CN104861068B - Fully human anti-HER 3 antibody and application thereof in treating related diseases - Google Patents

Abstract

The present application belongs to the field of genetically engineered antibodies. The invention provides a fully human targeted HER3scFv antibody and a coding gene thereof. The fully human HER 3-targeted scFv antibody can be combined with human HER3, and can obviously inhibit the proliferation of MDA-MB-453 under the premise of NRG1 stimulation. The antibodies of the invention have strong affinity to HER 3. The antibody of the invention has strong activity, is a fully human antibody, and has wide clinical and experimental application prospects.

Description

Fully human anti-HER 3 antibody and application thereof in treating related diseases

Technical Field

The invention relates to the field of genetically engineered antibodies, in particular to a genetically engineered antibody specifically bound with epidermal growth factor HER3 and application thereof in preparing a medicament for treating HER3 related diseases.

Background

HER3 is also called ErbB3, LCCS2, ErbB-3, c-erbB3, erbB3-S, MDA-BF-1, c-erbB-3, p180-ErbB3, p45-sErbB3 and p85-sErbB3, is one of the epidermal growth factor family members of tyrosine kinase, and has the size of 161 kDa. The human HER3 gene maps to chromosome 12q 13. This family consists of 4 members, EGFR, HER2, HER4 in addition to HER 3. Each member is composed of three parts, namely an extracellular region ligand binding region, a transmembrane region and an intracellular kinase region. The extracellular region of HER3 has a neuregulin binding site but no kinase activity intracellularly. Therefore, heterodimers with other members of the family are required before activation of the MAPK, PI3K-Akt pathways can occur.

The importance of multiple tumor gene therapy based on the HER family members EGFR and HER2 targets is undoubted. It has been confirmed that the EGFR family is dependent on the interaction of members of the respective families in the pathogenesis of cancers such as breast cancer, lung cancer, head and neck cancer, and the like. Among them, the formation of EGFR/HER3, HER2/HER3 heterodimers plays an important role in the development of resistance mechanisms in various cancer pathogenesis and antibody treatment strategies based on EGFR, HER 2.

Tumor types with high expression of HER 3: 1) HER3 is highly expressed in HER2 mediated breast tumors. The unique and key role of HER3 in HER2 oncogenic mechanism is emphasized by the fact that the tumor reduction is caused after the HER3 expression is knocked down in HER2 high-expression tumors, the effect is consistent with the effect of knocking down HER2, and the tumor reduction is not caused by knocking down EGFR in the tumor model, and in addition, the detection of clinical samples shows that the HER3 high expression has high consistency with the HER2 high expression in a HER2 high-expression breast cancer sample, and the correlation between the EGFR and the HER2 expression is avoided. 2) HER3 is highly expressed in melanoma. HER2 is low expressed in melanoma, but HER3 is likely to be a synergistic molecule of EGFR and/or HER4, is significantly high expressed in melanoma, and is associated with poor malignancy and prognosis of the disease. 3) The incidence of high expression of HER3 in lung cancer is 18% -100%, especially in non-small cell lung cancer (NSCLC) resistant to EGFR Tyrosine Kinase Inhibitor (TKI) gefitinib treatment, the high expression rate of HER3 is 100% compared to treatment-sensitive NSCLC, and furthermore, in NSCLC patients, high expression of HER3 has a significant correlation with brain metastasis and short survival. 4) HER3 was significantly highly expressed in children's osteosarcoma and in certain types of prostate, colon and ovarian cancers (expression rate between 10-90%), but its high expression in these tumors did not give regular results, although its involvement mechanism has not been elucidated, but it was confirmed that high expression of HER3 was associated with high metastasis, poor prognosis.

At present, several companies at home and abroad have focused on developing anticancer drugs with HER3 as targets, for example, the fully human monoclonal antibody AMG888 developed by U3Phaima GmbH is in clinical research stage, while the fully human monoclonal antibody MM-121 and the bispecific antibody MM-111 developed by Merck are in clinical stages 1-2. Particularly, the compound is directed to the site of HER3 with the activity deletion of the kinase domain, which cannot be used as the action target of small molecule inhibitor drugs, so that only antibody drugs or gene drugs can be developed. Meanwhile, based on the fact that HER3 plays a very important role in the occurrence, development, drug resistance and prognosis of various cancers, antibody drugs targeting HER3 will play an important role in the treatment and research of HER 3-related cancers, which is also a problem to be solved at present.

Disclosure of Invention

The invention aims to provide a fully human monoclonal antibody with inhibiting activity on HER 3. Another object of the present invention is to provide a pharmaceutical composition or a reagent, a kit or a chip comprising the antibody. The invention also aims to provide the application of the anti-HER 3 antibody in preparing a medicament for treating HER3 related diseases.

The term "antibody" as used herein should be construed to encompass any specific binding member having a binding domain with the desired specificity. Thus, this term encompasses antibody fragments, derivatives, and functional equivalents and homologues of antibodies homologous thereto, and also encompasses any polypeptide, whether natural or synthetically produced, that comprises an antigen-binding domain. Examples of antibodies are immunoglobulin subtypes (e.g., IgG, IgE, IgM, IgD and IgA) and subclasses thereof; it may also be a fragment comprising an antigen binding domain such as a Fab, scFv, Fv, dAb or Fd, or a diabody. Chimeric molecules comprising an antigen binding domain fused to another polypeptide or an equivalent are also included.

The monoclonal antibodies of the invention may be, for example, monovalent or single chain antibodies, diabodies, chimeric antibodies, and derivatives, functional equivalents and homologs of the foregoing, including antibody fragments and any polypeptides comprising an antigen binding domain.

Antibodies can be modified in a number of ways and recombinant DNA techniques can be used to generate other antibodies or chimeric molecules that retain the original antigenic specificity. Such techniques may involve introducing DNA encoding the immunoglobulin variable regions or Complementarity Determining Regions (CDRs) of an antibody into the constant regions or constant region plus framework regions of different immunoglobulins. Genetic mutations or other changes may also be made to the cells expressing the antibody, which may or may not alter the binding specificity of the antibody produced.

