyme Q10 99.0 engineering bacteria, engineering bacteria and application thereof | |
| CN112126610A (en) | Engineering bacterium for producing hydroxytyrosol | |
| JP6181972B2 (en) | Method for producing aromatic compound | |
| CN108949649B (en) | Engineering bacterium and application thereof in producing levodopa | |
| CN104862324B (en) | Applications of the '-hydroxylase gene Dr2473 in microorganism catalysis synthesis | |
| Balakumaran et al. | Modeling of process parameters for enhanced production of coenzyme Q10 from Rhodotorula glutinis | |
| CN104762242B (en) | The production bacterium of mevalonic acid and the method for producing mevalonic acid | |
| CN108949647B (en) | Engineering bacterium and application thereof in production of L-tyrosine | |
| CN108949648B (en) | A kind of engineering bacteria and its with the application of cheap substrates production danshensu | |
| CN108220264A (en) | A kind of application of glycosyl transferase in biosynthesis rhodioside | |
| Mouad et al. | Bioreduction of acetophenone derivatives by red marine algae Bostrychia radicans and B. tenella, and marine bacteria associated | |
| CN103820506B (en) | A kind of method of gene recombination bacterium fermentation preparation of cozymase Q 10 | |
| Liu et al. | A gene cluster for the biosynthesis of dibenzodioxocinons in the endophyte Pestalotiopsis microspora, a Taxol Producer | |
| Fuentes et al. | Work scheme to isolate the different micro‐organisms found in hydrogen‐producing reactors: a study of effectiveness by pyrosequencing analysis | |
| CN107058365B (en) | Gene engineering bacterium for co-catalytic synthesis of 2,3-butanediol by isozyme, and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |