CN104846109B - Molecular marker with cotton verticillium wilt functional gene and application of molecular marker - Google Patents

Abstract

The invention provides a molecular marker with a cotton verticillium wilt functional gene and an application of the molecular marker, and belongs to the field of molecular genetic breeding of crops. A surface receptor protein gene free of an intact reading frame is obtained through BAC (bacterial artificial chromosome) sequencing; nine gene specificity primers are designed by employing the position, which is different from other known gene sequences with verticillium wilt resistance, of the gene; the nine gene specificity primers are used for amplifying DNA (deoxyribonucleic acid) of a verticillium wilt-resistant and susceptible material; a segment with the length of 1549bp is amplified by only one pair of primers Gbvds1549 in all susceptible materials; a nucleotide sequence is as shown in SEQ ID NO.1, but no amplified product exists in a disease-resistant material; and meanwhile, a method of a functional molecular marker is developed on the basis. Through detection of the functional molecular marker, the verticillium wilt resistance of different cotton varieties or materials can be accurately detected; the molecular marker can be applied to screening of hybrid transforming offspring plants of cotton; the breeding efficiency is improved; the breeding and screening cost is significantly reduced; and the materials with relatively good verticillium wilt resistance can be obtained.

Description

A kind of molecular labeling of cotton verticillium wilt functional gene and its application

First, technical field

The invention provides a kind of molecular labeling of cotton verticillium wilt functional gene and its application, belong to crops molecule something lost Pass thremmatology field.The anti-sense material of verticillium wilt can be accurately detected, can be applicable to screen cotton hybrid introgressive line plant, be belonged to Biological technical field.

2nd, background technology

Cotton verticillium wilt is soil-borne disease, and flower bud, bell can be caused to come off in a large number, and when falling ill serious polished rod is come off into, or even Death, makes cotton underproduction 20-60%, is the main disease of China's Cotton Production.Up to the present, there is no effectively preventing medicine Agent, can only rely on plantation disease-resistant variety based on comprehensive preventive health measures (simple osmanthus is good, Zou Yafei, Ma Cun. cotton verticillium wilt flows year after year The reason for row and countermeasure. Cotton, 2003,30:13-14；Zhang Baolong, holds good, the Yang Yuwen of letter. verticillium wilt resistance of cotton by same study into Exhibition .2012, Scientia Agricultura Sinica technology publishing house).But because verticillium wilt pathogenesis are complicated and cotton key resistance resource master In there are the Wild ornamental resources such as Asiatic cotton and sea island cotton, to Disease Resistance Identification and breed breeding great obstacle is caused.Hold It is easily caused progeny material and selects inaccurate, improved variety resistance is unstable, and the merit such as yield, fiber is difficult to be polymerized, seed selection The problems such as inefficiency.Therefore, the molecular labeling with resistance to verticillium wilt close linkage is excavated, it is auxiliary using effectively reliability molecular labeling Help breeding to accelerate breeding process, improve efficiency of selection.

With the development of cotton molecular marking technique, the structure of cotton high density genetic linkage mapses, obtain some with The chain selected marker that can be used for molecular mark of resisting verticillium.Currently with the hybrid Population of upland cotton, and Upland cotton and sea island cotton interspecific hybridization colony, have been obtained for the related QTL of more than 100 resistance to verticillium wilt, except the 6th, 10,12 It is external with 18 dyeing, these QTL be distributed on remaining all of chromosome (Bolek Y, El-Zik KM, Pepper AE, Bell AA,Magill CW,et al.Mapping of verticillium wilt resistance genes in cotton.Plant Sci,2005,168:1581–1590；Du WS,Du XM,Ma ZY(2004)Studies on SSR markers of resistance gene of Verticillium wilt in cotton.J Northwest Sci Tech UnivAgri and For,2004,3:20–24；Gao YQ,Nie YC,Zhang XL.QTL mapping of genes resistant to Verticillium wilt in cotton.Cotton Sci,2003,2:73–78；Fang H,Zhou HP,Sanogo S,Flynn R,Percy RG,et al.Quantitative trait locus mapping for Verticillium wilt resistance in a backcross inbred line population of cotton(Gossypiumhirsutum×Gossypiumbarbadense)based on RGA-AFLP analysis.Euphytica,2013,194:79–91；Wang HM,Lin ZX,Zhang XL,Chen W,Guo XP,et al.Mapping and quantitative trait loci analysis of Verticillium wilt resistance genes in cotton.J Integr Plant Biol,2008,2:174–182；Yang C,Guo WZ, Li GY,Gao F,Lin SS,et al.QTLs mapping for Verticillium wilt resistance at seedling and maturity stages in Gossypiumbarbadense L.Plant Sci,2008,174:290– 298；Zhen R,Wang XF,Ma ZY,Zhang GY,Wang X.A SSR marker linked with the gene of Verticillium wilt resistance in Gossypiumbarbadense.Cotton Sci,2006,5:269– 272；Jiang F,Zhao J,Zhuo L,Guo WZ,Zhang TZ.Molecular mapping of Verticillium wilt resistance QTL clustered on chromosomes D7 and D9 in upland cotton.Sci China Ser C(life Sci),2009,9:872–884；Ning ZY,Zhao R,Chen H,Ai NJ,Zhang X,et al.Molecular tagging of a major quantitative trait locus for broad-spectrum resistance to Verticillium wilt in upland cotton cultivar Prema.Crop Sci, 2013,53:2304–2312；Wang FR,Liu RZ,Wang LM,Zhang CY,Liu GD,et al.Molecular marker of Verticillium resistance in upland cotton(Gossypiumhirsutum L.) cultivar and their effects on assisted phenotypic selection.Cotton Sci,2007, 6:424–430；Yang C,Guo WZ,Zhang TZ.QTL mapping for resistance to Verticillium wilt,fiber quality and yield traits in upland cotton(Gossypiumhirsutum L).Mol Plant Breed,2007,5(6):797–805).These results of study show that cotton verticillium wilt resistance locus are positioned and verticillium wilt Bacterium fungus strain it is related to cotton growth period (Wang et al., 2008；Yang et al.,2008；Yang et al.,2007). Application of the molecular mark technology in terms of verticillium wilt resistance of cotton by same breeding is less, and main cause is verticillium wilt resistance of cotton by same machine Reason is complicated, and it is stable that polyploid hybridization causes characters of progenies to be difficult to, and disease resistance trait identification stability and repeatability are general, cause seed selection During easily occur that material is elected or superseded blindness is larger, and breeding parent and filial generation material qualification result it is inaccurate Really.

Functional label is the one kind developed according to the polymorphism motif for causing phenotypic character to make a variation inside functional gene New molecular marker.Because this kind of mark need not be verified further from intragenic functional motif, therefore this kind of mark The presence or absence of target alleles just can be determined under different genetic background.Have in application compared with conventional genetic is marked Bigger advantage.First, mark derives from target gene, isolates with it, it is possible to avoiding being produced because restructuring is exchanged Select Error, colony target gene detect when it is more efficient；Further, since functional gene mark is directly from gene The polymorphism motif of function is determined on site, once therefore functional label be developed, it is not necessary to by further checking just Can apply under various different genetic backgrounds；It is effective to biological engineering colony and natural population；Secondly as being source In gene internal, directly reflect objective trait performance, when carrying out the transfer of merit hence with backcross transformation, functional label Application can preferably avoid Linkage drag, reduce importing (Andersen J R, L ü of the not beneficial gene of donor to acceptor bberstedt T.Functional markers in plants.Trends Plant Sci,2003,8:554-560)。

Can be preferable according to the functional label of the invertase TaCwi-A1 of Grain Weight in Common Wheat key gene cell wall-bound exploitations The size of thousand grain weight of wheat is distinguished on ground, can be used for molecular marker assisted selection (Xiang Jishan, Mu Peiyuan, Sang Wei, the Nie Ying of grain weight It is refined, Xu Hongjun, Zhuan Li, Cui Fengjuan, Han Xinnian, Zou Bo. Grain Weight in Common Wheat gene TaCwi-A1 functional label CWI22, CWI21's tests Card and application. Scientia Agricultura Sinica, 2014,47 (13):267-2679).According to paddy rice control mass of 1000 kernel gene TGW 6 with its etc. The single base disappearance that position gene tgw 6 exists in functional area, the functional label for designing and filtering out the genes of TGW 6 can be accurate Identify TGW 6 different genotype (Wang Jun, Yang Jie, Xu Xiang, Zhu Jinyan, Fan Fangjun, Li Wenqi, Wang Fangquan, Zhong Weigong. water The development and utilization of the functional labels of rice mass of 1000 kernel gene TGW 6. rice in China science, 2014.28 (5):473-478).According to water There is 8bp base deletions between rice recessiveness odor type kind and BAD2 genes (i.e. scent gene) sequence of non-odor type kind, design Go out the InDel functional label GRFM04 of scent gene fgr, can exactly distinguish odor type homozygous genotype, non-odor type homozygosis 3 kinds of banding patterns of genotype and heterozygous genotypes, and the aroma characteristics performance corresponding with its plant or kind of 3 kinds of banding patterns is completely in one by one Corresponding relation (Wang Feng, Li Jinhua, Liu Wuge, Liao Yilong, Zhu Manshan, Liu Zhenrong, Huang Huijun, Huang Dejuan. a kind of rice scent base Because of the exploitation of functional label. rice in China science, 2008,22 (4)：347-352).

The Ve genes of tomato (Lycopersiconesculentum) be first clone resisting verticillium gene, Ve genes Site includes two genes of Ve1 and Ve2, is a kind of receptor protein (receptor-like protein, RLP) gene, by its turn To enter be improved after susceptible Potato Cultivars the resistance to verticilliumalbo-atrum (Kawchuk LM, Hachey J, Lynch DR, et al.Tomato Ve disease resistance genes encode cell surface-like receptors.Proceedings of the national academy of sciences of the united states of America,2001,98:6511-6515.).Cotton GbVe gene families are equally extremely closed to the resistance of verticillium wilt It is important.Zhang etc. (2011) has cloned GbVe genes from sea island cotton Pima90-53, and the gene falls within RLP GFPs, 55.9% and 57.4% is respectively with tomato Ve1 and Ve2 gene similitude, the resistance to verticillium wilt of the gene transformation of Arabidopsis thaliana strain shows Write and improve (Zhang, Y., Wang, X., Yang, S., Chi, J., Zhang, G.and Ma, Z.Cloning and characterization of a Verticillium wilt resistance gene from Gossypiumbarbadense and functional analysis in Arabidopsis thaliana.Plant Cell Rep 30(2011),pp.2085-2096.)；Zhang etc. (2012) is cloned from the cotton variety H7124 of resisting verticillium island With tomato Ve1 genes (Fradin, E.F., Zhang, Z., Juarez Ayala, J.C., Castroverde, C.D., Nazar,R.N.,Robb,J.,Liu,C.M.and Thomma,B.P.Genetic dissection of Verticillium Wilt resistance mediated by tomato Ve1.Plant Physiol 150 (2009), pp.320-332.) and The Gbve1 genes of cotton GbVe genes (Zhang et al.2011) homeologous, the gene also has typical plant disease-resistant Protein structure domain, the homology with tomato Ve1 genes (Fradin et al.2009) is 51%, with cotton GbVe genes The homology of (Zhang et al.2011) is 69%.Using VIGS silences Gbve1 gene sea island cotton H7124 can be made to verticillium wilt Resistance lose；Also, the result of Gbve1 genetic transformation arabidopsis and upland cotton all shows Gbve1 gene pairs High pathogenicities Defoliation and non-defoliation verticillium wilt pathogen all have resistance (Zhang, B., Yang, Y., Chen, T., Yu, W., Liu, T., Li, H.,Fan,X.,Ren,Y.,Shen,D.,Liu,L.,Dou,D.and Chang,Y.Island cotton Gbve1 gene encoding a receptor-like protein confers resistance to both defoliating and non-defoliating isolates of Verticilliumdahliae.PLoS One 7(2012a), pp.e51091.).Yang etc. (2014) has cloned same with tomato Ve1 Gene Partials from the cotton variety H7124 of resisting verticillium island The Gbvdr5 genes in source, the arabidopsis of the gene and Cotton Transformation strain equally have defoliation and non-defoliation resistance to verticillium wilt (Yang YW,Ling XT,Chen TZ,CaiLiW,Liu TL,Wang JY,Fan XH,Ren YZ,Hongbo Yuan,Zhu W,Zhang BL,Ma Din-Pow.A Cotton Gbvdr5 Gene Encoding a Leucine-Rich-Repeat Receptor-Like Protein Confers Resistance to Verticilliumdahliae in Transgenic Arabidopsis and Upland Cotton.Plant Molecular Biology Reporter,2014,DOI 10.1007/s11105-014-0810-5)。

This research develops a kind of cotton verticillium wilt functional gene mark according to cotton GbVe gene families, and proves the mark Note can accurately detect the anti-sense material of verticillium wilt, can be applicable to screen cotton hybrid introgressive line plant, improve Breeding Efficiency, show Write and save breeding screening cost.

3rd, the content of the invention

Technical problem

The purpose of the present invention is：One cotton verticillium wilt functional gene mark is provided and its is applied, this labeled fragment is present In the susceptible material of cotton verticillium wilt, and lack in disease-resistant material or be mutated.The fragment is dominant molecular labeling.Can utilize The mark accurately detects the resistance to verticillium wilt of different cotton varieties or material, can be applicable to screen the plant of cotton hybrid introgressive line Strain, improves Breeding Efficiency, significantly saves breeding screening cost, obtains the preferable material of resistance to verticillium wilt.

Technical scheme

One cotton verticillium wilt functional gene mark and its application, it is characterised in that：

Use labeled primer Gbvds1549:

Left end primer sequence is:TTGAGCAATTGACAAGAATAGAGCT

Right-hand member primer sequence is:TAGTAATATTGGTCATTATTTGC.

With the disease-resistant material of labeled primer Gbvds1549 amplification cotton verticillium wilts or kind DNA, without amplified production.And expand Sensitizing disease material or kind DNA, the amplified fragments of acquisition are 1549bp, as cotton verticillium wilt functional gene mark Gbvds1549.This labeled fragment is lacked in disease-resistant material or is mutated in the susceptible material of cotton verticillium wilt.The fragment is Dominant molecular labeling.

The cotton verticillium wilt functional gene flag sequence, is one of following nucleotide sequence：

1) DNA sequence dna in sequence table shown in SEQ ID NO.1；

2) nucleotide sequence of the DNA sequence dna hybridization that can be limited with SEQ ID NO.1 in sequence table.

Described flag sequence, it is characterised in that the bar of the DNA sequence dna hybridization limited with SEQ ID NO.1 in sequence table Part is in 0.1 × SSPE or 0.1 × SSC, the solution of 0.1%SDS, under the conditions of 65 DEG C film to be washed.

Described flag sequence, it is characterised in that：Nonreactive of the molecule labelled series from one excalation of cotton Property effect surface receptor protein gene ghvdr6, the gene nucleotide length is 2121bp, and the amino acid length of coding is 706。

Beneficial effect

1st, present invention obtains a cotton verticillium wilt functional gene marks Gbvds1549.The present invention is sequenced by BAC, Obtain a surface receptor protein gene ghvdr6 without entire reading frame.Resisted using there is verticillium wilt known to the gene and other Property effect gene order differential position design gene specific primer, the primer expands susceptible material or kind DNA, the expansion of acquisition Increasing fragment is 1549bp, nucleotide sequence as shown in SEQIDNO.1, but with the primer expand the disease-resistant material of cotton verticillium wilt or Kind DNA, without amplified production.And the method for developing Functional marker on this basis.By detecting the functional molecular Mark, can accurately detect the resistance to verticillium wilt of different cotton varieties or material, can be applicable to screen cotton hybrid introgressive line Plant, improves Breeding Efficiency, significantly saves breeding screening cost, obtains the preferable material of resistance to verticillium wilt.

2nd, Gbvds1549 is the functional gene mark of the cotton verticillium wilt of first report.The present invention obtain mark be Functional gene is marked, with obvious advantage compared with the genetic marker reported before.Functional gene mark is according to function base Because inside causes a kind of New molecular marker for developing of polymorphism motif that phenotypic character makes a variation.Due to it is this kind of mark from Intragenic functional motif, therefore this kind of mark need not further verify and just can determine mesh under different genetic background The presence or absence of mark allele.Gbvds1549 is according to from the surface receptor protein closely related with cotton verticillium wilt resistance Gene, but the gene is one to be lacked, nonfunctional gene.So the mark is existed only in susceptible material.

3rd, the Breeding Efficiency of resistance to verticillium wilt material is improved, it is cost-effective.Traditional genetic marker receives genetic background, plant Growth period and environmental condition etc. affect.Such as cotton verticillium wilt mark is different because of verticillium wilt pathogen fungus strain and cotton growth period, The related QTL of more than 100 resistance to verticillium wilt is had been obtained at present, except the 6th, 10,12 and 18 articles of dyeing are external, is distributed in it On remaining all of chromosome.These marks are difficult to be effectively applied to molecular mark.And functional label is from control The gene of proterties processed itself, can use in different genetic background and breeding time.

4th, the present invention contributes to cloning verticillium wilt disease-resistant gene and understanding its resistance mechanism.Gbvds1549 is according to source In the surface receptor protein gene closely related with cotton verticillium wilt resistance, but the gene is one to be lacked, nonfunctional base Cause.The homologous gene in the site in by cloning disease-resistant material, it is possible to be separated to one and resistance to verticillium wilt is played a crucial role Disease-resistant gene.

4th, illustrate

The nucleotides and amino acid sequence of Fig. 1 ghvdr6.

The nucleotides of Fig. 2 ghvdr6 genes similar with other known cotton acceptors compares.Black surround part be ghvdr6 and its The larger position of his gene difference, i.e. Gbvds1549 labeled primers position.

Amplification of Fig. 3 Gbvds1549 labeled primers in the anti-sense material of difference.

5th, specific embodiment

Method therefor is if no special instructions conventional method in following embodiments, and the primer sequence is by Shanghai English Pretty Bioisystech Co., Ltd's synthesis, the percentage composition is weight/mass percentage composition.Resistance Strain of Cotton sense material used is public affairs Know public, pertinent literature and information are shown in Table 1.

(1) exploitation of cotton Gbvds1549 marks

According to one section of cotton est sequence (accession number in Gene Index：TC121084) design primer 5 '- TTCTGGTCCAATACCATCATTCT-3 ', 5 '-CTTAGATTCAGTACTCCAAGAGA-3 ' expand upland cotton DNA profiling, obtain To about 1Kb or so bands, by the sequencing fragment, its similarity for there was only 76% with original EST fragments, the fragment coding are found 1 brand-new cotton surfaces receptor protein gene, is further somebody's turn to do according to the fragment design primer by chromosome walking The full length sequence of gene, is GhVdr2 (patents by the unnamed gene：Cotton verticillium wilt disease-resistant related gene GhVdr2 and its should With grant number：ZL 201110066390.9).