The monoclonal antibodies of the invention are framework regions in addition to the hypervariable regions CDR1, CDR2 and CDR3 and the linking sequences in the heavy and light chains. The framework regions can be replaced by other sequences under conditions that leave the three-dimensional structure required for binding unaffected, and the molecular basis for antibody specificity is derived primarily from its hypervariable regions CDR1, CDR2 and CDR 3. These regions are key sites for binding to antigens. To maintain preferred binding properties, the sequence of the CDRs should be preserved as much as possible, however, some amino acid changes may be required to optimize binding properties, and one skilled in the art can do so using standard practice.

The invention provides a monoclonal antibody, wherein a heavy chain variable region of the monoclonal antibody contains CDR1, CDR2 and CDR3 which have amino acid sequences shown in SEQ ID NO 7, SEQ ID NO 8 and SEQ ID NO 9, and a light chain variable region of the monoclonal antibody contains CDR1, CDR2 and CDR3 which have amino acid sequences shown in SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12.

Variants of the CDRs of the variable region may have substitutions of up to 6 amino acid residues (e.g., 1, 2, 3, 4, or 5 amino acid substitutions) with the above CDR regions, and in monoclonal antibodies having CDR variants, the CDR region variants have binding activity to HER 3.

In one embodiment, the heavy chain variable region of the monoclonal antibody of the invention has the amino acid sequence shown in SEQ ID No. 4, or has at least 95% identity with SEQ ID No. 4 derived from the amino acid sequence of the heavy chain variable region by substitution, deletion, or addition of one or more amino acids, and the monoclonal antibody has the activity of specifically binding to HER 3.

In a specific embodiment, the nucleotide sequence encoding the variable region of the heavy chain is set forth in SEQ ID NO 1.

In one embodiment, the light chain variable region of the monoclonal antibody of the invention has the amino acid sequence shown in SEQ ID No. 5, or has at least 95% identity with SEQ ID No. 5 derived from the amino acid sequence of the light chain variable region by substitution, deletion, or addition of one or more amino acids, and the monoclonal antibody has the activity of specifically binding to HER 3.

In a specific embodiment, the nucleotide sequence encoding the variable region of the light chain is set forth in SEQ ID NO 2.

In one embodiment, the heavy chain amino acid sequence of the monoclonal antibody of the invention is as shown in SEQ ID NO. 15, or the heavy chain amino acid sequence thereof is at least 95% identical to SEQ ID NO. 15 by substitution, deletion, or addition of one or more amino acids, and the monoclonal antibody has the activity of specifically binding to HER 3.

In one embodiment, the light chain amino acid sequence of the monoclonal antibody of the invention is as shown in SEQ ID No. 16, or the light chain amino acid sequence thereof is at least 95% identical to SEQ ID No. 16 by substitution, deletion, or addition of one or more amino acids, and the monoclonal antibody has the activity of specifically binding to HER 3.

In one embodiment of the invention, the monoclonal antibody is a single chain antibody having the amino acid sequence of the heavy chain variable region of SEQ ID No. 4 or at least 95% identity to SEQ ID No. 4, and the single chain antibody has the activity of specifically binding to HER 3.

In one embodiment of the invention, the monoclonal antibody is a single chain antibody having the amino acid sequence of SEQ ID No. 5 in the light chain variable region or at least 95% identity to SEQ ID No. 5, and the single chain antibody has the activity of specifically binding to HER 3.

In one embodiment of the invention, the monoclonal antibody is a single chain antibody having the amino acid sequence of SEQ ID NO. 14 or at least 95% identity to SEQ ID NO. 14 and having the activity of specifically binding HER3, wherein the linker has the amino acid sequence of SEQ ID NO. 6.

In a specific embodiment of the invention, the coding nucleotide sequence of the single-chain antibody is SEQ ID NO. 13, and the coding nucleotide sequence of the contained linker (linker) is SEQ ID NO. 3.

In another embodiment, the antibody may comprise: a) a heavy chain variable region which differs in amino acid sequence by up to 6 amino acid sequence substitutions, e.g., 1, 2, 3, 4, 5, or 6 amino acid substitutions, as compared to the sequence set forth in seq id No. 4, and b) a light chain variable region which differs in amino acid sequence by up to 6 amino acid sequence substitutions, e.g., 1, 2, 3, 4, 5, or 6 amino acid substitutions, as compared to the sequence set forth in seq id No. 5. The antibody of interest may comprise any one or a combination of these substitutions.

Antibodies possessing any of these substitution positions and antibodies possessing all substitution positions also have the activity of binding HER 3. Amino acid substitutions may be present in both the framework and CDR regions, or may be present in the framework or CDR regions separately. Thus, in certain preferred embodiments, the amino acid sequence of the framework region of the heavy chain variable region may differ by up to 6 amino acid sequence substitutions, e.g., 1, 2, 3, 4, 5, or 6 substitutions, compared to the sequence set forth in seq id No. 4, and the amino acid sequence of the framework region of the light chain variable region may differ by up to 6 amino acid sequence substitutions, e.g., 1, 2, 3, 4, 5, and 6 substitutions, compared to the sequence set forth in seq id No. 5.

In some antibodies, amino acid substitutions may be distributed over multiple CDR regions. Thus, the amino acid sequences of the multiple CDR regions of the heavy chain variable region may differ by up to 6 amino acid sequence substitutions, e.g., 1, 2, 3, 4, 5, or 6 substitutions, as compared to the sequence set forth in seq id No. 4, and the amino acid sequences of the multiple CDR regions of the light chain variable region may differ by up to 6 amino acid sequence substitutions, e.g., 1, 2, 3, 4, 5, and 6 substitutions, as compared to the sequence set forth in seq id No. 5.

In another embodiment, the antibody may comprise a) a heavy chain variable region having an amino acid sequence at least 95% identical to the sequence set forth in SEQ ID No. 4 and b) a light chain variable region having an amino acid sequence at least 95% identical to the sequence set forth in SEQ ID No. 5. Thus, an antibody of interest may comprise a) a heavy chain variable region having an amino acid sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence set forth in seq id No. 4 and b) a light chain variable region having an amino acid sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence set forth in seq id No. 5.

In another embodiment, the antibody may comprise a) a heavy chain variable region having an amino acid sequence identical to that shown in SEQ ID No. 4 and b) a light chain variable region having an amino acid sequence identical to that shown in SEQ ID No. 5.

In another embodiment, the antibody further comprises an Fc region of an immunoglobulin, preferably the immunoglobulin is human IgG.

In another embodiment, an antibody may comprise a) a heavy chain having an amino acid sequence at least 95% identical to the sequence set forth in SEQ ID No. 15 and b) a light chain having an amino acid sequence at least 95% identical to the sequence set forth in SEQ ID No. 16. Thus, an antibody of interest may comprise a) a heavy chain variable region having an amino acid sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence set forth in seq id No. 4 and b) a light chain variable region having an amino acid sequence that is at least about 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence set forth in seq id No. 5.

In addition to the amino acid substitutions described above, the antibody of interest may have additional amino acids at either end of the heavy or light chain. For example, the antibody of interest may comprise at least 1, 2, 3, 4, 5, or 6 or more additional amino acids at the C-or N-terminus of the heavy and/or light chain, respectively. In certain embodiments, the antibody of interest may be shorter than the exemplary amino acids described herein, with the primary difference being 1, 2, 3, 4, 5, or 6 amino acids less than the exemplary amino acids at either end of the heavy and light chains, respectively.

In another embodiment, the antibody may comprise a) a heavy chain having an amino acid sequence identical to that set forth in SEQ ID NO. 15 and b) a light chain having an amino acid sequence identical to that set forth in SEQ ID NO. 16.

The invention also relates to a reagent, a kit, a chip or a pharmaceutical composition, which comprises the monoclonal antibody.

The invention also provides application of the antibody in preparing a medicament for treating HER3 related diseases. The HER3 related diseases comprise EGFR antibody treatment failure type lung cancer, HER2 positive type antibody drug-resistant breast cancer, cervical cancer and the like. The target antibody can also be used for scientific research related to HER3, or medical or pharmaceutical application research such as tumor.

Once the antibody molecule of the invention is prepared, it can be purified by any method known in the art for purifying immunoglobulin molecules, for example, by chromatography (e.g., ion exchange chromatography, affinity chromatography, particularly by affinity chromatography of protein a for a specific antigen and other column chromatography), centrifugation, use of solubility differences, or by any other standard technique for purifying proteins. In many embodiments, the antibody is secreted from the cell into the culture medium, and the antibody is obtained by collecting the culture medium and purifying it.

Drawings

FIG. 1 is a schematic representation of the purification and counterstaining identification of the HER3scFv antibodies of the invention.

Figure 2 is a graphical representation of the results of an ELISA assay to detect HER3scFv of the present invention binding to HER 3;

FIG. 3 is a graph showing the results of a CCK8 experiment for detecting the proliferation inhibition of HER3scFv of the present invention on MDA-MB-453 cells. Wherein FIG. 3A is cells not stimulated by NRG1, FIG. 3B is cells detected 24h after stimulation with 100ng/ml NRG1, arrow 1 in FIGS. 3A and B indicates rhodamine-stained HER3 (red), arrow 2 indicates DAPI-stained nuclei (blue), and arrow 3 indicates rhodamine and DAPI superimposed staining (red plus blue). FIG. 3C is a graph showing the results of a CCK8 experiment for detecting the proliferation inhibition of HER3scFv of the present invention on MDA-MB-453 cells. Wherein the ordinate is relative expression fold and the abscissa represents different groups. Group 1: cells without any treatment; group 2: cells stimulated with 100ng/ml NRG 1; group 3: cells to which only 40 μ g/ml HER3scFv antibody was added; group 4: cells with NRG1 at 200ng/ml were added 1h after 40. mu.g/ml antibody. Results are shown as mean ± standard deviation (n ═ 3) ·,. sp <0.001(1 v.s.2); p <0.01(2 v.s.4); p <0.05(3 v.s.4).

Definition of

The citation of the literature references, patents, patent applications and scientific literature, which constitute prior knowledge to those skilled in the art, are hereby incorporated by reference in their entirety to the same extent as if each of those references were specifically and individually indicated to be incorporated by reference. In case of any conflict between the incorporated literature and the specific meaning of the present specification, the latter shall control. Furthermore, to the extent that any conflict between an existing understanding of a definition of a term or phrase and the definition set forth in the specification is resolved, it is to be understood that the conflict is to be resolved.

Before the present invention is further described, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited by the appended claims.

The abbreviations for amino acid residues are standard 3-letter or 1-letter codes used in the art to refer to one of the 20 commonly used L-amino acids.

The terms "monoclonal antibodies (MAbs)" and "monoclonal antibodies" are used interchangeably herein to refer to the homogeneous population of antibodies to a particular antigen and which antibodies contain only one type of antigen binding site and bind only one epitope on an antigenic determinant. Monoclonal antibodies to a particular antigen can be obtained by methods well known to those skilled in the art. For example, monoclonal antibodies can be prepared by recombinant DNA methods.

The terms "antibody" and "immunoglobulin" are used interchangeably herein. These terms are well known to those skilled in the art and specifically refer to proteins that are composed of one or more polypeptides that specifically bind to an antigen. One form of antibody constitutes the basic building block of an antibody. This form is a tetramer, which is composed of two identical pairs of antibody chains, each pair having a light chain and a heavy chain. In each pair of antibody chains, the variable regions of the light and heavy chains are joined together and are responsible for binding to antigen, while the constant regions are responsible for the effector functions of the antibody.

Currently known immunoglobulin polypeptides include kappa and lambda light chains, as well as alpha, gamma (IgG1, IgG2, IgG3, IgG4), and mu heavy chains or other type equivalents thereof. Full-length immunoglobulin "light chains" (about 25kDa or about 214 amino acids) contain a variable region of about 110 amino acids at the NH 2-terminus, and kappa and lambda constant regions at the COOH-terminus. The full-length immunoglobulin "heavy chain" (about 50kDa or about 446 amino acids) consents to contain one variable region (about 116 amino acids), and one of the heavy chain constant regions, e.g., gamma (about 330 amino acids).

The terms "antibody" and "immunoglobulin" include any isotype antibodies or immunoglobulins, or antibody fragments that retain specific binding to an antigen, including but not limited to Fab, Fv, scFv, and Fd fragments, chimeric antibodies, humanized antibodies, single chain antibodies, and fusion proteins comprising an antigen-binding portion of an antibody and a non-antibody protein. The antibody may be labeled and detected, for example, by a radioisotope, an enzyme capable of producing a detectable substance, a fluorescent protein, biotin, or the like. The antibodies can also be bound to a solid support, including but not limited to polystyrene plates or beads, and the like. The term also includes Fab ', Fv, F (ab') 2 and/or other antibody fragments and monoclonal antibodies that specifically bind to an antigen.

Antibodies can also exist in a variety of forms including, for example, Fab, Fv, F (ab') 2, as well as bifunctional hybrid antibodies (e.g., Lanzavecchia et al, Eur.J.Immunol., 1987; 17, 105) and in single chain form (e.g., Huston et al, Proc.nat.l.Acad.Sci.U.S.A., 1988; 85, 5879 and Bird et al, Science, 1988; 242, 423, incorporated herein by reference). The variable region of the heavy or light chain of an immunoglobulin consists of three hypervariable regions (also known as "complementarity determining regions" or CDRs) which are separated by Framework Regions (FRs). The extent of the framework and complementarity determining regions has been precisely defined (see "sequences of proteins of Immunological Interest," E.Kabat et al, U.S. department of Health and Human Services, 1991). All antibody amino acid sequences discussed herein are ordered with reference to the Kabat system. The sequences of the light and heavy chain framework regions that differ from one species are relatively conserved. The framework regions of the antibody were used to locate and calibrate the CDRs. The CDRs are primarily responsible for binding epitopes of the antigen.

At a certain pointIn some embodiments, the affinity between an antibody and its target is characterized by a KD (dissociation constant) of less than 10^-6M、10^-7M、10^-8M、10^-9M、10^-10M、10^-11M, or about 10^-12M or less.

The "variable region" of an antibody heavy or light chain is the N-terminal mature region of the chain. All region, CDR and residue numbering are defined on the basis of sequence alignment, according to the existing structure. The identification and numbering of framework regions and CDR residues is described by Chothia and others (Chothia, Structural determinants in the sequences of immunoglobulin variable domain. J Mol biol. 1988; 278, 457).

"VH" is the variable region of an antibody heavy chain. "VL" is the variable region of an antibody light chain, which may have kappa and lambda isotypes. The K-1 antibody has a kappa-1 isotype and the K-2 antibody has a kappa-2 isotype, and "V.lambda" is a variable lambda light chain.

The terms "polypeptide" and "protein" are used interchangeably herein and both refer to polymeric forms of amino acids of any length, and may include coded and non-coded amino acids, amino acids modified or derivatized by chemical or biochemical modification, and polypeptides having modified peptide backbones. The term includes fusion proteins, including but not limited to fusion proteins having heterologous amino acid sequences; fusion proteins with heterologous or homologous leader sequences, with or without the N-terminal methionine amino acid residue; proteins with an immunological tag; fusion proteins with a detectable fusion partner include, for example, fluorescent proteins, β -galactosidase, fluorescein, and the like as fusion partners, and the like. The polypeptide may be of any size, and the term "peptide" refers to polypeptides of 8-50 residues (e.g., 8-20 residues) in length.

"corresponding amino acid" refers to two or more amino acid sequences when aligned, located in the same position (i.e. they correspond to each other) of the amino acid residues. Methods for antibody sequence alignment and numbering are described in detail in Chothia, supra, Kabat, supra, and elsewhere. It is known to those of ordinary skill in the art (see, e.g., kabat 1991Sequences of Proteins of Immunological Interest, DHHS, Washington, DC) that one, two or three gaps may sometimes be made in one or two amino acids of an antibody and/or 1, 2, 3 or 4 residues may be inserted or up to about 15 residues may be inserted (particularly in the L3 and H3 CDRs) to complete an alignment.

"substitutable position" refers to a particular position of an antibody that can be substituted with a different amino acid without significantly reducing the binding activity of the antibody. Methods for identifying substitutable positions and how they may be substituted are described in more detail below. The substitutable position may also be referred to as a "mutation-tolerant position".

A "parent" antibody refers to the target antibody as an amino acid substitution. In certain embodiments, a "donor" antibody will "donate" amino acids to a parent antibody to produce an altered antibody.

"related antibodies" refers to antibodies having similar sequences and produced by cells having a common B cell ancestor. This B cell progenitor contains a genome with rearranged link VJC region and rearranged heavy chain VDJC region and produces antibodies that have not undergone affinity maturation. The "naive" or "primary" B cells present in spleen tissue are a common ancestor of B cells. Related antibodies bind to the same epitope generally very similar in sequence, particularly their L3 and H3 CDRs. Both the H3 and L3 CDRs of related antibodies have the same length and nearly identical sequences (differing by 0-4 amino acid residues). The related antibodies are related by antibodies produced by a common antibody progenitor, the naive B cell progenitor.

The term "anti-HER 3 monoclonal antibody" is an antibody that binds with sufficient affinity and specificity to HER 3.

The term "effective amount" refers to an amount of a drug effective to treat a disease or disorder in a mammal.

The term "pharmaceutically acceptable carrier" refers to one or more organic or inorganic components which may be natural or synthetic and which, in combination with the antibody, facilitates its use. Acceptable carriers include sterile physiological saline or other pharmaceutically acceptable, aqueous or non-aqueous isotonic solutions or sterile suspensions, as are well known in the art.

Examples

The invention discloses an anti-HER 3 antibody, a composition containing the antibody and application of the antibody in preparing a medicament for treating HER3 related diseases. Those skilled in the art can modify the process parameters appropriately to achieve the desired results with reference to the disclosure herein. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the invention has been described in terms of preferred embodiments, it will be apparent to those skilled in the art that the techniques of the invention can be implemented and practiced with modification, or with appropriate modification, and combinations of the methods and applications described herein without departing from the spirit, scope, and spirit of the invention.

In order to make those skilled in the art better understand the technical solution of the present invention, the following detailed description of the present invention is provided with reference to specific embodiments.

Example 1 Gene Screen for HER3scFv antibodies

1.1 construction of antibody libraries

The scFv antibody targeting HER3 is obtained by constructing and screening a mammalian cell display type antibody library.

First, 100 healthy persons and 40 lung cancer patients were collected and lymphocytes were extracted from peripheral blood, and total RNAs were extracted and reverse-transcribed into cDNAs (Thermo Co.). According to the document [ Daniel Sbarlato, Andrew Bradbury.A definitive set of oligonucleotide primers for amplifying human V regions [ J ]. Immunotechnology.1998: 3: 271-278 was designed and synthesized by Beijing Bomai Germany technology development Co., Ltd, and 8-12 cases of cDNAs were used as a set of cDNAs for each cancer species, and 12 sets were used as templates, and the antibody variable region VH and VL genes were cloned by PCR. scFv is obtained by overlapping PCR and inserted into eukaryotic cell expression plasmid pDisplay to obtain mammalian cell display type fully human scFv antibody plasmid library pDisplay-scFv. VH and VL are about 350bp, scFv is about 700 bp.

Transient transfection of the antibody plasmid library pDisplay-scFv into 293T cells with PEI reagent (Invitrogen), 60h later digestion of the cells into individual cells with trypsin-free digest, PB digestion with PBAnd after washing for three times, adding SDS (sodium dodecyl sulfate) loading buffer solution into part of cells, boiling for 10min, centrifuging, taking supernate, carrying out SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), transferring the supernate onto a nitrocellulose membrane after electrophoresis, sealing the nitrocellulose membrane for 1h at room temperature by using 5% skimmed milk powder, respectively incubating overnight at 4 ℃ by using myc antibody and HE antibody diluted by using 5% skimmed milk powder, washing the membrane for 3 times and 7min each time by using TBST (tert-butyl-transferase), respectively adding goat anti-rabbit IgG (immunoglobulin G) coupled with horseradish peroxidase diluted by using 5% skimmed milk powder, slightly shaking for 1h at room temperature, washing the membrane for 3 times and 7min each time by using a chemiluminescence method, developing for. Another part of the cells were resuspended and the number of cells was adjusted to 2X 10⁶And taking 500 mu l of cell suspension to a 1.5ml EP tube, fully diluting 1 mu g of FITC-labeled anti-myc antibody in 500 mu l of PBS, adding the diluted antibody into the cell, gently mixing the diluted antibody uniformly, incubating the mixture for 1h at room temperature in a dark place, washing the mixture for 3 times by PBS, resuspending the mixture by 500 mu l of PBS, and performing the analysis on the transient transfection expression efficiency of the plasmid in the antibody library on a computer to show that about 20 percent of the cells express the foreign protein.

1.2 Gene Screen for HER 3-Targeted antibody

Plasmid pDisplay-scFv was transiently transfected into 293T cells for 60h, and the cells were digested into single cells with trypsin-free digest (Invitrogen), washed 3 times with PBS, and incubated with 10nM of the FITC-labeled HER3 extracellular domain protein for 1h at room temperature. After washing for 3 times with PBS, screening the cells by using a flow cytometer, and collecting 0.2% -0.4% of the cells with strongest fluorescence. Plasmids were extracted from the cells obtained from the first round of screening and transformed into E.coli DH5 a, followed by a second round of screening by transient transfer into 293T cells, while the antibody concentration would be 2 nM. The plasmids obtained in the second round were used for the third round of sorting at an antigen concentration of 0.2 nM. After three rounds of sorting, the scFv sequence with a certain binding ability to HER3 was obtained by aligning the scFv sequences in the recovered plasmids, and was designated as HER3scFv antibody sequence. As a result of sequencing, the full-length nucleotide sequence is shown as SEQ ID NO. 13, and the coded amino acid sequence is shown as SEQ ID NO. 14. Wherein the nucleotide sequence of the heavy chain variable region is shown as SEQ ID NO:1, and the coded amino acid sequence is shown as SEQ ID NO:4 is shown in the specification; the nucleotide sequence of the light chain variable region is shown as SEQ ID NO:2, and the coded amino acid sequence is shown as SEQ ID NO:5, respectively. Through comparison with an Igblast database, the obtained amino acid sequence is analyzed, and further comparison with a CDR region is carried out to deduce: the amino acid sequence of the heavy chain variable region CDR1 is GFTFSSYG (SEQ ID NO: 7), the amino acid sequence of the heavy chain variable region CDR2 is IWHDGTND (SEQ ID NO: 8), and the amino acid sequence of the heavy chain variable region CDR3 is TRAYGGNSWMDV (SEQ ID NO: 9); the amino acid sequence of CDR1 in the light chain variable region is PGDSAF (SEQ ID NO: 10), the amino acid sequence of CDR2 in the light chain is GAS (SEQ ID NO: 11), and the amino acid sequence of CDR3 in the light chain is QQTLT (SEQ ID NO: 12).

Example 2 preparation of HER3scFv antibody and identification of counterstain

Designing an upstream primer F through the nucleotide sequence of HER3scFv shown in the sequence 13: "GTACGCTCTTCATGTGAGGTGCAGCTGTTG"; and a downstream primer R: "GATCGCTCTTCTAGCTTTGATCTCCACCTT". HER3scFv gene was amplified using pDisplay-HER3scFv as template. After the PCR product is recovered, the product is connected by BspQ I enzyme digestion (NEB) and T4ligase (Takala) to obtain a secretory eukaryotic expression plasmid HXT-Chis-HER3 scFv. Transiently transfecting the HXT-Chis-HER3scFv plasmid into 293E cells by using a PEI transfection reagent for expression, supplementing CB5 on days 3 and 5, collecting cell supernatant on day 6, and purifying by using nickel affinity column chromatography. The eluate was replaced with PBS using a 3kDa ultrafiltration tube. Adding 20 μ l eluate into SDS sample buffer, boiling for 10min, centrifuging, collecting supernatant, performing SDS-PAGE, transferring into Coomassie brilliant blue staining solution, and rinsing for 30min for three times. As a result, as shown in FIG. 1, the band of about 25kDa in size in FIG. 1 is a HER3scFv antibody protein.

Example 3 ForteBio detection of affinity of HER3scFv antibodies

The affinity constant KD of the HER3scFv antibodies prepared in the invention to HER3 was determined using Fortebio. The HER3 extracellular domain protein antigen was biotinylated and immobilized on a streptavidin probe, the probe was equilibrated with PBS, followed by binding to HER3scFv, and the probe was then incubated in PBS for dissociation with KD/Ka, which is shown in table 1 for HER3scFv with affinity KD and HER3scFv with affinity constant KD of 1.039E-08.

TABLE 1 affinity assay results for HER3scFv

	Kd(1/s)	Ka(1/Ms)	KD(M)
				HER3scFv	8.103E-05	7.795E03	1.039E-08

Table 1 the results show that: the prepared HER3scFv has strong binding capacity with HER3 extracellular region protein.

Example 4 ELISA assay for detection of HER3scFv binding to HER3

Coating the ELISA plate with HER3 extracellular region protein (6nM), and standing overnight at 4 ℃; blocking with 1% BSA at 37 ℃ for 2 h; adding HER3scFv antibody with different dilution times, and incubating for 1h at 37 ℃; PBST was washed 6 times, Anti-His-HRP antibody (1:10000) was added, and incubation was carried out at 37 ℃ for 1 h; PBST was washed 6 times and developed by addition of TMB substrate. A commercial anti-HER 3(N-term) Antibody (ABGENT) was used as a positive control, and PBS was used instead of the HER3scFv antibody as a negative control. The results are shown in FIG. 2. From fig. 2, it can be seen that the HER3scFv prepared by the present invention can bind to HER3 extracellular domain protein with an affinity superior to that of the existing full-length HER3 antibody.

Example 5 CCK8 assay for HER3scFv antibody proliferation inhibition assay for MDA-MB-453

The activity of the HER3scFv antibody was determined using a human breast cancer cell line MDA-MB-453 positive for HER3 expression. MDA-MB-453 cells in logarithmic growth phase were digested to single cell suspension at 3X 10⁵Inoculating into 35mm laser confocal small dish, and culturing overnightThen removing the supernatant, adding 2ml complete medium containing 100ng/ml NRG1, culturing for 24h, removing the supernatant, washing with PBS 1 time, fixing with 4%/PBS paraformaldehyde for 10min, washing with PBS 3 times, blocking with 2% BSA/PBS for 30min, adding 1% BSA/PBS diluted anti-HER 3(N-term) antibody (ABGENT Co.) (dilution 1:50), hybridizing at 37 ℃ for 2 h; rinsing with PBS for 5min for 2 times; adding rhodamine-labeled anti-rabbit IgG (H + L) polyclonal antibody (KPL company) diluted by 1% BSA/PBS (dilution 1:50), and hybridizing at 37 ℃ for 2H; rinsing with PBS for 5min for 2 times; staining with 5ug/ml DAPI (Biyuntian Biotech research institute) for 2 min; after blocking, the anti-quenching blocking agent was imaged and photographed under a confocal laser microscope (see FIG. 3A). FIG. 3A shows cells not stimulated with NRG1 and FIG. 3B shows cells tested 24h after stimulation with 100ng/ml NRG 1. In fig. 3A and B, red is rhodamine-stained HER3, and blue is DAPI-stained cell nucleus, so that it can be seen that endogenous HER3 is mainly expressed in cell nucleus of cells not stimulated by NRG1, while HER3 is highly expressed on cell membrane of cells stimulated by NRG1 for 24 hours. The HER3scFv antibody can play an antibody function only by binding with HER3 antigen on the surface of a cell membrane, so that an NRG1 stimulation group is set in a subsequent HER3scFv proliferation inhibition test on cells.

Digesting MDA-MB-453 cells in logarithmic growth phase into single cells, seeding the cells into a 96-well plate at 4000/well, removing cell supernatant after 24h, adding 50 ul complete culture medium to groups 1 and 2, respectively, and adding 50 ul complete culture medium containing 40 ug/ml HER3scFv antibody to groups 3 and 4, respectively; after 1h, 50. mu.l of complete medium was added to groups 1 and 3, respectively, and 50. mu.l of complete medium containing 200ng/ml of NRG1 was added to groups 2 and 4, respectively; each set was plated with 3 duplicate wells, 10. mu.l of CCK8 (Beijing Tiannzze GeneTech Co., Ltd.) was added at 24 hours, and the absorbance at 450nm was measured by a microplate reader after incubation at 37 ℃ for 1 hour, as shown in 3C (results are shown as mean. + -. standard deviation (n. about.3),. about.P <0.001(1v.s.2),. about.P <0.01(2 v.s.4);. about.P <0.05(3 v.s.4)). The results showed that the NRG1 stimulated group showed very significant differences in the results from the unstimulated group (×) indicating that the cells proliferated significantly after stimulation with 100ng/ml NRG 1. While the NRG 1-stimulated group showed a very significant difference compared to the results of the HER3 scFv-inhibited group stimulated with NRG 1(═ 0.005), while the HER3 scFv-antibody-inhibited group not stimulated with NRG1 showed a significant difference compared to the results of the HER3 scFv-inhibited group stimulated with NRG 1(═ 0.011), indicating that HER3scFv significantly inhibited MDA-MB-453 cell proliferation under the premise of NRG1 stimulation.

Sequence listing

<110> institute of radiology and radiology medical science institute of military medical science institute of people's liberation force of China

<120> fully human anti-HER 3 antibody, composition containing antibody and application of antibody in preparation of medicine for treating HER3 related diseases

<130>

<160> 16

<170> PatentIn version 3.4

<210> 1

<211> 357

<212> DNA

<213> human sequence

<220>

<221> nucleotide sequence

<222> (1)..(357)

<220>

<221> nucleotide sequence of heavy chain variable region

<222> (1)..(357)

<400> 1

gaggtgcagc tgttggagac tgggggaggc ctggtcaagc cgggggggtc cctgagactc 60

tcctgtgcag cgtctggatt caccttcagt tcctatggca tgcattgggt ccgccaggct 120

ccaggcaagg ggctggaatg ggtggcattt atctggcatg atggaactaa tgatgaatat 180

atagactccg tgaagggccg attcaccatc tccagagaca attccaagag cacgctgtat 240

ctgcaactga acagtctgag agccgaggac acggctgtgt attactgtac aagagcctac 300

gggggtaact cgtggatgga cgtctggggc caagggacca cggtcaccgt ctcctca 357

<210> 2

<211> 309

<212> DNA

<213> human sequence

<220>

<221> variable light chain region nucleotide sequence

<222> (1)..(309)

<400> 2

gatattgtga tgacccagac tccatccttc ctgtctgcat ctgtaggaga cagagtcaca 60

atcacttgcc gggccagtcc gggcgatagt gcttttttag cctggtatca gcaaaaacca 120

ggaaaagccc ctaaactcct gatctatggt gcatccactt tacaaagtgg ggtcccatca 180

aggttcagcg gcagtggatc tgggacagaa ttcactctca cagtcagcag cctgcagcct 240

gaggattttg caacttatta ctgtcaacag accctcactt tcggcggagg gaccaaggtg 300

gagatcaaa 309

<210> 3

<211> 45

<212> DNA

<213> Artificial sequence

<220>

<221> Joint

<222> (1)..(45)

<400> 3

ggtggtggtg gatcaggtgg aggaggttct ggaggtggtg gatcc 45

<210> 4

<211> 119

<212> PRT

<213> human sequence

<220>

<221> heavy chain variable region amino acid sequence

<222> (1)..(119)

<400> 4

Glu Val Gln Leu Leu Glu Thr Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Phe Ile Trp His Asp Gly Thr Asn Asp Glu Tyr Ile Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Ser Thr Leu Tyr

65 70 75 80

Leu Gln Leu Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Ala Tyr Gly Gly Asn Ser Trp Met Asp Val Trp Gly Gln Gly

100 105 110

Thr Thr Val Thr Val Ser Ser

115

<210> 5

<211> 103

<212> PRT

<213> human sequence

<220>

<221> light chain variable region amino acid sequence

<222> (1)..(103)

<400> 5

Asp Ile Val Met Thr Gln Thr Pro Ser Phe Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Pro Gly Asp Ser Ala Phe

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Val Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Leu Thr Phe Gly Gly

85 90 95

Gly Thr Lys Val Glu Ile Lys

100

<210> 6

<211> 15

<212> PRT

<213> human sequence

<220>

<221> Joint

<222> (1)..(15)

<400> 6

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

1 5 10 15

<210> 7

<211> 8

<212> PRT

<213> human sequence

<220>

<221> heavy chain variable region CDR1

<222> (1)..(8)

<400> 7

Gly Phe Thr Phe Ser Ser Tyr Gly

1 5

<210> 8

<211> 8

<212> PRT

<213> human sequence

<220>

<221> heavy chain variable region CDR2

<222> (1)..(8)

<400> 8

Ile Trp His Asp Gly Thr Asn Asp

1 5

<210> 9

<211> 12

<212> PRT

<213> human sequence

<220>

<221> heavy chain variable region CDR3

<222> (1)..(12)

<400> 9

Thr Arg Ala Tyr Gly Gly Asn Ser Trp Met Asp Val

1 5 10

<210> 10

<211> 6

<212> PRT

<213> human sequence

<220>

<221> light chain variable region CDR1

<222> (1)..(6)

<400> 10

Pro Gly Asp Ser Ala Phe

1 5

<210> 11

<211> 3

<212> PRT

<213> human sequence

<220>

<221> light chain variable region CDR2

<222> (1)..(3)

<400> 11

Gly Ala Ser

1

<210> 12

<211> 5

<212> PRT

<213> human sequence

<220>

<221> human sequence

<222> (1)..(5)

<220>

<221> light chain variable region CDR3

<222> (1)..(5)

<400> 12

Gln Gln Thr Leu Thr

1 5

<210> 13

<211> 711

<212> DNA

<213> human sequence

<220>

<221> nucleotide sequence encoding scFv of the Single chain antibody HER3

<222> (1)..(711)

