CN1048523C - Enterically transmitted non-A/non-B hepatitis viral agent - Google Patents

Enterically transmitted non-A/non-B hepatitis viral agent Download PDF

Info

Publication number
CN1048523C
CN1048523C CN 89104064 CN89104064A CN1048523C CN 1048523 C CN1048523 C CN 1048523C CN 89104064 CN89104064 CN 89104064 CN 89104064 A CN89104064 A CN 89104064A CN 1048523 C CN1048523 C CN 1048523C
Authority
CN
China
Prior art keywords
nanb
antibody
infection
protein
order
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
CN 89104064
Other languages
Chinese (zh)
Other versions
CN1044955A (en
Inventor
格雷戈里·R·雷耶斯
丹尼尔·W·布雷德利
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
American Government
Genelabs Technologies Inc
Original Assignee
American Government
Genelabs Technologies Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by American Government, Genelabs Technologies Inc filed Critical American Government
Publication of CN1044955A publication Critical patent/CN1044955A/en
Application granted granted Critical
Publication of CN1048523C publication Critical patent/CN1048523C/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Images

Landscapes

  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Saccharide Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention discloses viral protein produced by an enterically transmitted non-A/non-B hepatitis virus factors. In a particular scheme, the protein and antibodies existing in an individual infected by the hepatitis virus factor have immunoreactivity. The protein can be used for a diagnostic method for detecting the infection of the enterically transmitted factor. The present invention also discloses DNA probes produced by the sequence of the virus factor, which can be used for identifying the complete virus factor, determining the sequence of the complete virus factor and detecting the existence of the virus factor in infected samples. The DNA probes are based on a specificity amplifying method of a DNA fragment derived form viruses.

Description

Prepare the method for protein produced by hepatitis virus factor
The application is the further part for 208, No. 997 U. S. applications submitted on June 17th, 1988, and this application is by the bibliography as this paper.
The present invention relates to recombinant protein, gene and gene probe, more specifically to this albumen and probe produced by Enterically transmitted non-A/non-B hepatitis viral agent, and relate to the use of diagnostic method and the vaccine application of these albumen and probe.
It has been reported that in Asia, Africa and the Indian subcontinent, intestinal transmitted property non-a, non-b type (ET-NANB) hepatitis virus factor is the cause of disease of many popular and fragmentary property hepatitis cases.Infection is acted on to be carried out typically by the water body of fecal pollution, but the virus can also be propagated by close physical contact.End poison seems that chronic infection can't be caused.Volunteer is infected by using the excrement isolate of collection, it was verified that the aetology of ET-NANB viruses；Immuno-electron microscope (IEM), which is studied, to be shown, a diameter of 27-34nm of the virion from infected individuals excrement.Virion can be pointed out with the serum antibody response from different geographic regions infected individuals, this phenomenon, and it is by caused by a kind of virokine or classification to have in the ET-NANB hepatitis of global range most of.In the individual serum by blood born NANB virus infection, antibody response is not observed, shows that there is different specificity between two kinds of NANB types.
In addition to serology difference, the infection of both NANB types also shows respective clinical significance.ET-NANB is characterized in acute infection, generally with heating and arthralgia, and portal inflammation, is also accompanied by the cholestasia (Arankalle) in liver biopsy.Symptom is general to disappear in six weeks.In contrast, blood born NANB is chronic infection in about 50% case.Heating and arthralgia are seldom observed, inflammation is then distributed mainly in parenchyma (Khuroo, 1980).Both virokines can also be distinguished according to the infectivity for primate host.ET-NANB can infect dog monkey (Cynomolgusmonkeys), but blood born sex factor can not.Blood born sex factor raw meat raw meat more black than ET-NANB more infectivities (Bradley, 1987).
In order to differentiate and clone the viral genome related to ET-NANB hepatitis sequentially, a large amount of effort have been made in the world.One of target of effort is to differentiate virus and its protein product and determine its feature, and this needs the genome orders of virus-specific.Another object is that production recombinant viral proteins, diagnosis and vaccine that it can be used in based on antibody.Although having made these effort, so far, do not identify the virus order related to ET-NANB hepatitis successfully also, do not differentiate yet or produce any virus specified proteins.
Herein cited pertinent literature is as follows：
Arankalle, V.A., et al., The Lancet, 550 (March 12,1988)
Bradley, D.W., et al., J Gen. Virol., 69：1(1988).
Bradley, D.W. et al., Proc. Nat. Acad. Sci., USA, 84：6277(1987).
Gravelle, C.R. et al., J.Infect.Diseases, 131：167(1975).
Kane, M.A., et al., JAMA, 252：3140(1984).
Khuroo, M.S., Am.J.Med., 48：818(1980).
Khuroo, M.S., et al., Am.J.Med., 68：818(1983).
Maniatis, T., et al.Molecular Cloning：ALaboratory Manual, Cold Spring Harbor Laboratory (1982)
Seto, B., et al., Lancet, 11：941(1984).
Sreenivasan, M.A.m et al., J.Gen.Virol., 65：1005(1984).
Tabor, E., et al., J.Infect.Dis., 140：789(1979).
The invention provides the preparation method and application of new composition, composition, the composition includes virus protein and its fragment from ET-NANB virokines.Preparing the method for ET-NANB virus proteins includes separation ET-NANB genome orders, is then cloned and is expressed in host cell.Produced recombinant viral proteins can be used as diagnosticum and vaccine.Genome orders and its fragment can be used to prepare ET-NANB virus proteins, and can be used as the probe of Viral diagnosis.
Fig. 1 shows to obtain the ET-NANB fragments of clone and determines vector construction and the operating process of its order：
Fig. 2A -2B show Southern Hybridized blots, wherein, hybridize radiolabeled ET-NANB probes and the cDNA fragments of amplification, the cDNA fragments are prepared with the RNA for originating (2A) and being separated from (I) of infection and (N) fecal specimens source (2B) of non-infection from (N) bile of infection (I) and non-infection.
The invention provides the general sequence including being produced by ET-NANB virokines and its new composition of fragment, and the recombinant viral proteins produced with this genome orders and the method using these compositions.
Found by identifying, ET-NANB virokine genomes contain one and insert the homologous region of section with the 1.33kb DNA EcoRI in plasmid PTZ-KF1 (ET1.1), and the plasmid is taken in preserving number as in CCTCCM89041 BB4 plants of colibacillus.In Primary Study, two end regions and an intermediate region that this inserts section are determined.This 5 ' end regions for inserting section contains following order：1 mono- intermediate region of 42GAT GGA AGG CAC TAA TCT GGC AAG ACC TGT CCC TGT TGC AGC43 84TGT TCT ACC ACC CTG CCC CGA GCT CGA ACA GGG CCT TCT CTA85 126CCT GCC CCA GGA GCT CAC ACA CCC TGT GAT AGT GTC GTA ACA127 168TTT GAA TTA ACA GAC ATT GTG CAC TGC CGC ATG GCC GCC CCG169 210AGC CAG CGC AAG GCC GTG CTG TCC ACA CTC GTG GGC CGC TAC211GGC. has following order：691, , , , , , , , , , , , , 731CTA, GAG, TGT, GCT, ATT, ATG, GAG, GAG, TGT, GGG, ATG, CCG, CAG, TGG733, , , , , , , , , , , , , 774CTC, ATC, CGC, CTG, TAT, CAC, CTT, ATA, AGG, TCT, GCG, TGG, ATC, TTG775, , , , , , , , , , , , , 816CAG, GCC, CCG, AAG, GAG, TCT, CTG, CGA, GGG, TTT, TGG, AAG, AAA, CAC817, , , , , , , , , , , , , 858TCC, GGT, GAG, CCC, GGC, ACT, CTT, CTA, TGG, AAT, ACT, GTC, TGG, AAT859, , , , , , , , , , , , , 900ATG, GCC, GTT, ATT, ACC, CAC, TGT, TAT, GAC, TTC, CGC, GAT, TTT, CAG901, , , , , , , , , , , , , 942GTG, GCT, GCC, TTT, AAA, GGT, GAT, GAT, TCG, ATA, GTG, CTT, TGC, AGT943, , , , , , , , , , , , , 984GAG, TAT, CGT, CAG, AGT, CCA, GGA, GCT, GCT, GTC, CTG, ATC, GCC, GGC985, , , , , , , , , , , , 1026TGT, GGC, TTG, AAG, TTG, AAG, GTA, GAT, TTC, CGC, CCG, ATC, GGT, TTG1027TAT.3 ' end regions have order below：Research work follow-up 1191 1232TGA GTA GAG GAT GTT GTT TCC CGT GTT TAT GGG GTT TCC CCT1233 1274GGA CTC GTT CAT AAC CTG ATT GGC ATG CTA CAG GCT GTT GCT1275 1316GAT GGC AAG GCA CAT TTC ACT GAG TCA GTA AAA CCA GTG CTC1317 1327GAC CGG AAT TC. has been provided for the complete sequence of both direction, and these are sequentially listed in following.Due to not knowing which bar chain dao gene is located on, the order of two chains is provided below.However, the order in a direction has been named as " forward direction " order, because it has statistics similitude with known albumen.It shown below is this order and three kinds of possible translations sequentially.Wherein there is frame of translating one long to start from nucleotides 145 with isoleucine, and extend to the end of order.Two other solution frame has many termination codons.Below and elsewhere in this specification, all using nucleotides and the standardized abbreviations of amino acid.
, , , , , , forward sequence, R, I, P, P, T, D, G, R, H, Z, S, G, K, T, C, P, C, C, S, C, E, F, R, Q, L, M, E, G, T, N, L, A, R, P, V, P, V, A, A, V, N, S, A, N, Z, W, K, A, L, I, W, Q, D, L, S, L, L, Q, L, F35, , *, , , *, , , *, , , *, , , * 1, , , 11, , 21, , 31, , 41, , 51CGAATTCCGCCAACTGATGGAAGGCACTAATCTGGCAAGACCTGTCCCTGTTGC AGCTGT, S, T, T, L, P, R, A, R, T, G, P, S, L, P, A, P, G, A, H, H, L, P, P, C, P, E, L, E, Q, G, L, L, Y, L, P, Q, E, L, T, T, Y, H, P, A, P, S, S, N, R, A, F, S, T, C, P, R, S, S, P, P*, , , *, , , *, , , *, , , *, , , * 61, , 71, , 81, , 91, , 101, , 111TCTACCACCCTGCCCCGAGCTCGAACAGGGCCTTCTCTACCTGCCCCAGGAGC TCACCAC, L, Z, Z, C, R, N, I, Z, I, N, R, H, C, A, L, P, H, G, R, P, C, D, S, V, V, T, F, E, L, T, D, I, V, H, C, R, M, A, A, P, V, I, V, S, Z, H, L, N, Z, Q, T, L, C, T, A, A, W, P, P, R*, , , *, , , *, , , *, , , *, , , * 121, , 131, , 141, , 151, , 161, , 171CTGTGATAGTGTCGTAACATTTGAATTAACAGACATTGTGCACTGCCGCATGG CCGCCCC, E, P, A, Q, G, R, A, V, H, T, R, G, P, L, R, R, R, T, K, L, S, Q, R, K, A, V, L, S, T, L, V, G, R, Y, G, V, A, Q, S, S, A, S, A, R, P, C, C, P, H, S, W, A, A, T, A, S, H, K, A, L*, , , *, , , *, , , *, , , *, , , * 181, , 191, , 201, , 211, , 221, , 231GAGCCAGCGCAAGGCCGTGCTGTCCACACTCGTGGGCCGCTACGGCGTCGCAC AAAGCTC, Y, N, A, S, H, S, D, V, R, D, S, L, A, R, F, I, P, A, I, G, T, M, L, P, T, L, M, F, A, T, L, S, P, V, L, S, R, P, L, A, Q, C, F, P, L, Z, C, S, R, L, S, R, P, F, Y, P, G, H, W, P*, , , *, , , *, , , *, , , *, , , * 241, , 251, , 261, , 271, , 281, , 291TACAATGCTTCCCACTCTGATGTTCCCGACTCTCTCGCCCGTTTTATCCCGGC CATTGGC, P, V, Q, V, T, T, C, E, L, Y, E, L, V, E, A, M, V, E, K, G, P, Y, R, L, Q, L, V, N, C, T, S, Z, W, R, P, W, S, R, R, A, R, T, G, Y, N, L, Z, I, V, R, A, S, G, G, H, G, R, E, G, P*, , *, , , *, , , *, , , *, , , * 301, , 311, , 321, , 331, , 341, , 351CCCGTACAGGTTACAACTTGTGAATTGTACGAGCTAGTGGAGGCCATGGTCGA GAAGGGC, Q, D, G, S, A, V, L, E, L, D, L, C, N, R, D, V, S, R, I, T, R, M, A, P, P, S, L, S, L, I, F, A, T, V, T, C, P, G, S, P, G, W, L, R, R, P, Z, A, Z, S, L, Q, P, Z, R, V, Q, D, H, L*, , *, , , *, , , *, , , *, , , * 361, , 371, , 381, , 391, , 401, , 411CAGGATGGCTCCGCCGTCCTTGAGCTTGATCTTTGCAACCGTGACGTGTCCAG GATCACC, F, F, Q, K, D, C, N, K, F, T, T, G, E, T, I, A, H, G, K, V, S, S, R, K, I, V, T, S, S, P, Q, V, R, P, L, P, M, V, K, W, L, P, E, R, L, Z, Q, V, H, H, R, Z, D, H, C, P, W, Z, S, G*, , , *, , , *, , , *, , , *, , , *, 421, , 431, , 441, , 451, , 461, , 471TTCTTCCAGAAAGATTGTAACAAGTTCACCACAGGTGAGACCATTGCCCATGG TAAAGTG, G, Q, G, I, S, A, W, S, K, T, F, C, A, L, F, G, P, W, F, R, A, R, A, S, R, P, G, A, R, P, S, A, P, S, L, A, L, G, S, A, P, G, H, L, G, L, E, Q, D, L, L, R, P, L, W, P, L, V, P, R*, , , *, , , *, , , *, , , *, , , * 481, , 491, , 501, , 511, , 521, , 531GGCCAGGGCATCTCGGCCTGGAGCAAGACCTTCTGCGCCCTCTTTGGCCCTTG GTTCCGC, A, I, E, K, A, I, L, A, L, L, P, Q, G, V, F, Y, G, D, A, F, L, L, R, R, L, F, W, P, C, S, L, R, V, C, F, T, V, M, P, L, Y, Z, E, G, Y, S, G, P, A, P, S, G, C, V, L, R, Z, C, L, Z*, , , *, , , *, , , *, , , *, , , * 541, , 551, , 561, , 571, , 581, , 591GCTATTGAGAAGGCTATTCTGGCCCTGCTCCCTCAGGGTGTGTTTTACGGTGA TGCCTTT, D, D, T, V, F, S, A, A, V, A, A, A, K, A, S, M, V, F, E, N, M, T, P, S, S, R, R, L, W, P, Q, Q, R, H, P, W, C, L, R, M, Z, H, R, L, L, G, G, C, G, R, S, K, G, I, H, G, V, Z, E, Z*, , , *, , , *, , , *, , , *, , , * 601, , 611, , 621, , 631, , 641, , 651GATGACACCGTCTTCTCGGCGGCTGTGGCCGCAGCAAAGGCATCCATGGTGTT TGAGAAT, D, F, S, E, F, D, S, T, Q, N, N, F, S, L, G, L, E, C, A, I, T, F, L, S, L, T, P, P, R, I, T, F, L, W, V, Z, S, V, L, L, L, F, Z, V, Z, L, H, P, E, Z, L, F, S, G, S, R, V, C, Y, Y*, , , *, , , *, , , *, , , *, , , * 661, , 671, , 681, , 691, , 701, , 711GACTTTTCTGAGTTTGACTCCACCCAGAATAACTTTTCTCTGGGTCTAGAGTG TGCTATT, M, E, E, C, G, M, P, Q, W, L, I, R, L, Y, H, L, I, R, S, A, W, R, S, V, G, C, R, S, G, S, S, A, C, I, T, L, Z, G, L, R, G, G, V, W, D, A, A, V, A, H, P, P, V, S, P, Y, K, V, C, V*, , , *, , , *, , , *, , , *, , , * 721, , 731, , 741, , 751, , 761, , 771ATGGAGGAGTGTGGGATGCCGCAGTGGCTCATCCGCCTGTATCACCTTATAAG GTCTGCG, W, I, L, Q, A, P, K, E, S, L, R, G, F, W, K, K, H, S, G, E, G, S, C, R, P, R, R, S, L, C, E, G, F, G, R, N, T, P, V, S, D, L, A, G, P, E, G, V, S, A, R, V, L, E, E, T, L, R, Z, A*, , , *, , , *, , , *, , , *, , , * 781, , 791, , 801, , 811, , 821, , 831TGGATCTTGCAGGCCCCGAAGGAGTCTCTGCGAGGGTTTTGGAAGAAACACTC CGGTGAG, P, G, T, L, L, W, N, T, V, W, N, M, A, V, I, T, H, C, Y, D, P, A, L, F, Y, G, I, L, S, G, I, W, P, L, L, P, T, V, M, T, R, H, S, S, M, E, Y, C, L, E, Y, G, R, Y, Y, P, L, L, Z, L*, , , *, , , *, , , *, , , *, , , * 841, , 851, , 861, , 871, , 881, , 891CCCGGCACTCTTCTATGGAATACTGTCTGGAATATGGCCGTTATTACCCACTG TTATGAC, F, R, D, F, Q, V, A, A, F, K, G, D, D, S, I, V, L, C, S, E, S, A, I, F, R, W, L, P, L, K, V, M, I, R, Z, C, F, A, V, S, P, R, F, S, G, G, C, L, Z, R, Z, Z, F, D, S, A, L, Q, Z, V*, , , *, , , *, , , *, , , *, , , * 901, , 911, , 921, , 931, , 941, , 951TTCCGCGATTTTCAGGTGGCTGCCTTTAAAGGTGATGATTCGATAGTGCTTTG CAGTGAG, Y, R, Q, S, P, G, A, A, V, L, I, A, G, C, G, L, K, L, K, V, I, V, R, V, Q, E, L, L, S, Z, S, P, A, V, A, Z, S, Z, R, Z, S, S, E, S, R, S, C, C, P, D, R, R, L, W, L, E, V, E, G, R*, , , *, , , *, , , *, , , *, , , * 961, , 971, , 981, , 991, , 1001, , 1011TATCGTCAGAGTCCAGGAGCTGCTGTCCTGATCGCCGGCTGTGGCTTGAAGT TGAAGGTA, D, F, R, P, I, G, L, Y, A, G, V, V, V, A, P, G, L, G, A, L, I, S, A, R, S, V, C, M, Q, V, L, W, W, P, P, A, L, A, R, S, F, P, P, D, R, F, V, C, R, C, C, G, G, P, R, P, W, R, A, P*, , , *, , , *, , , *, , , *, , , * 1021, , 1031, , 1041, , 1051, , 1061, , 1071GATTTCCGCCCGATCGGTTTGTATGCAGGTGTTGTGGTGGCCCCCGGCCTTG GCGCGCTC, P, D, V, V, R, F, A, G, R, L, T, E, K, N, W, G, P, G, P, E, L, M, L, C, A, S, P, A, G, L, P, R, R, I, G, A, L, A, L, S, Z, C, C, A, L, R, R, P, A, Y, R, E, E, L, G, P, W, P, Z, A*, , , *, , , *, , , *, , , *, , , * 1081, , 1091, , 1101, , 1111, , 1121, , 1131CCTGATGTTGTGCGCTTCGCCGGCCGGCTTACCGAGAAGAATTGGGGCCCTG GCCCTGAG, R, A, E, Q, L, R, L, A, V, S, D, F, L, R, K, L, T, N, V, A, G, R, S, S, S, A, S, L, L, V, I, S, S, A, S, S, R, M, Z, L, G, G, A, A, P, P, R, C, Z, Z, F, P, P, Q, A, H, E, C, S, S*, , , *, , , *, , , *, , , *, , , * 1141, , 1151, , 1161, , 1171, , 1181, , 1191CGGGCGGAGCAGCTCCGCCTCGCTGTTAGTGATTTCCTCCGCAAGCTCACGA ATGTAGCT, Q, M, C, V, D, V, V, S, R, V, Y, G, V, S, P, G, L, V, H, N, R, C, V, W, M, L, F, P, V, F, M, G, F, P, L, D, S, F, I, T, D, V, C, G, C, C, F, P, C, L, W, G, F, P, W, T, R, S, Z, P*, , , *, , , *, , , *, , , *, , , * 1201, , 1211, , 1221, , 1231, , 1241, , 1251CAGATGTGTGTGGATGTTGTTTCCCGTGTTTATGGGGTTTCCCCTGGACTCG TTCATAAC, L, I, G, M, L, Q, A, V, A, D, G, K, A, H, F, T, E, S, V, K, Z, L, A, C, Y, R, L, L, L, M, A, R, H, I, S, L, S, Q, Z, N, D, W, H, A, T, G, C, C, Z, W, Q, G, T, F, H, Z, V, S, K, T*, , , *, , , *, , , *, , , *, , , * 1261, , 1271, , 1281, , 1291, , 1301, , 1311CTGATTGGCATGCTACAGGCTGTTGCTGATGGCAAGGCACATTTCACTGAGT CAGTAAAA, P, V, L, D, R, N, S, S, Q, C, S, T, G, I, R, S, A, R, P, E, F, E*, , , *, , , * 1321, , 1331, , 1341CCAGTGCTCGACCGGAATTCGAGC
Complementary order is referred to as " reverse sequence " here, below to provide this sequentially with forward sequence identical mode.In this reverse sequence, it can be seen that have several can translate frame, what they were all shorter than the length that is present in forward sequence translates frame.
, , , , , , reverse sequence, A, R, I, P, V, E, H, W, F, Y, Z, L, S, E, M, C, L, A, I, S, L, E, F, R, S, S, T, G, F, T, D, S, V, K, C, A, L, P, S, A, S, N, S, G, R, A, L, V, L, L, T, Q, Z, N, V, P, C, H, Q, Q*, , , *, , , *, , , *, , , *, , , * 1, , , 11, , 21, , 31, , 41, , 51GCTCGAATTCCGGTCGAGCACTGGTTTTACTGACTCAGTGAAATGTGCCTTGCC ATCAGC, N, S, L, Z, H, A, N, Q, V, M, N, E, S, R, G, N, P, I, N, T, T, A, C, S, M, P, I, R, L, Z, T, S, P, G, E, T, P, Z, T, R, Q, P, V, A, C, Q, S, G, Y, E, R, V, Q, G, K, P, H, K, H, G*, , , *, , , *, , , *, , , *, , , * 61, , 71, , 81, , 91, , 101, , 111AACAGCCTGTAGCATGCCAATCAGGTTATGAACGAGTCCAGGGGAAACCCCAT AAACACG, G, N, N, I, H, T, H, L, S, Y, I, R, E, L, A, E, E, I, T, N, E, T, T, S, T, H, I, Z, A, T, F, V, S, L, R, R, K, S, L, T, K, Q, H, P, H, T, S, E, L, H, S, Z, A, C, G, G, N, H, Z, Q*, , , *, , , *, , , *, , , *, , , * 121, , 131, , 141, , 151, , 161, , 171GGAAACAACATCCACACACATCTGAGCTACATTCGTGAGCTTGCGGAGGAAAT CACTAAC, S, E, A, E, L, L, R, P, L, R, A, R, A, P, I, L, L, G, K, P, A, R, R, S, C, S, A, R, S, G, P, G, P, Q, F, F, S, V, S, R, R, G, G, A, A, P, P, A, Q, G, Q, G, P, N, S, S, R, Z, A, G*, , , *, , , *, , , *, , , *, , , * 181, , 191, , 201, , 211, , 221, , 231AGCGAGGCGGAGCTGCTCCGCCCGCTCAGGGCCAGGGCCCCAATTCTTCTCGG TAAGCCG, A, G, E, A, H, N, I, R, E, R, A, K, A, G, G, H, H, N, T, C, P, A, K, R, T, T, S, G, S, A, P, R, P, G, A, T, T, T, P, A, R, R, S, A, Q, H, Q, G, A, R, Q, G, R, G, P, P, Q, H, L, H*, , , *, , , *, , , *, , , *, , , * 241, , 251, , 261, , 271, , 281, , 291GCCGGCGAAGCGCACAACATCAGGGAGCGCGCCAAGGCCGGGGGCCACCACAA CACCTGC, I, Q, T, D, R, A, E, I, Y, L, Q, L, Q, A, T, A, G, D, Q, D, Y, K, P, I, G, R, K, S, T, F, N, F, K, P, Q, P, A, I, R, T, T, N, R, S, G, G, N, L, P, S, T, S, S, H, S, R, R, S, G, Q*, , , *, , , *, , , *, , , *, , , * 301, , 311, , 321, , 331, , 341, , 351ATACAAACCGATCGGGCGGAAATCTACCTTCAACTTCAAGCCACAGCCGGCGA TCAGGAC, S, S, S, W, T, L, T, I, L, T, A, K, H, Y, R, I, I, T, F, K, A, A, P, G, L, Z, R, Y, S, L, Q, S, T, I, E, S, S, P, L, K, Q, L, L, D, S, D, D, T, H, C, K, A, L, S, N, H, H, L, Z, R*, , , *, , , *, , , *, , , *, , , * 361, , 371, , 381, , 391, , 401, , 411AGCAGCTCCTGGACTCTGACGATACTCACTGCAAAGCACTATCGAATCATCAC CTTTAAA, G, S, H, L, K, I, A, E, V, I, T, V, G, N, N, G, H, I, P, D, A, A, T, Z, K, S, R, K, S, Z, Q, W, V, I, T, A, I, F, Q, T, Q, P, P, E, N, R, G, S, H, N, S, G, Z, Z, R, P, Y, S, R, Q*, , , *, , , *, , , *, , , *, , , * 421, , 431, , 441, , 451, , 461, , 471GGCAGCCACCTGAAAATCGCGGAAGTCATAACAGTGGGTAATAACGGCCATAT TCCAGAC, S, I, P, Z, K, S, A, G, L, T, G, V, F, L, P, K, P, S, Q, R, V, F, H, R, R, V, P, G, S, P, E, C, F, F, Q, N, P, R, R, D, Y, S, I, E, E, C, R, A, H, R, S, V, S, S, K, T, L, A, E, T*, , , *, , , *, , , *, , , *, , , * 481, , 491, , 501, , 511, , 521, , 531AGTATTCCATAGAAGAGTGCCGGGCTCACCGGAGTGTTTCTTCCAAAACCCTC GCAGAGA, L, L, R, G, L, Q, D, P, R, R, P, Y, K, V, I, Q, A, D, E, P, S, F, G, A, C, K, I, H, A, D, L, I, R, Z, Y, R, R, M, S, H, P, S, G, P, A, R, S, T, Q, T, L, Z, G, D, T, G, G, Z, A, T*, , , *, , , *, , , *, , , *, , , * 541, , 551, , 561, , 571, , 581, , 591CTCCTTCGGGGCCTGCAAGATCCACGCAGACCTTATAAGGTGATACAGGCGGA TGAGCCA, L, R, H, P, T, L, L, H, N, S, T, L, Z, T, Q, R, K, V, I, L, C, G, I, P, H, S, S, I, I, A, H, S, R, P, R, E, K, L, F, W, A, A, S, H, T, P, P, Z, Z, H, T, L, D, P, E, K, S, Y, S, G*, , , *, , , *, , , *, , , *, , , * 601, , 611, , 621, , 631, , 641, , 651CTGCGGCATCCCACACTCCTCCATAATAGCACACTCTAGACCCAGAGAAAAGT TATTCTG, G, G, V, K, L, R, K, V, I, L, K, H, H, G, C, L, C, C, G, H, V, E, S, N, S, E, K, S, F, S, N, T, M, D, A, F, A, A, A, T, W, S, Q, T, Q, K, S, H, S, Q, T, P, W, M, P, L, L, R, P, Q*, , , *, , , *, , , *, , , *, , , * 661, , 671, , 681, , 691, , 701, , 711GGTGGAGTCAAACTCAGAAAAGTCATTCTCAAACACCATGGATGCCTTTGCTG CGGCCAC, S, R, R, E, D, G, V, I, K, G, I, T, V, K, H, T, L, R, E, Q, A, A, E, K, T, V, S, S, K, A, S, P, Z, N, T, P, Z, G, S, R, P, P, R, R, R, C, H, Q, R, H, H, R, K, T, H, P, E, G, A, G*, , , *, , , *, , , *, , , *, , , * 721, , 731, , 741, , 751, , 761, , 771AGCCGCCGAGAAGACGGTGTCATCAAAGGCATCACCGTAAAACACACCCTGAG GGAGCAG, G, Q, N, S, L, L, N, S, A, E, P, R, A, K, E, G, A, E, G, L, A, R, I, A, F, S, I, A, R, N, Q, G, P, K, R, A, Q, K, V, L, P, E, Z, P, S, Q, Z, R, G, T, K, G, Q, R, G, R, R, R, S, C*, , , *, , , *, , , *, , , *, , , * 781, , 791, , 801, , 811, , 821, , 831GGCCAGAATAGCCTTCTCAATAGCGCGGAACCAAGGGCCAAAGAGGGCGCAGA AGGTCTT, A, P, G, R, D, A, L, A, H, F, T, M, G, N, G, L, T, C, G, E, L, Q, A, E, M, P, W, P, T, L, P, W, A, M, V, S, P, V, V, N, S, R, P, R, C, P, G, P, L, Y, H, G, Q, W, S, H, L, W, Z, T*, , , *, , , *, , , *, , , *, , , * 841, , 851, , 861, , 871, , 881, , 891GCTCCAGGCCGAGATGCCCTGGCCCACTTTACCATGGGCAATGGTCTCACCTG TGGTGAA, L, V, T, I, F, L, E, E, G, D, P, G, H, V, T, V, A, K, I, K, L, L, Q, S, F, W, K, K, V, I, L, D, T, S, R, L, Q, R, S, S, C, Y, N, L, S, G, R, R, Z, S, W, T, R, H, G, C, K, D, Q, A*, , , *, , , *, , , *, , , *, , , * 901, , 911, , 921, , 931, , 941, , 951CTTGTTACAATCTTTCTGGAAGAAGGTGATCCTGGACACGTCACGGTTGCAAA GATCAAG, L, K, D, G, G, A, I, L, A, L, L, D, H, G, L, H, Z, L, V, Q, S, R, T, A, E, P, S, W, P, F, S, T, M, A, S, T, S, S, Y, N, Q, G, R, R, S, H, P, G, P, S, R, P, W, P, P, L, A, R, T, I*, , , *, , , *, , , *, , , *, , , * 961, , 971, , 981, , 991, , 1001, , 1011CTCAAGGACGGCGGAGCCATCCTGGCCCTTCTCGACCATGGCCTCCACTAGC TCGTACAA, F, T, S, C, N, L, Y, G, A, N, G, R, D, K, T, G, E, R, V, A, S, Q, V, V, T, C, T, G, P, M, A, G, I, K, R, A, R, E, S, R, H, K, L, Z, P, V, R, G, Q, W, P, G, Z, N, G, R, E, S, R, E*, , , *, , , *, , , *, , , *, , , * 1021, , 1031, , 1041, , 1051, , 1061, , 1071TTCACAAGTTGTAACCTGTACGGGGCCAATGGCCGGGATAAAACGGGCGAGA GAGTCGCG, N, I, R, V, G, S, I, V, E, L, C, A, T, P, Z, R, P, T, S, V, T, S, E, W, E, A, L, Z, S, F, V, R, R, R, S, G, P, R, V, W, H, Q, S, G, K, H, C, R, A, L, C, D, A, V, A, A, H, E, C, G*, , , *, , , *, , , *, , , *, , , * 1081, , 1091, , 1101, , 1111, , 1121, , 1131AACATCAGAGTGGGAAGCATTGTAGAGCTTTGTGCGACGCCGTAGCGGCCCA CGAGTGTG, D, S, T, A, L, R, W, L, G, A, A, M, R, Q, C, T, M, S, V, N, T, A, R, P, C, A, G, S, G, R, P, C, G, S, A, Q, C, L, L, I, Q, H, G, L, A, L, A, R, G, G, H, A, A, V, H, N, V, C, Z, F*, , , *, , , *, , , *, , , *, , , * 1141, , 1151, , 1161, , 1171, , 1181, , 1191GACAGCACGGCCTTGCGCTGGCTCGGGGCGGCCATGCGGCAGTGCACAATGT CTGTTAAT, S, N, V, T, T, L, S, Q, V, V, S, S, W, G, R, Z, R, R, P, C, Q, M, L, R, H, Y, H, R, W, Z, A, P, G, A, G, R, E, G, P, V, K, C, Y, D, T, I, T, G, G, E, L, L, G, Q, V, E, K, A, L, F*, , , *, , , *, , , *, , , *, , , * 1201, , 1211, , 1221, , 1231, , 1241, , 1251TCAAATGTTACGACACTATCACAGGTGGTGAGCTCCTGGGGCAGGTAGAGAA GGCCCTGT, S, S, S, G, Q, G, G, R, T, A, A, T, G, T, G, L, A, R, L, V, R, A, R, G, R, V, V, E, Q, L, Q, Q, G, Q, V, L, P, D, Z, C, E, L, G, A, G, W, Z, N, S, C, N, R, D, R, S, C, Q, I, S, A*, , , *, , , *, , , *, , , *, , , * 1261, , 1271, , 1281, , 1291, , 1301, , 1311TCGAGCTCGGGGCAGGGTGGTAGAACAGCTGCAACAGGGACAGGTCTTGCCA GATTAGTG, P, S, I, S, W, R, N, S, L, P, S, V, G, G, I, F, H, Q, L, A, E, F*, , , *, , , * 1321, , 1331, , 1341CCTTCCATCAGTTGGCGGAATTCG
By the respective sequence for analyzing the Strain separated by Burma, it was verified that this uniformity sequentially with the order in pathogenic factor.Contain following order in Burman isolate, it contains except the nucleotide sequence of the base-pair of foremost 37 in ET1.1 orders, and be cloned artefact and confused.This is sequentially the correct order for eliminating clone's artefact.CGGTTGTTCAGTACCAGTTTACTGCAGGTGTGCCTGGATCCGGCAAGTGCCGCTCTATCACCCAAGCCGATGTGGAGGTTGTCGTGGTCCCGACGCGTGA     100GTTGCGTAATGCCTGGCGCCGTCGCGGCTTTGCTGCTTTTACCCCGCATACTGCCGCCAGAGTCACCCAGGGGCGCCGGGTTGTCATTGATGAGGCTCGA     200TCCCTCCCCCCTCACCTGCTGCTGCTCCACATGCAGCCCGCCGCCACCGTCCACCTTCTTGGCGCCCCGAACCAGATCCCAGCCATCGACTTTGAGCACG     300CTGGGCTCGTCCCCGCCATCAGGCCCGACTTAGCCCCACCTCCTGGTGGCATGTTACCCATCGCTGCCTGCGGATCTATGCGAGCTCATCCGTGGTGCAT     400ACCCCATGATCCAGACCACTAGCCGGGTTCTCCGTTCGTTGTTCTGGGGTCAGCCTGCCGTCGGGCAGAAACTAGTGTTCACCCACCCGGCCAAGCCCGC     500CAACCCCGGCTCAGTGACGGTCCACGACGCGCAGGGCGCTACCTACACGGAGACCACTATTATTGCCACAGCAGATGCCCCCGGCCTTATTCAGTCGTCT     600CGGGCTCATGCCATTGTTGCTCTGACGCGCCACACTGAGAAGTGCGTCATCATTGACGGACCAGGCCTGCTTCGCGAGGTGGGCATCTCCGATGCAATCG     700TTAATAACTTTTTCCTCGCTGGTGGCGAAATTGGTCACCAGCGCCCATCAGTTATTCCCCGTGGCAACCCTGACGCCAATGTTGACACCCTGGCTGCCTT     800CCCGCCGTCTTGCCAGATTAGTGCCTTCCATCAGTTGGCTGAGGAGGTTGGCCACAGACCTGTCCCTGTTGCAGCTGTTCTACCACCCTGCCCCGAGCTC     900GAACAGGGCCTTCTCTACCTGCCCCAGGAGCTCACACCACCTGTGATAGTGTCGTAACATTTGAATTAACAGACATTGTGCACTGCCGCATGGCCGCCCC  1000GAGCCAGCGCAAGGCCGTGCTGTCCACAGTCGTGGGCCGCTACGGCGTCGCACAAAGCTCTACAATGCTTCCCACTCTGATGTTCGCGACTCTCTCATCC  1100CCGGATTGGCCCGGATTGGCCCCGTACAGGTTACAACTTGTGAATTGTACGAGCTAGTGGAGGCCATGGTCGAGAAGGGCCAGCATCTGCCGCCGTCCTT  1200GAGCTTGATCTTTGCAACCGTGACGTGTGCAGGATCACCTTCTTCCAGAAAGATTGTAACAAGTTCACCACAGGTGAGNCCATTGCCCATGGTAAAGTGG  1300GCCAGGGCATCTCGGCCTGGAGCAAGACGTTCTGCGCCCTCTTTGGCCCTTGGTTCCGCGCTATTGAGAAGGCTATTCTGGCCCTGCTCCCTCAGGGTGT  1400GTTTTACGGTGATGCCTTTGATGACACCGTCTTCTCGGCGGCTGTCGAGGCCAAAGGCATCCATGGTCTTTGAGAATGACTTTTCTGAGTTTGACTCCAC  1500CCAGAATAACTTTTCTCTGGGTCTAGAGTGTGCTATTATGGAGGAGTGTCGGGATGCCGCAGTGGCTCATCCGCCTGTATCACCTTATAAGGTCTCCGTG  1600GATCTTGCAGGCCCCGAAGGAGTCTCTGCGAGGGTTTTGGAAGAAACACTCCGGTGAGCCCGGCACTCTTCTATGGAATACTGTCTGGAATATGGCCGTT  1700ATTACCCACTGTTATGACTTCCGCGATTTTCAGGTGGCTGCCTTTAAAGGTGATGATTCGATAGTGCTTTGCAGTGAGTATCGTCAGAGTCCAGGAGCTG  1800CTGTCCTGATCGCCGGCTGTGGCTTGAAGTTGAAGGTAGATTTCCGCCCGATCGGTTTGTATGCAGGTGTTGTGGTGGCCCCCGGCCTTGGCCCGCTCCC  1900TGATGTTGTGCCGTTCGCCGGCCGGCTTACCGAGAAGAATTGGCCGTGGCCTGAGCGGCGAAGACACGTGCGCTCGCTGTTGTTAGTGATTTCCTGCGCA  2000AGCTCACGAATGTAGCTCAGAGTGTGTGGATGTTGTTTCCCGTGTTTATGGGGTTTCCCCTGGACTCGTTCATAACCTGATTGGCATGCTACAGGCTGTT  2100GCTGATGGCAAGGCACATTTCACTGAGTCAGTAAAACCAGTGCTCGACTTGACAAATTCAATCTTGTGTCGGGTGGAATGAATAACATGTCTTTTGCTGC  2200GCCCATGGGTTCGCGACCATGCCCCTCGGCCTATTTTGTTGCTGCTCCTCATGTTTTTGCCTATGCTGCCCGCGCCACCGCCCGGTCAGCCGTCTCGCCG  2300CCGTCGTGGGCGGCGCAGCGGCGGTTCCGGCGGTGGTTTCTGGGGTGACCGGGTTGATTCTCAGCCCTTCGCAATCCCCTATATTCATCCAACCAACCCC  2400TTCGCCCCCGATGTCACCGCTGCGGCCGGGGCTGGACCTCGTGTTCGCCAACCCGCCCGACCACTCGGCTCCGCTTGGCGTGACCAGGCCCAGCGCCCCG  2500CCGTTGCCTCACGTCGTAGACCGACCACAGCTGGGGCCGCGCCGCTAACCGCGGTCGCTCCGGCCCCG                                  2568
Methods described herein can be separated from other NANB hepatitis strains and differentiate inhereditary material, and this point is confirmed by differentiating the inhereditary material in the isolate obtained by Mexico.There are about 75% and ET1.1 sequence consensus listed earlier in the order of this isolate.This is sequentially to save the condition provided using following ii .3 by hybridizing to differentiate.The part cDNA being made up of 1304 nucleotides is listed below sequentially.GCGGCCGCTCGGCAAAAGAGGCCTAGGGGGCATGGTGGCGAACCCATGGGCGCACGAAACCACATGTTATTCATTCAGACCGGTGCATAATTGAGTGTGT  100AAGGTCAAGTATAGGCTTAACAGACTCTGTAAAATGCGCCTTACCATCACCAATAGTCTGGAGCATGCCTATCAGGTTATGAACCAGACCCGGGGAAACC  200CCGTAAACTCTAGACACCACCTCAACACAAATCTGGGCCACATTCGTTAACCTACGGAGGAAATCCTGCACGGCGACGCGGACGTGCTCTGCCCGCTCCG  300GATCAGGCCCCCAGTTCTTCTCCGAAAGCCGTCCGGCGAATCGAACGACATCGGGTAGGGCCCCGAGCCCGGGGCGACGACAACCCCGGCATACAGCCCA  400ATCGGCCGGAAGTCAGCCTTCAACTTCGGGCCACAGCCTGCTATAAGCGAACCGGCGCCTGGGCTCTGGCGGTATTCACTACAGAAAGGAACCGACCGAG  500TCGTCGCCCTTGAAGGCGGCAACCTGGAGGTCCCGGAACTCATAGCAATGGGCAATGATTGCCATGTTCCACACCGTATTCCACAGCAACGTGCCCGGCT  600CACCAGAATGCTTCTTCCAGAACCCTCTCAAAGACTCTTTTGGGGCCTGCAGGGATCCACGCCGACCGGACGGCATGGTACAACCTGACAAGCCACTGGG  700GCATACCACACTCTTCCATAATGGCGCACTCAAGACCTAGGGAAAAGTTATTCTGAGTCGAGTCAAACTCAGAAAAATCATTTTCAAACACCATGGCATG  800GCTGGCGCCAGCCACGGCAGCAGAGAATAGTGAGTCGTCATAAGCATCCCCGTAGAACACAGCTTGTGGTAAAAGGGATAGAATAGCCTTCTCAATCGCA  900CGGAACCAGGGGCCAAACAGGGCACAAAAGGTCTTACTCCAGGCGGAGATACCCTCACCGACTTTGCCATGCGCAATTGTCTCGCCGGTCGTGAACTTGT  1000TACAATCCTTCTGGAAAAAGGTTATGCGGGACACATCTCGGCTGCACAAATCCAACTCGAGGACGGCTGAACCGTCTTGGCCCTTCTCGACCATCGCCTC  1100TACAAGCTCAAAGAGTTCACAGGTGGTGGCAGTAACCCGCCGAGAGTGGGAATAAAGCGCGCAAGGGAGGCGCGCACATCCGTGTGACCCGCATCATAAA  1200GCCTTGTGCGTCTGCCATACCGGCCTACCAGCATGACAAAACAGCTTTCCTTTGGCTAGGGGCCGCCATGGGCCTGACAACTGTCACTTAGCTCAAATGT  1300CACA                                                1304
The professional in molecular genetics field it will be recognized that both the above order all discloses corresponding complementary DNA sequentially, and corresponding to shown two primary sequences and complementary DNA order RNA sequentially.In addition, wherein there is encoded peptide to translate frame, although do not list amino acid sequence clearly as in ET1.1 orders above, but this nucleotides still discloses effable peptide.I. define
Term defined below has following meaning：
" 1. intestinal transmitted property non-a, non-b type (ET-NANB) hepatitis virus factor " refers to a kind of virus, virus type or virus type, this factor (i) causes the catarrhal jaundice carried by water, (ii) dog monkey can be infected, (iii) there is different serological properties from hepatitis A virus (HAV) and hepatitis B (HAB), and (iv) inserts the homologous genome area of section comprising one with the 1.33kb cDNA in plasmid pTZ-KF1 (ET1.1), the plasmid is taken in preserving number as in CCTCC M89041 BB4 plants of colibacillus.
So-called 2. " homologous " refers to that nucleic acid fragment can hybridize the base mismatch pair that 25-30% is contained up in chain in phase mutual cross under hybridization conditions.If it is, in general, that (ibid, p.320-323) two single stranded nucleic acid molecules hybridize under conditions of described in Maniatis et al., then it is that homologous but used wash conditions are as follows to claim them：2 × SCC, 0.1%SDS, 2 times at room temperature, every time 10 minutes；Followed by 2 × SCC, 0.1%SDS, 50 DEG C next time, 30 minutes；Followed by 2 × SCC, 2 times at room temperature, every time 10 minutes.It is further preferred that homologous nucleic acid chains contain 15-25% base mismatch pair, 5-15% base mismatch pair is further more preferably comprised only.Stricter wash conditions can be used to be selected for these homologous degree, and be cloned with differentiating from gene library (or other inhereditary materials are originated), as is well known in the art.
3. if a DNA fragmentation is containing the base pair sequence identical or essentially identical with certain region of virokine genome, it is by ET-NANB virokines " generation " to claim this DNA fragmentation.
4. a protein if DNA or RNA fragments as being produced from ET-NANB virokines translate frame coded by, then it is by ET-NANB virokines " generation " to claim this protein.II. the ET-NANB fragments of clone are obtained
According to an aspect of the present invention, it was found that the DNA clone of virus-specific can be produced by following step, (a) RRNA is separated from the known bile with the ET-NANB dog monkeys infected, (b) cloned cDNA fragment to be to form frag-ment libraries, and (c) pass through and infection and non-infection bile source radioactive label cDNA resolution screening by hybridization library.A.cDNA fragment mixtures
Dog monkey is set to occur ET-NANB infection by being injected intravenously inoculation, inoculum is the suspension of 10%W/V Feces of Patients (27-34nm ET-NANB particle positives, average diameter 32nm).Infection animal is monitored by the rising of alanine aminotransferase levels, this rising shows to there occurs virus infection.According to disclosed method (Gravelle), confirmation ET-NANB infection is combined with the immunologic opsonin of viruslike particle (VLP) by seropositivity antibody.In brief, excrement (or bile) sample is taken by the animal after infecting 3-4 weeks, with phosphate buffer with 1: 10 dilution, this 10% suspension is clarified by low-speed centrifugal, continue through 1.2 and 0.45 microns of filter filtering.This material (Bradley) further can be purified by the precipitation process of 30% sucrose cushions.Obtained VLP preparations are mixed with dilute solution serum of the ET-NANB patients infected.After incubated overnight, make mixture centrifuged overnight to precipitate immune aggregation body, the antibody combined after dyeing with electron microscopic examination with VLP.
It can also confirm that ET-NANB infects by the seroconversion to VLP positive serums.In this method, the serum of infection animal is as described above with 27-34nm VLP mixing (this VLP in the fecal specimens of infected patient by separating), the antibody then combined by immunoelectronmicroscopy with VLP.
Bile can be intubated to collect bile fluid by following two ways by collecting in ET-NANB animals showing positives in bile pipeline, or in autopsy by bile pipeline in extraction.As described in example 1A, by hot phenol extraction by extracting total serum IgE in bile.Also according to described in example 1A, with this RNA fragment by triggering the corresponding double stranded cDNA fragment of synthesis at random.CDNA fragments are separated by gel electrophoresis or density gradient centrifugation, to obtain the fragment of required size, such as 500-4000 base pair fragments.
Although other viral material source production cDNA components, such as VLP obtained as fecal specimens (as described in example 4) can be used, but still preferably use bile source.According to an aspect of the present invention, by the card of immuno-electron microscope it has been found that the bile from ET-NANB infection monkeys has more complete virus particles than the material from fecal specimens.The bile obtained by the ET-NANB people infected or dog monkey can be used as ET-NANB virus proteins or genomic material or intact virus and source, and this bile constitutes the part of the present invention.B.cDNA libraries and its screening
Above-mentioned cDNA fragments are cloned into suitable cloning vector to form cDNA library.This can be completed by following step：Assemble suitable end manual splice for blunt fragment, such as EcoRI sequentially, then by the suitable insertion point of this fragment inserting clone carrier, such as single EcoRI sites.After preliminary clone, library can if desired cloned again, to improve the percentage of the carrier containing Insert Fragment.The building process in library is described in detail in example 1B.In this method, cDNA fragments is become blunt end, fit on EcoRI ends, and insert in bacteriophage lambda gt10 EcoRI sites.The Insert Fragment that this library phages is shown is less than 5%, after being isolated, Insert Fragment is cloned into again in λ gt10 carriers, produced bacteriophage contains more than 95% slotting section.
By the resolution hybridization with cDNA probes, screening is specific to ET-NANB order in cDNA library, and cDNA probes are produced by source infecting and being uninfected by.Carry out self-infection and be uninfected by bile or the cDNA fragments of faecal viruses isolate to be prepared as above.(Maniatis, page 109), is radiolabeled by random labelling, nick translation or end mark to fragment according to conventional methods.As example 2 is described in detail, hybridizes by being transferred to the nitrocellulose filter of duplication, and with the radiolabeled probe of infection genesis and non-infection genesis (control), above-mentioned cDNA library is screened.In order to reclaim the order for locating hybridization outside preferred 25-30% base mismatch is to scope, the clone hybridized under the conditions of Maniatis et al. (ibid, p.320-323) is described can be selected, but use following wash conditions：2 × SCC, 0.1%SDS, 2 times at room temperature, every time 30 minutes；Followed by 2 × SCC, 0.1% SDS, 1 time, 30 minutes at 50 DEG C；Followed by 2 × SCC, 2 times at room temperature, every time 10 minutes.By these conditions, Mexico's isolate can be differentiated by the use of ET1.1 orders as probe.Show that the plaque with the selective hybridization of probe of infection genesis preferably remakes flat board culture with low-density, and screened again as described above, to isolate the monospecific polyclonal for being specific to ET-NANB orders.As pointed by example 2, by these processes, 16 are identified and have occurred the clone of specific hybrid with the probe of infection genesis.One of them is named as λ gt10-1.1, and it contains 1.33kb Insert Fragment.C.ET-NANB is sequentially
Pass through the sequential determination of standard, it is determined that the base pair sequence for the ET-NANB fragments cloned in part B.In the illustrative method that example 3 is described, Insert Fragment is cut from the cloning vector of selection, is separated by gel electrophoresis, in the cloning vector for being inserted into the base pair sequence of known insertion point both sides.The specific carrier that example 3 is utilized is pTZ-KF1 carriers, and it is shown in Fig. 1 left side.By in the single EcoRI sites of the ET-NANB fragments insertion pTZ-KF1 plasmids from gt10-1.1 bacteriophages.As described in example 3, differentiate the recombinant of slotting section needed for carrying by the hybridization of the 1.33kb fragments with separating.A selected plasmid is accredited as pTZ-KFF1 (ET1.1), and this carrier produces expected 1.33kb fragments after being digested with EcoRI.BB4 plants of the colibacillus infected with pTZ-KF1 (ET1.1) plasmid have been deposited in American Type culture and have collected center (Rockville, MD), and preserving number is CCTCCM89041.
Fig. 1 bottoms give pTZ-KFF1 (ET1.1) schematic diagram of plasmid.The 5 ' of Insert Fragment and 3 ' end regions indicate A and C respectively, and intermediate region indicates B.Order in these regions is determined by the double deoxidation sequential determination (seeing below) of standard.Three short order (A.B and C) is from same insertion chain.It can be seen that B areas order is actually what is determined by opposition chain from example 3, therefore B Qu Shunxu given above represent the complementary order of institute's surveyor's chain.The base number of part order is general.
The later stage work in the present inventor laboratory identifies complete sequence (being also given above).The fragment of this complete sequence is easy to be prepared with restriction endonuclease.Computer analysis and identification is carried out to two kinds of orders of forward and reverse and goes out some cleavage sites.Following table summarizes these specific cleavage sites (forward sequence).Base number CC^WGG (BstNI) CCWGG 106,360,410,483 answered in discriminating order pairing order " forward direction " chain (^=cleavage sites),
                                         497,973,1129,1243CC^SGG(NciI)                CCSGG            288,841,1063GAAGANNNNNNNN^(MboII)       GAAGA            822,1116TCTTC (＜ -7-MboII) TCTTC 422,611,849GCGTC (＜ -10-HgaI) GCGTC 225GCATCNNNNN^ (SfaNI) GCATC 488,640GCAGCNNNNNNNN^(BbvI)           GCAGC          53,631,1149GCTGC (＜ -12-BbvI) GCTGC 919,979GGATGNNNNNNNNN^(FokI)          GGATG          363,734,1212CATCC (＜ -13-FokI) CATCC 641,750GGTGANNNNNNNN^(HphI)           GGTGA          454,589,835,931TCACC (＜ -7-HphI) TCACC 114,416,446,762GP^CGYC(AhaII)                 GPCGYC         224GDGCH^C(BspI1286)              GDGCHC         77,110,158,838,
1125,1324GPGCY^C (BanII) GPGCYC 77,110,838,1125C^YCGPG (AvaI) CYCGPG 74,178Y^GGCCP (EaeI) YGGCCP 171,290,626,875
                                          1101GWGCW^C(GgiAI)                 GWGCWC         77,110,158,1324C^CTTGG(StyI)                  CCTTGG         529,1068P^GATCY(XhoII)                 PGATCY         782CAG^CTG(PvuII)                 CAGCTG         54C^CATGG(NcoI)                  CCATGG         344,468,644CGAT^CG(PvuI)                  CGATCG         1031C^GGCCG(EagI)                  CGGCCG         1101G^AATTC(EcoRI)                 GAATTC         2,1335GAGCT^C(SacI)                  GAGCTC         77,110GCATG^C(SphI)                  GCATGC         1268GCC^GGC(NaeI)                  GCCGGC         994,1099,1103G^CGCGC ( BssHII ) GCGCGC 1073GGGCC^C ( ApaI ) GGGCCC 1125TCG^CGA ( NruI ) TCGCGA 264T^CTAGA ( XbaI ) TCTAGA 705TTT^AAA ( DraI ) TTTAAA 925G^TGCAC ( ApaLI ) GTGCAC 158ACCTGCNNNN^ ( BpsMI ) ACCTGC 99GCAGGT (＜-8-BspMI ) GCAGGT 1045GACN^NNGTC ( TthlllI ) GACNNNGTC 604CCANNNN^NTGG ( PflMI ) CCANNNNNTGG 10CC^TNAGG ( MstII ) CCTNAGG 571GCCNNNN^NGGC ( BglI ) GCCNNNNNGGC 216,359,738CCANNNNN^NTGG (BstXI) CCANNNNNNTGG 204III.ET-NANB fragments
According on the other hand, present invention additionally comprises the ET-NANB specific fragments or probe that can hybridize with ET-NANB genome orders or the cDNA being generated by it fragments.This fragment may include the cDNA fragments of the complete length as described in section II, or can be the shorter order by being produced in the cDNA fragments cloned.Will be it can be seen that by carrying out enzymatic digestion to complete length fragment under conditions of size fragment needed for producing, shorter fragment can be prepared from the description of iv section.Generated in addition, the order produced by cDNA fragments can also be used in these fragments by oligonucleotide synthesis method.The method or service for producing the oligonucleotide fragment of selecting sequence can be obtained.
In order to confirm that given ET-NANB fragments are strictly what is produced by ET-NANB virokines, the fragment can be made to hybridize with the electing property of cDNA from the source of infection.From descriptive purpose, in order to confirm that the 1.33kb fragments in pTZ-KF1 (ET1.1) plasmid are initiated by ET-NANB's, this fragment is cut from pTZ-KF1 (ET1.1) plasmid, purified, radioactive label is carried out by random labelling method.The cDNA for making labeled fragment and carrying out the separation of self-infection and the non-source of infection hybridizes, to confirm that cDNA of the probe only with the source of infection reacts.Example 4 illustrates the method, wherein, check above-mentioned radiolabeled 1.33kb fragments (coming from pTZ-KF1 (ET1.1) plasmid) and cDNA (being prepared by infection and the non-source of infection) combination.The source of infection includes the bile that (1) carrys out the freely dog monkey of a virus, the virus is produced by the known fecal specimens with the ET-NANB Burma patients infected, the virokine that (2) are produced by the fecal specimens of patient ET-NANB of Mexico.CDNA in every kind of fragment mixture, is expanded according to manual splice/primer extension method of example 4 first.The isolated fragment on Ago-Gel, then carries out Sowthern trace transfers, is then hybridized, and combines cDNA of the radiolabeled 1.33kb fragments with separating.As would be expected, the swimming lane containing source of infection cDNA shows fuzzy bonding probes band (cDNA expanded by manual splice/primer extension method is expected to wider a wide range of).Probe is not observed to be combined with the amplification cDNA from the non-source of infection.As a result show, 1.33kb probes are specific to the cDNA fragments related to ET-NANB infection.Had confirmed with ET1.1 as the similar research of probe, the probe can be with the ET-NANB sample hybridizations collected from Tashkent, Somalia, Borneo and Pakistan and other places.Secondly, the fact that probe is specific to the EAT-NANB associated orders from different continents (Asia, Africa and North America) illustrates, the African ET-NANB orders of clone are produced by universal type ET-NANB viruses or virus type, and it is responsible for worldwide ET-NANB virus infections.
In a related conclusive research, the probe that the genomic fragment with separating is combined is checked, these isolated fragments are by people or the preparation of dog monkey genomic DNA.Probe is not observed to be combined with any genomic fragment, this shows that ET-NANB fragments are not the endogenous fragment of people or dog monkey.
Another evidence that there is the specific orders of ET-NANB in these fragments is that the code area in fragment can express ET-NANB albumen.Following iv section discusses the method using these fragment expression albumen.
One important use of ET-NANB specific fragments is to differentiate the cDNA produced by ET-NANB, wherein containing other order information.Then, the cDNA newly differentiated produces new probe fragment again, enabling further repeated, until identifying complete viral genome and determining its order.The ET-NANB library other to differentiate and the method for being generated by it new probe, can typically follow clone and the system of selection described in section II.
These fragments (and the oligonucleotides prepared according to order given above) may further be used to the primer of the polymerase chain reaction (PCR) method as the ET-NANB viral genome materials in detection patient samples.Following V sections will describe this diagnostic method.IV.ET-NANB protein
As described above, by the way that the expression of frame code area can be translated in ET-NANB fragments, ET-NANB protein can be prepared.For the ET-NANB fragments of expressing protein produced by the cDNA cloned in a kind of method for optimizing, the cDNA makes the fragment that it produces required size, the preferably main random fragment between about 100 to about 300 base-pairs of size by processing.Example 5 is described digests the method for preparing this fragment by DNA.As it is desirable that obtaining the peptide antigen between about 30 to about 100 amino acid, digestion fragment preferably through excessive separation, for example, is separated by gel electrophoresis, to select the fragment in the range of about 100-300 base-pairs.A. expression vector
ET-NANB fragments are inserted in suitable expression vector.The example of one expression vector is λ gt11, and it contains single EcoRI insertion points at the base-pair of beta-galactosidase gene translation stop codon upstream 53.Therefore, insertion sequence will be used as beta galactosidase expressing fusion protein, it contains N-terminal portion, heterologous peptides and the C-terminal region with or without beta galactosidase peptide of beta-galactosidase gene (if heterologous peptides coded sequence is free of translation stop codon, C-terminal part will be expressed).This carrier also produces a responsive to temperature type repressor (c1857), it at the allowed temperature (such as 32 DEG C) cause the lysogenesis of virus, and cause virolysis if higher temperature (such as 42 DEG C).The advantage of this carrier includes：(1) high efficiency produces recombinant, and (2) can select the host cell of lysogenization, and (3) high level to produce the fusion protein of restructuring at a temperature of permission rather than non-permitted according to the growth of host cell.Further, since the beta galactosidase that the bacteriophage containing heterologous slotting section produces is inactivation, then the substrate reactions that the phagocytosis physical efficiency containing slotting section is easily dyed by beta galactosidase are differentiated.
In order to which the viral fragment digested is inserted in expression vector, if desired, it can be modified according to routine techniques, the manual splice for making it contain selectable restriction site, such as EcoRI manual splicies.Example 1 illustrates the method being cloned into digestion fragment in λ gt11, and this method comprises the following steps：Flat fragments end, is connected with EcoRI manual splicies, and fragment is imported in the λ gt11 that EcoRI is cut.The Viral genomic libraries of generation can be checked, to confirm to have generated relatively large (representative) library.For λ gt11 carriers, this can be completed by following methods：Suitable bacterial host is infected, flat board culture bacterium checks the plaque for losing betagalactosidase activity.Using the methods described of example 1, there is about 50% plaque to show and lose enzymatic activity.B. the expression of peptide antigen
The production of peptide antigen (being expressed in the form of fusion protein) is screened in the Viral genomic libraries of above-mentioned formation, the antigen has the immunocompetence with the antiserum reaction from ET-NANB seropositive individuals.In a preferred screening technique, the host cell that culture is infected with phage library carrier as described above duplicates culture plate, so that the recombinant protein antigen produced by cell is transferred on filter membrane with nitrocellulose filter.Then react filter membrane and ET-NANB antiserums, uncombined antibody removed by washing, then the anti-human antibody with mark reacts, the antibody with sandwich like way by anti-ET-NANB antibody bindings on filter membrane.
Generally, the bacteriophage plaque identified by the production of recombinant antigen interested, detects that they produce the situation of antibody response fusion protein again with relatively low density.By the method, the recombinant phage clone of some production immunocompetence recombinant antigens is identified.
In order to be purified into recombinant protein, production can be enlarged with the expression vector of selection.Production is enlarged using one kind in a large amount of known methods, these methods include：(a) suitable host (such as colibacillus) lysogenization is made with the λ gt11 recombinants of selection, (b) cultivates transducer cell, (c) purified recombinant antigens from dissolving cell under conditions of high-level heterologous peptides is produced.
In a method for optimizing of above-mentioned λ gt11 cloning vectors is related to, the high production strain of colibacillus host is infected with the library phages of selection, BNN103 plant, and carry out with two flat boards repeatedly culture.At 32 DEG C viral lysogenesis can occur at this temperature for one flat board culture, and another culture is at 42 DEG C, and the bacteriophage infected at this temperature is in dissolved state, and therefore prevents the growth of cell.It is therefore contemplated that the cell produced under relatively low rather than higher temperature is by successfully lysogenization.
Then, make to grow in lysogenization host cell liquid medium within, this condition is conducive to the high level production of the fusion protein containing viral slotting section, by quick-frozen dissolving cell with the fusion protein needed for discharging.C. the purifying of peptide
Differential precipitation, sieve chromatography, ion-exchange chromatography, isoelectric focusing, gel electrophoresis and affinity chromatography etc. can be may include by the method for purifying proteins purification of Recombinant peptide of standard, these methods.For fusion protein, such as the beta galactosidase fusion protein of above-mentioned preparation, the protein separation technology for purifying can be by the technological transformation for separating natural albumen.Therefore, for separation beta galactosidase fusion protein, it is easy to isolate albumen by simple affinity chromatography, even if cell dissolved matter is combined with the solid phase of beta galactosidase antibody just by surface.D. virus protein
The ET-NANB albumen of the present invention also can be produced directly by ET-NANB virokines.The VLP separated as described above by the fecal specimens of infected individuals, is a suitable virus protein material source.The VLP separated by fecal specimens can be further purified by affinity chromatography, then carry out Separation of Proteins (see below).Virokine can also be produced by group born of the same parents' culture, and this provides a convenient and potential concentrated source for virus protein.Have jointly 846 submitted on April 1st, 1986, No. 757 U.S. Patent applications describe a kind of three knurls (trioma) liver cell do not gone out, the NANB infection in its energy sertoli cell culture.Three oncocyte systems are to blend preparation to (being selected according to the stability of human chromosome) by making human liver cell be merged with mouse/people.Cell containing required NANB virokines, the human antibody using anti-ET-NANB is differentiated by immunofluorescence technique.
Before separation albumen, crush virokine by conventional method, these methods may include utilizing for sonication, high salt or low-salt conditions or detergent.
ET-NANB virus proteins can use the suitable solid phase that purifying ET-NANB antibody is combined according to standard method by affinitive layer purification.Antibody by affinitive layer purification, in this purifying, can also make the immunocompetence ET-NANB protein bindings of the restructuring of for example above-mentioned preparation in solid phase in itself, to separate ET-NANB antibody from immune serum.The antibody of combination is discharged from solid phase by standard method.
Another method is that ET-NANB antibody can be the monoclonal antibody (Mab) prepared according to following methods：With ET-NANB recombinant proteins immune mouse or other animals, make cell constantization, the successful fusion product of selection and the protein immunogen reaction of restructuring by separating lymphocyte in animal, and with suitable fusion partners.They can be used in above-mentioned affinity purification, to obtain natural ET-NANB antigens.V. practicality A. diagnostic methods
The particle and antigen of the present invention, and inhereditary material can be used to diagnose in detection method.The method of detection ET-NANB hepatitis includes, and analyzes biological sample such as blood sample, excrement or liver biopsy, and seeing whether there is has and ET-NANB hepatitis viruse analyte of interest.
Analyte can be the nucleotide sequence hybridized with probe, and the probe includes at least 16 continuous nucleotides in said sequence (cDNA is sequentially), typically 30 to 200 nucleotides, until the nucleotides of essentially completed order.Analyte can be RNA or cDNA.Typical analyte is to suspect the virion for ET-NANB, or a kind of particle that this classification is just being excluded for it.Virion further feature is that have a rna virus cdna group, the order that the genome contains has at least about 80% homologous degree with the order of at least 12 continuous nucleotides in above-mentioned " forward direction " and " reverse " order, typically there is at least about 90% homologous degree with least about 60 continuous nucleotides in the order, and one and the order of complete length homologous order substantially can be contained.In order to test and analyze thing, in the case of analyte and probe hybridization, the probe can contain detectable mark.
Analyte, which may also comprise, recognizes a kind of antibody of antigen, such as cell surface antigen in ET-NANB virion.Analyte can also be ET-NANB viral antigens.When analyte is antibody or antigen, immune complex can be combined to form with the antigen or antibody and analyte of mark respectively, then can detect this compound by marking.
It is, in general, that the method for detection and analysis such as surface antigen and/or complete particle is to be detected as basis with immune.Immunodetection can be used to determine the antibody produced in host due to the infection of ET-NANB hepatitis viruses, or directly determine virion or antigen.This technology is it is well known that without being described in detail here.The example includes heterogeneous and homogeneity immunoassay technology.Both technologies are all based on forming immune complex between virion or its antigen and corresponding specific antibody.The heterogeneous detection method of viral antigen is usually using the specific monoclonal or polyclonal antibody combined with solid phase surface.Sandwich assay is just becoming more prevalent.Homogeneous detection method can also be used, this is carried out in the solution without solid phase, for example, determine due to the enzyme activity difference that free antibodies is combined and produced with enzyme-antigen conjugates.Some suitable detection methods are disclosed in US3,817,837,4,006,360,3,996,345.
When determining the antibody by ET-NANB virus inductions, detection IgG or IgM antibody can be removed as specific binding agents with the virus and antigen of the present invention.Because IgM antibody is usually the antibody that occurs first in course of infection, now IgG synthesis may be also not actuated, therefore, by specifically differentiating IgM and IgG antibody in host blood, actually or with regard to doctor or other researchers can be made to determine that the infection is recent chronic.
In a kind of diagnostic method, test sera is set to be combined with the surface the former solid-phase reagent reaction of ET-NANB proteantigens.After anti-ET-NANB antibody is combined with reagent, uncombined serum component is washed away, the anti-human antibody of the reagent and mark is reacted, display thing is combined on reagent, binding capacity is proportional to the ET-NANB amount of antibody combined in solid phase.Washing reagent determines the amount of the display thing combined with reagent to remove uncombined labelled antibody.It is, in general, that the display thing is a kind of enzyme, it is detected by making solid phase be incubated with suitable fluorescence or chromogenic substrate.
Solid phase surface reagent in above-mentioned detection method is prepared by known technology, for making protein substance adhere to solid support, such as polymeric beads, leaching label or filter.These adherence methods generally comprise the non-specific adsorption of protein and solid phase, or protein and solid phase covalent bond, reacted generally by the chemical active radical on free amino and solid phase, carboxyl base, hydroxyl or the aldehyde radical of such as activation.
In second of diagnostic method, i.e., so-called homogeneous detection method produces some changes with the antibody of solid phase binding in response matrix, and these changes can be detected directly in matrix.So far, it is known that the general type of the homogeneous detection method proposed has：(a) (Spin-labeled) of spin labeling shows thing, detected with the antibody of antigen binding by shown mobility (broadening at spin-spin splitting peak), (b) fluorescence display thing, surveyed and combined by the change detection of fluorescence efficiency, (c) enzyme shows thing, antibody binding influences the interaction of enzyme/substrate, and the display thing that (d) liposome is combined, with reference to causing liposome dissolving and discharge Nang Bao display thing.These methods follow the conventional method progress for preparing homogeneous detection reagent with the adaptation of proteantigen of the present invention.
In each above-mentioned detection method, it is directed to make the serum of test individual react with proteantigen and check antigen, sees with the presence or absence of the antibody for having combination.In the detection of first method, it may include make the anti-human antibody of mark and antibody binding to be checked, check that antibody is IgM (acute stage) or IgG (convalescence), and determine with because of the display thing quantity being combined.In the detection of second method, it may include observe the effect after antibody is combined with homogeneous detection reagent.
Detecting system or medicine box for carrying out above-mentioned detection method also constitute an aspect of of the present present invention.Medicine box generally includes the solid phase that surface is combined with recombinant protein antigen, the antigen is that (a) has the immunocompetence for being directed to the antibody being present in intestinal transmitted property non-a, non-b type virokine capsule sense individual, and (b) is produced from the virus hepatitis factor, the genome of the factor contains one and inserts the homologous region of section with plasmid pTZ-KF1 (ET1.1) 1.33kb DNA EcoRI, and the plasmid is taken in preserving number as in CCTCCM89041 BB4 plants of colibacillus.It is used to detect the anti-ET-NANB antibody of surface combination in medicine box by the anti-human antibody of display substance markers.B. the application of viral genome diagnosis
The inhereditary material of the present invention can be used in a variety of detection methods in itself, using the probe as the inhereditary material in natural infect.A kind of method for making nucleic acid target amplification (for then being analyzed by hybridization check) is so-called polymerase chain reaction (PCR) method or round pcr.Using the Oligonucleolide primers opened each other and based on above-mentioned genetic sequence, round pcr can be used for detecting the virion of the present invention in suspected pathological sample.Primers complementary is in the opposition chain of double chain DNA molecule, and they are typically separated by about 50-450 or more nucleotides (being typically no more than 2000 nucleotides).The method includes preparing special Oligonucleolide primers, then repeats following circulations：Target DNA is denatured, and primer is combined, and is extended to obtain the DNA fragmentation of the length according to desired by primer interval with archaeal dna polymerase.The extension products produced by a primer are used as the extra target sequence of other primer.The amplification degree of target sequence is controlled by cycle-index, and by simple formula 2nMake theoretical calculation, wherein n is cycle-index.Assuming that the average efficiency circulated every time is about 65% to 85%, then 25 circulations produce the target sequence that 0.3-4.8 million is copied.PCR method is recorded in many publications, including Saiki et al., Science230：1350-1354,1985；Saiki et al., Nature 324：163-166,1986；Scharf et al., Science 233：1076-1078,1986.Referring also to US 4,683,194；4,683,195；4,683,202.
The present invention includes the specific diagnostic assays of a measure ET-NANB virokine, and the method is based on the selective amplification of ET-NANB fragments.The method utilizes a pair of single-stranded primers, they are produced by the non-homogeneous area of DNA double chain fragment opposition chain, the double-stranded DNA is produced by intestinal transmitted property hepatitis virus factor, the genome of this factor contains one and inserts the homologous region of section with the EcoRI of 1.33kb DNA in plasmid pTZ-KF1 (ETI.1), and the plasmid is taken in preserving number as in M89041 BB4 plants of colibacillus.These " primer segments " constitute an aspect of of the present present invention, and they are prepared by ET-NANB fragments above for example described in section iii.This method is as described above, it then follows US4, the method for the nucleic acid sequences for expanding selection disclosed in 683,202.C. peptide vaccine
Any antigen of the present invention can be used in preparing vaccine.Prepare the fixed particle antigen by being separated in bile of preferred initial substance of vaccine.Antigen is preferably reclaimed first in the form of complete particle as described above.However, it is also possible to by preparing suitable vaccine from the particle or non-particle recombinant antigen of other source separation.If using non-particle antigen (being usually soluble antigen), preferably using and preparing vaccine by the albumen of virus envelope or viral capsid generation.These albumen can pass through above-mentioned affinitive layer purification.
If purifying protein does not possess immunogenicity in itself, it can be incorporated on carrier so that albumen has immunogenicity.Carrier includes bovine serum albumin, keyhole limpet hemocyanin etc..Preferably make antigen purification extremely substantially free of people's albumen, but this is not required in that.But importantly, in antigen can not the albumen containing nonhuman origin, virus and other materials, they may be imported by various pollution channels, for example, cultivate or obtain nutrient matrix used by virus, cell line, the pollution of tissue or pathology liquid.
Inoculation can be carried out by conventional methods.For example, antigen (either virion or albumen) can be used in suitable diluent, such as water, physiological saline, buffer solution, complete or incomplete adjuvant.Immunogene is applied with induction of antibodies using standard technique, such as containing inactivation or the virion weakened or the hypodermic injection of the physiological compatibility sterile solution of antigen.The virion of immune response amount typically can be produced by vaccinal injection administration, volume is generally 1 milliliter or less.
One specific vaccine combination example includes a kind of pharmaceutically acceptable adjuvant, a kind of recombinant protein or protein mixture produced by Enterically transmitted non-A/non-B hepatitis viral agent, the genome of the factor contains one and inserts the homologous region of section with the EcoRI of 1.33kbDNA in plasmid pTZ-KF1 (ET1.1), and the plasmid is taken in preserving number as in M89041 BB4 plants of colibacillus.Vaccine is applied with the interval of determination, until detecting significant ET-NANB antibody titers in serum.This vaccine will prevent ET-NANB infection.D. antibody and antiserum are prevented and treated
In addition to as vaccine, composition can also be used for preparing the antibody for ET-NANB virion.Antibody can be used directly as antivirotic.In order to prepare antibody, host animal is immunized using virion, or if appropriate, the non-particle antigen for making virion naturally-produced as described above combined with carrier and as vaccine.Human serum or blood plasma are collected after suitable time interval, to provide the composition containing the antibody that can be reacted with virion.By using (such as) saturated ammonium sulfate or DEAE Sephadex, or other technologies known in the art, gamma Globulin component or IgG antibody can be obtained.Antibody will not substantially produce many unfavorable side effects, and this side effect may be combined with other antivirotics such as medicine.
Minimized by making potential unfavorable immune system response, antibody compositions can be made to become that there is bigger compatibility with host system.This is completed by following methods：All part Fc parts of the antibody of alien species are removed, or use the antibody of the same race with host, such as using the antibody from the miscellaneous knurl of people/people.
Antibody may further be used to the means as enhancing immune response, because antibody-viral compound is recognized by macrophage.The amount of application of antibody can be similar to the antibody amount of application for other treatment.For example, other viral diseases such as rabies, measles and hepatitis B infection in early days, the amount of application of the gamma Globulin of collection is weighed oneself for 0.02-0.1ml/, with the entrance cell of viral interference.Accordingly, it is capable to which the antibody reacted with ET-NANB virion, can be combined the host being passively applied to infected with ET-NANB viruses, to strengthen the effect of immune response and/or antiviral drugs individually or with another antivirotic.
In addition, the antibody of anti-ET-NANB viruses can be induced as the anti-id AB of immunogene by applying.The convenient practice is that anti-id AB is induced in host animal using the ET-NANB antiviral antibody preparations for the purifying being prepared as above.Composition is administered to host animal in suitable diluent.After administration, the administration typically repeated, host produces anti-id AB.In order to eliminate the immunogenic response for being directed to Fc areas, the antibody by being produced in the animal of the same race with host animal can be used, or remove the Fc areas of institute's administration of antibodies.Induced in host animal after anti-id AB, take out serum or blood plasma to provide antibody compositions.Can be as above in face of purified composition described in the anti-ET-NANB antiviral antibodies of purifying, or by using the affinitive layer purification for the anti-ET-NANB antiviral antibodies for being incorporated into affinity substrate.The conformation of produced anti-id AB is similar to real ET-NANB antigens, and can be used to prepare ET-NANB vaccines, and without using ET-NANB particle antigens.
If being used as inducing the means of anti-ET-NANB antiviral antibodies in patient body, the mode of injection of antibodies is identical during purpose with for being inoculated with, i.e. in the diluent of PHYSIOLOGICALLY COMPATIBLE, under conditions of adjuvant is with or without, muscle, intraperitoneal, hypodermic injection etc. are carried out with valid density.One or many booster shots are probably needs.The method that ET-NANB antiviral antibodies are induced with anti-idiotype, can slow down may be by passively applying the problem of anti-ET-NANB antiviral antibodies cause, such as unfavorable immune response, and blood constitutent to applying purifying it is related the problem of, such as by also undiscovered viral infection at present.
The present invention may be additionally used for producing the antiserum of the prevention processing before or after being designed to be exposed by the ET-NANB albumen produced.In this method, ET-NANB albumen or protein mixture are administered to volunteer to produce human antiserum together with suitable adjuvant by known method.As described in section II A above, in a period of immune rear several weeks, the antibody response for injecting albumen is monitored, i.e., periodically extracts the anti-ET-NANB of blood serum sample detection serum antibody.
Antiserum from immune body can be administered to the individual with risk of infection as pre-exposure prophylaxis agent.The individual that antiserum can be additionally used in after treatment exposure, i.e., make the prevention after exposure to hepatitis B similar to using high titre antiserum.E. monoclonal antibody
For the antibody and anti-id AB for ET-NANB virion and albumen, in two kinds of purposes of live body and diagnosis, monoclonal antibody is all preferably used.Can be such as the antiviral particle antibody or anti-id AB of following production monoclonals.The method according to known to professionals in the field, spleen or lymphocyte are taken out by immune animal, and make its constantization or for preparing hybridoma.In order to produce people-people's hybridoma, selection human lymphocyte is used as donor.The known donor (having had proven to this by the presence or Virus culture of antiviral antibody in blood to infect) infected with ET-NANB viruses can be used as suitable lymphocyte donor.Lymphocyte, or the usable splenocyte if making donor be subjected to splenectomy can be separated from peripheral blood sample.Epstein-Barr virus (EBV) can be used human lymphocyte constantization, or the fusion partners of usable people is produced people-people's hybridoma.When producing human monoclonal antibodies, it is possible to use peptide carries out in vitro primary immune.
The antibody that constantization cell is secreted is screened, to determine clone of the secretion with required specific antibody.For the antiviral particle antibody of monoclonal, antibody must be combined with ET-NANB virion.For the anti-id AB of monoclonal, antibody must be with antiviral particle antibody binding.Select cell of the production with required specific antibody.
Following examples illustrate various aspects of the invention, but they are in no way intended to limit the scope of the present invention.Material
Material used is as follows in following examples：