<400> 13

gaggtgcagc tgttggagac tgggggaggc ctggtcaagc cgggggggtc cctgagactc 60

tcctgtgcag cgtctggatt caccttcagt tcctatggca tgcattgggt ccgccaggct 120

ccaggcaagg ggctggaatg ggtggcattt atctggcatg atggaactaa tgatgaatat 180

atagactccg tgaagggccg attcaccatc tccagagaca attccaagag cacgctgtat 240

ctgcaactga acagtctgag agccgaggac acggctgtgt attactgtac aagagcctac 300

gggggtaact cgtggatgga cgtctggggc caagggacca cggtcaccgt ctcctcaggt 360

ggtggtggat caggtggagg aggttctgga ggtggtggat ccgatattgt gatgacccag 420

actccatcct tcctgtctgc atctgtagga gacagagtca caatcacttg ccgggccagt 480

ccgggcgata gtgctttttt agcctggtat cagcaaaaac caggaaaagc ccctaaactc 540

ctgatctatg gtgcatccac tttacaaagt ggggtcccat caaggttcag cggcagtgga 600

tctgggacag aattcactct cacagtcagc agcctgcagc ctgaggattt tgcaacttat 660

tactgtcaac agaccctcac tttcggcgga gggaccaagg tggagatcaa a 711

<210> 14

<211> 237

<212> PRT

<213> human sequence

<220>

<221> Single chain antibody HER3scFv amino acid sequence

<222> (1)..(237)

<400> 14

Glu Val Gln Leu Leu Glu Thr Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Phe Ile Trp His Asp Gly Thr Asn Asp Glu Tyr Ile Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Ser Thr Leu Tyr

65 70 75 80

Leu Gln Leu Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Ala Tyr Gly Gly Asn Ser Trp Met Asp Val Trp Gly Gln Gly

100 105 110

Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

115 120 125

Ser Gly Gly Gly Gly Ser Asp Ile Val Met Thr Gln Thr Pro Ser Phe

130 135 140

Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser

145 150 155 160

Pro Gly Asp Ser Ala Phe Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys

165 170 175

Ala Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Leu Gln Ser Gly Val

180 185 190

Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr

195 200 205

Val Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln

210 215 220

Thr Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

225 230 235

<210> 15

<211> 449

<212> PRT

<213> human sequence

<220>

<221> heavy chain amino acid sequence

<222> (1)..(449)

<400> 15

Glu Val Gln Leu Leu Glu Thr Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Phe Ile Trp His Asp Gly Thr Asn Asp Glu Tyr Ile Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Ser Thr Leu Tyr

65 70 75 80

Leu Gln Leu Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Thr Arg Ala Tyr Gly Gly Asn Ser Trp Met Asp Val Trp Gly Gln Gly

100 105 110

Thr Thr Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe

115 120 125

Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu

130 135 140

Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp

145 150 155 160

Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu

165 170 175

Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser

180 185 190

Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro

195 200 205

Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys

210 215 220

Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro

225 230 235 240

Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser

245 250 255

Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp

260 265 270

Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn

275 280 285

Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val

290 295 300

Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu

305 310 315 320

Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys

325 330 335

Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr

340 345 350

Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser Leu Thr

355 360 365

Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu

370 375 380

Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu

385 390 395 400

Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys

405 410 415

Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu

420 425 430

Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly

435 440 445

Lys

<210> 16

<211> 208

<212> PRT

<213> human sequence

<220>

<221> light chain amino acid sequence

<222> (1)..(208)

<400> 16

Asp Ile Val Met Thr Gln Thr Pro Ser Phe Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Pro Gly Asp Ser Ala Phe

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Gly Ala Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Val Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Thr Leu Thr Phe Gly Gly

85 90 95

Gly Thr Lys Val Glu Ile Lys Thr Val Ala Ala Pro Ser Val Phe Ile

100 105 110

Phe Pro Pro Ser Asp Glu Gln Leu Lys Ser Gly Thr Ala Ser Val Val

115 120 125

Cys Leu Leu Asn Asn Phe Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys

130 135 140

Val Asp Asn Ala Leu Gln Ser Gly Asn Ser Gln Glu Ser Val Thr Glu

145 150 155 160

Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu

165 170 175

Ser Lys Ala Asp Tyr Glu Lys His Lys Val Tyr Ala Cys Glu Val Thr

180 185 190

His Gln Gly Leu Ser Ser Pro Val Thr Lys Ser Phe Asn Arg Gly Glu

195 200 205

Claims (8)

1. An anti-HER 3 monoclonal antibody, wherein the amino acid sequences of CDR1, CDR2 and CDR3 in the heavy chain variable region are SEQ ID NO. 7, SEQ ID NO. 8 and SEQ ID NO. 9; and the amino acid sequences of CDR1, CDR2 and CDR3 in the light chain variable region are SEQ ID NO 10, SEQ ID NO 11 and SEQ ID NO 12.

2. The anti-HER 3 monoclonal antibody of claim 1, wherein the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO. 4, and the monoclonal antibody has the activity of specifically binding to HER 3.

3. The anti-HER 3 monoclonal antibody of claim 1, wherein the amino acid sequence of the light chain variable region is as shown in SEQ ID NO. 5, and the monoclonal antibody has the activity of specifically binding to HER 3.

4. The anti-HER 3 monoclonal antibody of claim 1, further comprising a human immunoglobulin Fc region, wherein the immunoglobulin is IgG.

5. The anti-HER 3 monoclonal antibody of claim 1, having a heavy chain amino acid sequence as set forth in SEQ ID NO. 15 and having the activity of specifically binding to HER 3.

6. The anti-HER 3 monoclonal antibody of claim 1, wherein the light chain amino acid sequence is set forth in SEQ ID NO 16, and the monoclonal antibody has the activity of specifically binding to HER 3.

7. Use of the anti-HER 3 monoclonal antibody of any one of claims 1 to 6 in the manufacture of a medicament for the treatment of a HER 3-related disease, wherein the HER 3-related disease is ErbB2 positive breast cancer.

8. A pharmaceutical composition comprising an effective amount of the anti-HER 3 monoclonal antibody of any one of claims 1-6 and a pharmaceutically acceptable carrier.

Images