Enzyme：DNA enzymatic I and alkaline phosphatase esterase derive from Boehringer MannheimBiochemicals (BMB, Indianapolis, IN)；EcoRI, EcoRI methylase, DNA ligase and DNA polymerase i derive from New EnglandBiolabs (NEB.Beverly MA)；RNaseA derives from Sigma (St.Louis, MO).
Other reagents：EcoRI manual splicies derive from NEB；The chloro- 3- indoyl phosphates (BCIP) of NBT (NBT), the bromo- 4- of 5-, the chloro- 3- indyls-B-D- galactopyranosides (X-gal) of the bromo- 4- of 5- and isopropyl-B-D- Thiogalactopyranosides (IPTG) derive from Sigma.
CDNA synthesizes medicine box and random initiation labeling kit derives from Boehringer-Mannheim Biochemical (BMB, Indianapolis, IN).Example 1 prepares cDNA library A.ET-NANB viral sources
Two dog monkeys (cynos) are injected intravenously with 10% fecal specimens suspension, the sample is derived from by the second generation monkey (cyno#37) of one plant of ET-NANB virus infection, the virus is separated in the Burma patient by excrement in the ET-NANB positives, it is that the 27-34nm viroids particle (VLP) in excrement is combined with the immune serum of known ET-NANB patient to infect evidence.The ALT (ALT) of higher level is occurred in that after inoculation between 24-36 days, in animal body, has a preceding acute stage in infection to secret out of 27-34nm VLP in its bile.
The bile pipeline of every infection animal is intubated, about 1-3cc bile is collected daily.Using the RNA partition methods of standard, by extracting RNA by hot phenol extraction method in a bile sample (cyno#121).Medicine box is synthesized using the cDNA derived from Boehringer-Mannheim (Indianapolis, IN), double-strand cDNA is formed by the RNA separated, the first chain is produced by random priming.B. double-stranded segment is cloned
At the standard conditions (Maniatis, p.118), make the end of double stranded cDNA fragment smooth with T4 archaeal dna polymerases, then extracted with phenol/chloroform, use ethanol precipitation.(Maniatis, p.396-397) is connected tack material with EcoRI manual splicies at the standard conditions, and digests to remove unnecessary connector end with EcoRI.Manual splice on not connected is removed by continuous isopropanol precipitating.
λ gt10 phage vectors (Huynh) derive from Promega Biotec (Madison, WI).This cloning vector has single EcoRI cloning sites in bacteriophage cI repressor genes.It will be imported from above-mentioned cDNA fragments in this EcoRI site, the gt10 that i.e. mixing 0.5-1.0 μ g EcoRI are cut, C.5, the above-mentioned double-stranded segments of 0.5-3 μ l, 0.5 μ l 10x connection buffer solutions μ l ligases (200 unit) and add to 5 μ l distilled water.According to standard method (Maniatis, p.256-268), make mixture in 14 DEG C of incubated overnights, then packed in vitro.
With hf1 plants, such as HG415 plants of phage-infect colibacillus packed.In addition, it is possible to use hf1 plants of colibacillus C600, it is available from Promega Biotec, Madison, WI.By the analysis of 20 random plaques, the restructuring plaque percentage of the slotting section with EcoRI ends is less than 5%.
Resulting cDNA library makees flat board culture, by adding elution buffer from wash-out bacteriophage on selection flat board.Extracted by bacteriophage after DNA, digest DNA with EcoRI, discharge heterologous slotting stage group and fall, isolation of DNA fragments is to remove bacteriophage fragment on agarose.500-4 is isolated, 000bp inserts section, is cloned into again in λ gt10 as described above, with HG415 plants of phage-infect colibacillus packed.The percentage of success recombinant is more than 95%.By phage library culture on HG415 plants of flat boards of colibacillus, in 8 flat boards altogether, there are about 5,000 plaque/flat board.The selection A.cDNA probes of the ET-NANB cloned sequences of example 2
As described in Example 1, double stranded cDNA fragment is prepared in the dog monkey infected by non-infection and ET-NANB.Using the random initiation labeling kit derived from Boehringer-Mannheim (Indianapol-is, IN), radioactive label is carried out by triggering method at random to cDNA fragments.B. Immune Clone Selection
According to standard method (Mariatis, p.320-323), the cDNA library that example 1 is cultivated is transferred on two nitrocellulose filters, phage DNA is fixed on filter membrane by baking.Repeat filter membrane and the above-mentioned source of infection or compare cDNA probes to hybridize.The autoradiograph of filter membrane is checked, to differentiate the library clone only hybridized with the radioactive label cDNA probes of infection genesis, that is to say, that they do not hybridize with the cDNA probes of the non-source of infection.By this subtraction back-and-forth method, 16 this clones are identified from altogether about 40, the clone of 000 inspection.
Choose this 16 clones, and with low concentration culture on agar plate.Clone on each flat board is transferred on two nitrocellulose filters by duplicating, and checks the hybridization of the radioactive label cDNA probes with infection and the non-source of infection as described above.Select the clone's (that is, being combined with source of infection probe, but not combined with the probe of the non-source of infection substantially) for presenting and having selective binding with source of infection probe.Isolate one it is for further study with the clone of source of infection probe selective binding.The carrier of selection is identified as λ gt10-1.1, as shown in Figure 1.The ET-NANB of example 3 is sequentially
The λ gt10-1.1 clones of example 2 are digested to discharge heterologous slotting section with EcoRI, and section is inserted by separating this in carrier segments by gel electrophoresis.The electrophoretic mobility of the fragment is consistent with 1.33kb fragments.This fragment for containing EcoRI ends is inserted to the EcoRI sites of pTZ-KF1 carriers, the structure and property of the carrier are recorded in have jointly 125 submitted on November 25th, 1987, in No. 650 U.S. Patent applications, entitled " cloning vector system and method that differentiate rare clone ".In brief, as shown in figure 1, this plasmid contains the single EcoRI sites of adjacent T7 polymerase promoter sites, and plasmid and phage replication origin.The order for being tightly adjacent to EcoRI sites both sides is known.With BB4 plants of colibacillus of this plasmid conversion (deriving from Stratagene, La Jolla, CA).
Radiolabeled ET-NANB probes are prepared as described above, i.e., cut 1.33kb from the λ gt101.1 bacteriophages of example 2 and insert section, the fragment is separated by gel electrophoresis, and carry out random labelling.Method according to example 2, by duplicating and hybridizing with radiolabeled ET-NANB probes, selects the bacterium for inserting section after being transfected with above-mentioned pTZ-KF1 containing required ET-NANB.
The order that a part of 1.33kb inserts section is determined with the bacteria colonies for containing successfully recombinant.This name has been deposited in American Type culture collection center for pTZ-KF1 (ET1.1) isolate, and preserving number is CCTCCM89041.Using the primer of the double deoxidation sequential determination of standard, and the order in adjacent EcoRI sites, about 200-250bp order has been obtained by the 5 ' end regions and 3 ' end regions of inserting section.This is given in above-mentioned section II sequentially.The complete sequence of both direction is then determined with same technology, this is above also given sequentially.The detection of the ET-NANB orders of example 4
CDNA fragment mixtures are prepared by the bile of non-infection and ET-NANB the dog monkey infected as described above.The cDNA fragments obtained by human faecal mass sample are for example following to be prepared.30ml derives from 10% stool suspension (individual be diagnosed as the outburst due to ET-NANB and infected with ET-NANB) of Mexico individual, and the excrement for deriving from non-infection healthy individuals of same volume, it is layered on 30% sucrose density gradient pad, centrifuged 6 hours with 25,000xg in 15 DEG C in SW27 rotors.27-34nm VLP particles containing tool ET-NANB infection characteristics in sediment from source of infection excrement.For infection and non-infection sample, RNA all is isolated from saccharose gradient precipitation, and as described in Example 1, cDNA fragments are produced with the RNA of separation.
Have jointly 07/208 submitted according on June 17th, 1988, method described in No. 512 patent applications (entitled " DNA cloning and subtracting techniques "), makes the bile source of infection and non-infection and the cDNA fragments mixture in the human faecal mass source of infection and non-infection all be expanded by new manual splice/primer replica method.In brief, the fragment of every kind of sample DNA polymerase i blunt end, then extracts and uses ethanol precipitation with phenol/chloroform.Blunt fragment is connected with the manual splice with following orders：
5′-GGAATTCGCGGCCGCTCG-3′
3′-TTCCTTAAGCGCCGGCGAGC-5′
Double-stranded segment is digested with NruI to remove the dimer of manual splice, is mixed with order for 5 '-GGAATTCGCGGCCGCTCG-3 ' primer, then heat denatured, is cooled to room temperature to form single stranded DNA/primer complex.Thermus aquaticus (Ther musaquaticus, Taq) polymerase and all four deoxynucleotides are added, makes compound replicate to form double-stranded segment.Reproduction process is set to repeat 25 times, including the denaturation of continuous chain, the formation and duplication of chain/primer complex.
Using 2% agarose matrix, the cDNA of amplification is separated sequentially by agarose gel electrophoresis.DNA fragmentation is transferred on nitrocellulose filter by Ago-Gel, filter membrane is hybridized with the random labeled 32p probes such as following preparations：(i) fragment of above-mentioned pTZ-KF1 (ET1.1) plasmid, the 1.33kb ET-NANB fragments that (ii) separation is discharged, and the separation of (iii) random labelling is handled with EcoRI.Probe hybridization is carried out according to conventional Southern blot hybridizations (Maniatis, p.382-389).Fig. 2 shows (I) with infection and (N) bile source (2A) of non-infection, and the hybridization pattern obtained with the cDNA in (I) and non-infection that infect (N) human faecal mass source (2B).It can be seen that ET-NANB probes hybridize with the fragment obtained by two kinds of sources of infection, but do not have homology with the order that is obtained by two kinds of non-infection genesis, it is therefore evident that the selectivity of produced order.
The Southern blot hybridizations of radiolabeled 1.33kb fragments and the genomic DNA fragment from people and dog monkey DNA are also carried out.Probe is not observed with any genomic fragment mixture to hybridize, it was demonstrated that ET-NANB orders are all external sources for people and monkey genome.The preparation of the expression A.ET-NANB coded sequences of the ET-NANB albumen of example 5
PTZ-KF1 (ET1.1) plasmid in example 2 is digested with EcoRI, inserts section with the ET-NANB for discharging 1.33kb, this fragment is purified by gel electrophoresis from the plasmid of linearisation.Purified fragments are suspended in standard digestion buffer solution (0.5M Tris-HCl, pH7.5 with about 1mg/ml concentration；1mg/ml BSA；10mM MnCl2), digested at room temperature about 5 minutes with DNA enzymatic I.These reaction conditions are determined by demarcation before this, in this research, it is determined that the main soaking time produced required for 100-300bp fragments.Digestive juice is extracted with phenol/chloroform, ethanol precipitation is then carried out.
Make the fragment blunt end in digestion mixture, and be connected as described in Example 1 with EcoRI manual splicies.The fragment of generation is analyzed by 1.2% agarose gel electrophoresis (5-10V/cm), and big tick marks are used as by the use of PhiX174/Hae III and λ/Hind III.100-300bp components are eluted on NA45 bars (Schleicher and Schu-ell), are subsequently placed in the 1.5ml micro-pipes equipped with eluent (1M NaCl, 50mM arginine, pH9.0), 30-60 minutes are incubated in 67 DEG C.The DNA of elution is extracted with phenol/chloroform, then with the ethanol precipitation of two volumes.Precipitation is resuspended in 20 μ l TE (0.01M Tris-HCl, pH7.5,0.001M EDTA).B. it is cloned in expression vector
λ gt11 phage vectors (Huynh) derive from Promega Biotec (Madison, WI).This cloning vector has a single EcoRI cloning site at the base-pair of beta galactosidase translation stop codon upstream 53.Imported from above-mentioned genomic fragment in this EcoRI site, the gt11 that i.e. mixing 0.5-1.0 μ g EcoRI are cut, the fragment of the above-mentioned sizes of 0.3-3 μ l, 0.5 μ l 10x connection buffer solutions (above-mentioned), 0.5 μ l ligases (200 unit), and add distilled water to 5 μ l.Then mixture carries out in vitro package in 14 DEG C of incubated overnights according to standard method (Maniatis, p.256-268).
With packaged KM392 plants of phage-infect colibacillus (deriving from Dr.KevinMoore, DNAX, Palo Alto, CA).In addition, it is possible to use be available from Y1090 plants of the Escherichia coli (ATCC 37197) that American Type culture collects center.The bacterium of infection is cultivated, using the X-gal substrate plaque detection methods (Maniatis) of standard, the forfeiture (clear plaque) of betagalactosidase activity is checked in the presence of Xgal in the colony of generation.About 50% bacteriophage plaque shows the forfeiture (recombinant) of betagalactosidase activity.The screening of C.ET-NANB recombinant proteins
ET-NANB convalescence antiserums are derived from such patient, and they had infection history in the ET-NANB burst periods that Mexico, Borneo, Pakistan, Somalia and Burma record.Serum has the immunocompetence for being directed to VLP in fecal specimens, and these samples are from some other patients with ET-NANB hepatitis.
With about 104The above-mentioned bacteriophage reserve infection colibacillus KM392 cells of pfu, and 5-8 hours are incubated in 37 DEG C of upsets on 150mm flat boards, so that lawn is made.By nitrocellulose filter pin on lawn, the ET-NANB recombinant proteins of expression are made to be transferred to by plaque on filter membrane.Flat board and filter membrane are marked, corresponding flat board and filter membrane position is matched.
Filter membrane (10mM Tris pH8.0 in TBST buffer solutions, 105mMNaCl, 0.05% Tween 20) wash 2 times, closed with AIB (TBST buffer solutions add 1% gelatin), washed again with TBST, add antiserum (1: 50,12-15ml/ flat boards are diluted to AIB) incubated overnight afterwards.Filter membrane is washed 2 times in TBST, is then allowed to contact with the anti-human antibody that enzyme is marked, labelled antibody is attached on the filter membrane site containing the antigen that can be recognized with antiserum.After the final washing, filter membrane (100mM Tris pH9.5,100mM NaCl, 5mMMgCl in 5ml alkaline phosphatase esterase buffer solutions2), developed the color in the substrates containing 33 μ l NBT (50mg/ml storing solutions are maintained at 5 DEG C) and 16 μ l BCIP (50mg/ml storing solutions are maintained at 5 DEG C).Due to sero-fast identification, there is purple in the site for producing antigen.D. screening and culturing
The region of generation antigen is determined in previous step, is cultivated with about 100-200pfu on 82mm flat boards.The step of being developed the color repeating to be incubated by 5-8 hours above to NBT-BCIP, with bacteriophage that can be with the antigen of ET-NANB antibody responses by Plaque-purified secretion.Choose the plaque identified, be eluted in bacteriophage buffer solution (Maniatis, p.443).E. the discriminating of antigenic determinant
Using technology same as described above, a series of subclones produced by originally pTZ-KF1 (ET1.1) plasmid of example 2 are separated.In this 5 are subcloned, each with for the sero-fast immunocompetences of anti-ET in C.Subclone contains the short order come from " reverse " order listed hereinbefore.It shown below is the starting and ending site of subclone order (relative to complete " reverse " order).
Table 1 is subcloned the position in " reverse " order
Hold at 5 ' ends 3 '
Y1                522             643
Y2                594             667
Y3                508             665
Y4                558             752
Y5                545             665
Due to all gene orders for being provided in table all must the coded sequence containing antigenic determinant, then it will be apparent that the coded sequence of antigenic determinant falls in the region between nucleotides 594 (5 ' end) and 643 (3 ' hold).Therefore, shorter order is equivalent on the other hand and complementary gene order is particularly preferred aspect of the present invention, and the peptide produced with this code area is also such.
The second series clone of entirely different antigenic determinant is identified only by being separated in the serum of Mexican.
Table 2 is subcloned the position in " forward direction " order
Hold the 109ET13-1 2 101 of 2 193ET8-3 of ET2-2,2 135ET9-1 2 in 5 ' ends 3 '
The coded system of this antigenic determinant falls between nucleotides 2 (5 ' end) and 101 (3 ' ends).Therefore it is also preferred that with this short order dependent gene order, with this code area produce peptide be also such.
Although describing the present invention with reference to specific embodiment, method, structure and purposes, without deviating from the invention, those skilled in the art obviously can be variously modified and modify.

Claims (4)

1. a kind of prepare the method for protein produced by Enterically transmitted non-A/non-B hepatitis viral agent, the genome of the factor contains one and inserts the homologous region of section with the EcoRI of 1.33kb DNA in plasmid pTZ-KF1 (ET1.1), and it is CCTCCNo that the plasmid, which is taken in preserving number,：In M89041 BB4 plants of Escherichia coli, methods described includes：
(a) DNA fragmentation of code for said proteins is inserted in appropriate expression vector, generates recombinant vector；
(b) recombinant vector is imported in appropriate host cell；
(c) host cell is cultivated under conditions of the protein can be effectively produced in host cell；
(d) protein is purified from host cell.
2. the code area coding in section is inserted by the 1.33kb DNA EcoRI the method for claim 1 wherein protein.
3. the method for claim 1 wherein the genome contains one with having the first order：1, , , 11, , 21, , 31, , 41, , 51*, , , *, , , *, , , *, , , *, , , * CGAATTCCGCCAACTGATGGAAGGCACTAATCTGGCAAGACCTGTCCCTGTTGCAG CTGT61, , 71, , 81, , 91, , 101, , 111*, , , *, , , *, , , *, , , *, , , * TCTACCACCCTGCCCCGAGCTCGAACAGGGCCTTCTCTACCTGCCCCAGGAGCTCA CCAC121, , 131, , 141, , 151, , 161, , 171*, , , *, , , *, , , *, , , *, , , * CTGTGATAGTGTCGTAACATTTGAATTAACAGACATTGTGCACTGCCGCATGGCCG CCCC181, , 191, , 201, , 211, , 221, , 231*, , , *, , , *, , , *, , , *, , , * GAGCCAGCGCAAGGCCGTGCTGTCCACACTCGTGGGCCGCTACGGCGTCGCACAAA GCTC241, , 251, , 261, , 271, , 281, , 291*, , , *, , , *, , , *, , , *, , , * TACAATGCTTCCCACTCTGATGTTCGCGACTCTCTCGCCCGTTTTATCCCGGCCAT TGGC301, , 311, , 321, , 331, , 341, , 351*, , , *, , , *, , , *, , , *, , , * CCCGTACAGGTTACAACTTGTGAATTGTACGAGCTAGTGGAGGCCATGGTCGAGAA GGGC361, , 371, , 381, , 391, , 401, , 411, *, , *, , , *, , , *, , , *, , , * CAGGATGGCTCCGCCGTCCTTGAGCTTGATCTTTGCAACCGTGACGTGTCCAGGAT CACC421, , 431, , 441, , 451, , 461, , 471*, , , *, , , *, , , *, , , *, , , * TTCTTCCAGAAAGATTGTAACAAGTTCACCACAGGTGAGACCATTGCCCATGGTAA AGTG481, , 491, , 501, , 511, , 521, , 531*, , , *, , , *, , , *, , , *, , , * GGCCAGGGCATCTCGGCCTGGAGCAAGACCTTCTGCGCCCTCTTTGGCCCTTGGTT CCGC541, , 551, , 561, , 571, , 581, , 591*, , , *, , , *, , , *, , , *, , , * GCTATTGAGAAGGCTATTCTGGCCCTGCTCCCTCAGGGTGTGTTTTACGGTGATGC CTTT601, , 611, , 621, , 631, , 641, , 651*, , , *, , , *, , , *, , , *, , , * GATGACACCGTCTTCTCGGCGGCTGTGGCCGCAGCAAAGGCATCCATGGTGTTTGA GAAT661, , 671, , 681, , 691, , 701, , 711*, , , *, , , *, , , *, , , *, , , * GACTTTTCTGAGTTTGACTCCACCCAGAATAACTTTTCTCTGGGTCTAGAGTGTGC TATT721, , 731, , 741, , 751, , 761, , 771*, , , *, , , *, , , *, , , *, , , * ATGGAGGAGTGTGGGATGCCGCAGTGGCTCATCCGCCTGTATCACCTTATAAGGTC TGCG781, , 791, , 801, , 811, , 821, , 831*, , , *, , , *, , , *, , , *, , , * TGGATCTTGCAGGCCCCGAAGGAGTCTCTGCGAGGGTTTTGGAAGAAACACTCCGG TGAG841, , 851, , 861, , 871, , 881, , 891*, , , *, , , *, , , *, , , *, , , * CCCGGCACTCTTCTATGGAATACTGTCTGGAATATGGCCGTTATTACCCACTGTTA TGAC901, , 911, , 921, , 931, , 941, , 951*, , , *, , , *, , , *, , , *, , , * TTCCGCGATTTTCAGGTGGCTGCCTTTAAAGGTGATGATTCGATAGTGCTTTGCAG TGAG961, , 971, , 981, , 991, , 1001, , 1011, *, , *, , , *, , , *, , , *, , , * TATCGTCAGAGTCCAGGAGCTGCTGTCCTGATCGCCGGCTGTGGCTTGAAGTTGAA GGTA1021, , 1031, , 1041, , 1051, , 1061, , 1071*, , , *, , , *, , , *, , , *, , , * GATTTCCGCCCGATCGGTTTGTATGCAGGTGTTGTGGTGGCCCCCGGCCTTGGCGC GCTC1081, , 1091, , 1101, , 1111, , 1121, , 1131*, , , *, , , *, , , *, , , *, , , * CCTGATGTTGTGCGCTTCGCCGGCCGGCTTACCGAGAAGAATTGGGGCCCTGGCCC TGAG1141, , 1151, , 1161, , 1171, , 1181, , 1191*, , , *, , , *, , , *, , , *, , , * CGGGCGGAGCAGCTCCGCCTCGCTGTTAGTGATTTCCTCCGCAAGCTCACGAATGT AGCT1201, , 1211, , 1221, , 1231, , 1241, , 1251*, , , *, , , *, , , *, , , *, , , * CAGATGTGTGTGGATGTTGTTTCCCGTGTTTATGGGGTTTCCCCTGGACTCGTTCA TAAC1261, , 1271, , 1281, , 1291, , 1301, , 1311*, , , *, , , *, , , *, , , *, , , * CTGATTGGCATGCTACAGGCTGTTGCTGATGGCAAGGCACATTTCACTGAGTCAGT AAAA1321, , 1331, , 1341*, , , *, , , * CCAGTGCTCGACCGGAATTCGAGC or second order 1, , , 11, , 21, , , 31, , 41, , 51*, , , *, , , *, , , *, , *, , , * GCTCGAATTCCGGTCGAGCACTGGTTTTACTGACTCAGTGAAATGTGCCTTGCCAT CAGC61, , 71, , 81, , , 91, , 101, , 111*, , , *, , , *, , , *, , *, , , * AACAGCCTGTAGCATGCCAATCAGGTTATGAACGAGTCCAGGGGAAACCCCATAAA CACG121, , 131, , 141, , 151, , 161, , 171*, , , *, , , *, , , *, , *, , , * GGAAACAACATCCACACACATCTGAGCTACATTCGTGAGCTTGCGGAGGAAATCAC TAAC181, , 191, , 201, , 211, , 221, , 231*, , , *, , , *, , , *, , *, , , * AGCGAGGCGGAGCTGCTCCGCCCGCTCAGGGCCAGGGCCCCAATTCTTCTCGGTAA GCCG241, , 251, , 261, , 271, , 281, , 291*, , , *, , , *, , , *, , *, , , * GCCGGCGAAGCGCACAACATCAGGGAGCGCGCCAAGGCCGGGGGCCACCACAACAC CTGC301, , 311, , 321, , 331, , 341, , 351*, , , *, , , *, , , *, , *, , , * ATACAAACCGATCGGGCGGAAATCTACCTTCAACTTCAAGCCACAGCCGGCGATCA GGAC361, , 371, , 381, , 391, , 401, , 411*, , , *, , , *, , , *, , *, , , * AGCAGCTCCTGGACTCTGACGATACTCACTGCAAAGCACTATCGAATCATCACCTT TAAA421, , 431, , 441, , 451, , 461, , 471*, , , *, , , *, , , *, , , *, , , * GGCAGCCACCTGAAAATCGCGGAAGTCATAACAGTGGGTAATAACGGCCATATTCC AGAC481, , 491, , 501, , 511, , 521, , 531*, , , *, , , *, , , *, , , *, , , * AGTATTCCATAGAAGAGTGCCGGGCTCACCGGAGTGTTTCTTCCAAAACCCTCGCA GAGA541, , 551, , 561, , 571, , 581, , 591*, , , *, , , *, , , *, , , *, , , * CTCCTTCGGGGCCTGCAAGATCCACGCAGACCTTATAAGGTGATACAGGCGGATGA GCCA601, , 611, , 621, , 631, , 641, , 651*, , , *, , , *, , , *, , , *, , , * CTGCGGCATCCCACACTCCTCCATAATAGCACACTCTAGACCCAGAGAAAAGTTAT TCTG661, , 671, , 681, , 691, , 701, , 711*, , , *, , , *, , , *, , , *, , , * GGTGGAGTCAAACTCAGAAAAGTCATTCTCAAACACCATGGATGCCTTTGCTGCGG CCAC721, , 731, , 741, , 751, , 761, , 771*, , , *, , , *, , , *, , , *, , , * AGCCGCCGAGAAGACGGTGTCATCAAAGGCATCACCGTAAAACACACCCTGAGGGA GCAG781, , 791, , 801, , 811, , 821, , 831*, , , *, , , *, , , *, , , *, , , * GGCCAGAATAGCCTTCTCAATAGCGCGGAACCAAGGGCCAAAGAGGGCGCAGAAGG TCTT841, , 851, , 861, , 871, , 881, , 891*, , , *, , , *, , , *, , , *, , , * GCTCCAGGCCGAGATGCCCTGGCCCACTTTACCATGGGCAATGGTCTCACCTGTGG TGAA901, , 911, , 921, , 931, , 941, , 951*, , , *, , , *, , , *, , , *, , , * CTTGTTACAATCTTTCTGGAAGAAGGTGATCCTGGACACGTCACGGTTGCAAAGAT CAAG961, , 971, , 981, , 991, , 1001, , 1011*, , , *, , , *, , , *, , , *, , , * CTCAAGGACGGCGGAGCCATCCTGGCCCTTCTCGACCATGGCCTCCACTAGCTCGT ACAA1021, , 1031, , 1041, , 1051, , 1061, , 1071*, , , *, , , *, , , *, , , *, , , * TTCACAAGTTGTAACCTGTACGGGGCCAATGGCCGGGATAAAACGGGCGAGAGAGT CGCG1081, , 1091, , 1101, , 1111, , 1121, , 1131*, , , *, , , *, , , *, , , *, , , * AACATCAGAGTGGGAAGCATTGTAGAGCTTTGTGCGACGCCGTAGCGGCCCACGAG TGTG1141, , 1151, , 1161, , 1171, , 1181, , 1191*, , , *, , , *, , , *, , , *, , , * GACAGCACGGCCTTGCGCTGGCTCGGGGCGGCCATGCGGCAGTGCACAATGTCTGT TAAT1201, , 1211, , 1221, , 1231, , 1241, , 1251*, , , *, , , *, , , *, , , *, , , * TCAAATGTTACGACACTATCACAGGTGGTGAGCTCCTGGGGCAGGTAGAGAAGGCC CTGT1261, , 1271, , 1281, , 1291, , 1301, , 1311*, , , *, , , *, , , *, , , *, , , * TCGAGCTCGGGGCAGGGTGGTAGAACAGCTGCAACAGGGACAGGTCTTGCCAGATT AGTG1321, , 1331, , 1341*, , , *, , , * CCTTCCATCAGTTGGCGGAATTCG. or the 3rd order CGGTTGTTCAGTACCAGTTTACTGCAGGTGTGCCTGGATCCGGCAAGTCCCGCTCT ATCACCCAAGCCGATGTGGACGTTGTCGTGGTCCCGACGCGTGA, , 100GTTGCGTAATGCCTGGCGCCGTCGCGGCTTTGCTGCTTTTACCCCGCATACTG CCGCCAGAGTCACCCAGGGGCGCCGGGTTGTCATTGATGAGGCTCCA, , 200TCCCTCCCCCCTCACCTGCTGCTGCTCCACATGCAGCGGGCCGCCACCGTCCA CCTTCTTGGCGCCCCGAACCAGATCCCAGCCATCGACTTTGAGCACG, , 300CTGGGCTCGTCCCCGCCATCAGGCCCGACTTAGCCCCACCTCCTGGTGGCATG TTACCCATCGCTGCCTGCGGATGTATGCGAGCTCATCCGTGGTGCAT, , 400ACCCCATGATCCAGACCACTAGCCGGGTTCTCCGTTCGTTGTTCTGGGGTGAG CCTGCCGTCGGGCAGAAACTAGTGTTCACCCAGGCGGCCAAGCCCGC, , 500CAACCCCGGCTCAGTGACGGTCCACGAGGCGCAGGGCGCTACCTACACGGAGA CCACTATTATTGCCACAGCAGATGCCCGGGGCCTTATTCAGTCGTCT, , 600CGGGCTCATGCCATTGTTGCTCTGACGCGCCACACTGAGAAGTGCGTCATCAT TGACGCACCAGGCCTGCTTCGCGAGGTGGGCATCTCCGATGCAATCG, , 700TTAATAACTTTTTCCTCGCTGGTGGCGAAATTGGTCACCAGCGCCCATCAGTT ATTCCCCGTGGCAACCCTGACGCCAATGTTGACACCCTGGCTGCCTT, , 800CCCGCCGTCTTGCCAGATTAGTGCCTTCCATCAGTTGGCTGAGGAGCTTGGCC ACAGACCTGTCCCTGTTGCAGCTGTTCTACCACCCTGCCCCGAGCTC, , 900GAACAGGGCCTTCTCTACCTGCCCCAGGAGCTCACACCACCTGTGATAGTGTC GTAACATTTGAATTAACAGACATTGTGCACTGCCGCATGGCCGCCCC, 1000GAGCCAGCGCAAGGCCGTGCTGTCCACACTCGTGGGCCGCTACGGCGTCGCA CAAAGCTCTACAATGCTTCCCACTCTGATGTTCGCGACTCTCTCATCC, 1100CCGGATTGGCCCGGATTGGCCCCGTACAGGTTACAACTTGTGAATTGTACGA GCTAGTGGAGGCCATGGTCGAGAAGGGCCAGGATCTGCCGCCGTCCTT, 1200GAGCTTGATCTTTGCAACCGTGACGTGTCCAGGATCACCTTCTTCCAGAAAG ATTGTAACAAGTTCACCACAGGTGAGACCATTGCCCATGGTAAAGTGG, 1300GCCAGGGCATCTCGGCCTGGAGCAAGACCTTCTGCGCCCTCTTTGGCCCTTG GTTCCGCGCTATTGAGAAGGCTATTCTGGCCCTGCTCCCTCAGGGTGT, 1400GTTTTACGGTGATGCCTTTGATGACACCGTCTTCTCGGCGGCTGTCGAGGCC AAAGGCATCCATGGTGTTTGAGAATGACTTTTCTGAGTTTGACTCCAC, 1500CCAGAATAACTTTTCTCTGGGTCTAGAGTGTGCTATTATGGAGGAGTGTCGG GATGCCGCAGTGGCTCATCCGCCTGTATCACCTTATAAGGTCTGCGTG, 1600GATCTTGCAGGCCCCGAAGGAGTCTCTGCGAGGGTTTTGGAAGAAACACTCC GGTGAGCCCGGCACTCTTCTATGGAATACTGTCTGGAATATGGCCGTT, 1700ATTACCCACTGTTATGACTTCCGCGATTTTCAGGTGGCTGCCTTTAAAGGTG ATGATTCGATAGTGCTTTGCAGTGAGTATCGTCAGAGTCCAGGAGCTG, 1800CTGTCCTGATCGCCGGCTGTGGCTTGAAGTTGAAGGTAGATTTCCGCCCGAT CGGTTTGTATGCAGGTGTTGTGGTGGCCCCCGGCCTTGGCGCGCTCCC, 1900TGATGTTGTGCCGTTCGCCGGCCGGCTTACCGAGAAGAATTGGCCCTGGCCT GAGCGGCGAAGACACGTGCGCTCGCTGTTGTTAGTGATTTCCTCCGCA, 2000AGCTCACGAATGTAGCTCAGAGTGTGTGGATGTTGTTTCCCGTGTTTATGGG GTTTCCCCTGGACTCGTTCATAACCTGATTGGCATGCTACAGGCTGTT, 2100GCTGATGGCAAGGCACATTTCACTGAGTCAGTAAAACCAGTGCTCGACTTGA CAAATTCAATCTTGTGTCGGGTGGAATGAATAACATGTCTTTTGCTGC, 2200GCCCATGGGTTCGCGACCATGCCCCTCGGCCTATTTTGTTGCTGCTCCTCAT GTTTTTGCCTATGCTGCCCGCGCCACCGCCCCGTCAGCCGTCTGGCCG, 2300CCGTCGTGGGCGGCGCAGCGGCGGTTCCGGCGGTGGTTTCTGGGGTGACCGG GTTGATTCTCAGCCCTTCGCAATCCCCTATATTCATCCAACCAACCCC, 2400TTCGCCCCCGATGTCACCGCTGCGGCCGGGGCTGGACCTCGTGTTCGCCAAC CCGCCCGACCACTCGGCTCCGCTTGGCGTGACCAGGCCCAGCGCCCCG, 2500CCGTTGCCTCACGTCGTAGACCGACCACAGCTGGGGCCGCGCCGCTAACCGC GGTCGCTCCGGCCCCG, , , , , , , , , 2568 or the 4th order GCGGCCGCTCGGCAAAAGAGGCCTAGGGCGCATGGTGGCGAACCCATGGGCGCACG AAACCACATGTTATTCATTCAGACCGGTGCATAATTGAGTGTGT, 100AAGGTCAAGTATAGGCTTAACAGACTCTGTAAAATGCGCCTTACCATCACCAA TAGTCTGGAGCATGCCTATCAGGTTATGAACCAGACCCGGGGAAACC, 200CCGTAAACTCTAGACACCACCTCAACACAAATCTGGGCCACATTCGTTAACCT ACGGAGGAAATCCTGCACGGCGAGGCGGACGTGCTCTGCCCGCTCCG, 300GATCAGGCCCCCAGTTCTTCTCCGAAAGCCGTCCGGCGAATCGAACGACATCG GGTAGGGCCCCGAGCCCGGGGCGACGACAACCCCGGCATACAGCCCA, 400ATCGGCCGGAAGTCAGCCTTCAACTTCGGGCCACAGCCTGCTATAAGCGAACC GGCGCCTGGGCTCTGGCGGTATTCACTACAGAAAGGAACCGACCGAG, 500TCGTCGCCCTTGAAGGCGGCAACCTGGAGGTCCCGGAACTCATAGCAATGGGC AATGATTGCCATGTTCCACACCGTATTCCAGAGCAACGTGCCCGGCT, 600CACCAGAATGCTTCTTCCAGAACCCTCTCAAAGACTCTTTTGGGGCCTGCAGG GATCCACGCCGACCGGACGGCATGGTACAACCTGACAAGCCACTGGG, 700GCATACCACACTCTTCCATAATGGCGCACTCAAGACCTAGGGAAAAGTTATTC TGAGTCGAGTCAAACTCAGAAAAATCATTTTCAAACACCATGGCATG, 800GCTGGCGCCAGCCACGGCAGCAGAGAATACTGAGTCGTCATAAGCATCCCCGT AGAACACAGCTTGTGGTAAAAGGGATAGAATAGCCTTCTCAATCGCA, 900CGGAACCAGGGGCCAAACAGGGCACAAAAGGTCTTACTCCAGGCGGAGATACC CTGACCGACTTTGCCATGCGCAATTGTCTCGCCGGTCGTGAACTTGT, 1000TACAATCCTTCTGGAAAAAGGTTATGCGGGAGACATCTCGGCTGCACAAATC CAACTCGAGGACGGCTGAACCGTCTTGGCCCTTCTCCACCATCGCCTC, 1100TACAAGCTCAAAGAGTTCACAGGTGGTGGCAGTAACCCGCCGAGAGTGGGAA TAAAGCGCGCAAGGGAGGCGCGGACATCGGTGTGACCCGCATCATAAA, 1200GCCTTGTGCGTCTGCCATACCGGCCTACCAGCATGACAAAACAGCTTTCCTT TGGCTAGGGGCCGCCATGGGCCTGACAACTGTCAGTTAGCTCAAATGT, 1300CACA, , , , , , , , , , , , , the homologous region of 1304 double-stranded DNA.
4. the method for claim 1 wherein the protein has the immunocompetence to being present in the antibody in the individual of Enterically transmitted non-A/non-B hepatitis viral agent infection.
CN 89104064 1988-06-17 1989-06-16 Enterically transmitted non-A/non-B hepatitis viral agent Expired - Lifetime CN1048523C (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US20899788A 1988-06-17 1988-06-17
US208,997 1988-06-17

Related Child Applications (1)

Application Number Title Priority Date Filing Date
CNB991083075A Division CN1155407C (en) 1988-06-17 1999-06-02 Method for preparing intestinal transmitted non-A and non-B hepatitis vaccine

Publications (2)

Publication Number Publication Date
CN1044955A CN1044955A (en) 1990-08-29
CN1048523C true CN1048523C (en) 2000-01-19

Family

ID=22776916

Family Applications (2)

Application Number Title Priority Date Filing Date
CN 89104064 Expired - Lifetime CN1048523C (en) 1988-06-17 1989-06-16 Enterically transmitted non-A/non-B hepatitis viral agent
CNB991083075A Expired - Lifetime CN1155407C (en) 1988-06-17 1999-06-02 Method for preparing intestinal transmitted non-A and non-B hepatitis vaccine

Family Applications After (1)

Application Number Title Priority Date Filing Date
CNB991083075A Expired - Lifetime CN1155407C (en) 1988-06-17 1999-06-02 Method for preparing intestinal transmitted non-A and non-B hepatitis vaccine

Country Status (1)

Country Link
CN (2) CN1048523C (en)

Also Published As

Publication number Publication date
CN1155407C (en) 2004-06-30
CN1245721A (en) 2000-03-01
CN1044955A (en) 1990-08-29

Similar Documents

Publication Publication Date Title
EP0217919B1 (en) Type-specific papillomavirus dna sequences and peptides
KR0185373B1 (en) Nanbv diagnostics and vaccines
JP2810004B2 (en) Hepatitis δ diagnostics and vaccines
JP2007031440A (en) Enterically transmitted non-a non-b hepatitis viral factor
CN1041005A (en) Post-transfusion, on-A, non-B hepatitis virus and antigen
KR0178399B1 (en) Enterically transmitted non-a/non-b hepatitis viral agent and characteristic epitopes thereof
US6395472B1 (en) Methods of utilizing the TT virus
JP2001269185A (en) Hepatitis c virus epitope
US5218099A (en) Post-transfusion, non-A, non-B hepatitis virus polynucleotides
JP2006036795A (en) Hepatitis e virus vaccine and its inoculation method
WO2003021221A2 (en) Method for discovering new infectious particles
CN1048523C (en) Enterically transmitted non-A/non-B hepatitis viral agent
US5789559A (en) DNA sequences of enterically transmitted non-A/non-B hepatitis viral agent
Contag et al. Correlation between presence of lactate dehydrogenase-elevating virus RNA and antigens in motor neurons and paralysis in infected C58 mice
US5824649A (en) DNA sequences of enterically transmitted non-A/non-B hepatitis viral agent and characteristic epitopes thereof
JP2003516136A (en) Hepatitis virus sentinel virus I (SVI)
JPS58500389A (en) A method for preparing a hybrid DNA containing a complementary hepatitis A virus genome, the hybrid DNA, a plasmid vector containing the same, a virus-specific protein expressed by the hybrid DNA, and a vaccine prepared therefrom and containing the same.
EP1010759B1 (en) Non-b non-c non-g hepatitis virus gene, polynucleotide, polypeptide, virion, method for separating virion, and method for detecting virus
CN1117150C (en) Epstein-barr virus dna sequences encoding diagnostically relevant virus capid antigen, expression clones derived through polymerase chain reaction and the use of this recombinant antigen in diagnostic
CN1440456A (en) sentinel virus II
KR100187483B1 (en) Hcv polynucleotides and uses thereof
US6620913B1 (en) Polypeptides of a novel hantavirus

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C15 Extension of patent right duration from 15 to 20 years for appl. with date before 31.12.1992 and still valid on 11.12.2001 (patent law change 1993)
OR01 Other related matters
C17 Cessation of patent right
CX01 Expiry of patent term