Because this kind of surface receptor protein gene has many similar sequences in genome, in order to obtain more this kind of bases Cause, according to GhVdr2 primer is designed

GhVdr2-F595：5 '-CTTGATGGGGTGAATATTAGAGCA-3 ',

GhVdr2-R1021：5’-ATTGCCCAAGGTTACCGATAGAAT-3’

Amplification upland cotton DNA profiling.Cotton BAC (bacterial artificial chromosomes are screened with the about 400bp fragments for obtaining as probe Body group) library (it is maxxa to build cotton variety used by library, and library derives from Clemson University), it is obtained 40 Individual BAC positive colonies.

BAC clone D1 are sequenced, commission Shanghai Han Yu biotech companies are carried out.Sequencing result shows, the clone In addition to containing the surface receptor protein gene with entire reading frame, such protein gene sequence of also one disappearance should Gene nucleotide is 2121bp, and the amino acid length of coding is only 706, is ghvdr6 (Fig. 1) by the unnamed gene.And tomato Resistance to verticillium wilt gene Ve1 length is that (Fradin et al., 2009), cotton Gbve is 3819bp (Zhang et to 3162bp Al., 2011), Gbve1 is that (Zhang et al., 2012), Gbvdr5 is 3454bp (Yang et al.2014) to 3417bp.Profit Ghvdr6 and the resistance to verticillium wilt gene order (Fig. 2) reported are analyzed with DNAMAN.9 genes are devised for diversity sequence Special primer, for expanding the DNA of the anti-sense material of verticillium wilt.

(2) molecular markers for identification of the anti-sense material of verticillium wilt

Identified using the anti-sense material of 30 verticillium wilt (be public, be shown in Table 1 bibliography), wherein disease-resistant material 21, material, susceptible material 9 (table 1).These are all to be presently considered to the preferably or extremely susceptible cotton material of resistance, and often It is used as parent and builds segregating population.Using CTAB methods extract cotton genomic dna (PATERSON A H, Brubaker C L, Wendel J F.A rapid methodfor extraction cotton (spp.)genomic DNA suitablefor RFLP or PCR analysis.Plant MolBiol Rep,1993,11:122-127).Using 9 gene specifics of design Primer expands the DNA of the anti-sense material of verticillium wilt, and PCR reaction systems are：The μ l of DNA profiling 1, primer are added in 25 μ l reaction systems Each 5nmol, 5 μ l5 × primeSTAR buffer (Mg²⁺Plus) PCR buffer solutions, 0.2mMdNTP, 1U primeSTARHS DNA Polymerase (TaKaRa companies) enters performing PCR amplification.PCR amplification conditions are：94 DEG C 45 after 94 DEG C of 3' ", 56 DEG C 45 ", 72 DEG C 1'30 ", circulates 36 times, then 72 DEG C of extension 10'.PCR primer is detected on 1% Ago-Gel.As a result only a pair are shown Primer amplify in all of susceptible material length be 1549bp fragment, nucleotide sequence as shown in SEQIDNO.1, but Without amplified production (Fig. 3) in disease-resistant material.The mark is named as into Gbvds1549, its labeled primer is：

Left end primer sequence is:TTGAGCAATTGACAAGAATAGAGCT

Right-hand member primer sequence is:TAGTAATATTGGTCATTATTTGC.

Table 1. is used for the anti-sense material of 30 verticillium wilt of molecular markers for identification

SEQ ID NO.1：

TTGAGCAATTGACAAGAATAGAGCTTGCGACTTGCAATTTCAGTGGAGCCATACCCAAAACAATGAAGA AACTTACCCAACTTGTGTATCTGGATTTTTCCTTTAACCGTTTTTCTGGTCCAATACCATCATTCTCATCAGCCAGA AATCTTATATACCTAAGCCTTAGTTATAATCAGTTAAATGGTGGAATTCATTCCACTGATTGGTCAAGTCTTTCTAA GCTAGAAATTGTTTACTTAGGAAACAACAAGTTAAGTGGAACCATTCCACCGGCTTTGTTTTGCATTCCATCACTGC GTGGACTTCACCCTTATCAAAACCAATTCAAGGGTAACCTTAATGACCTTCATGGTAAGGCCTCTTTATTGCTTGAG GACCTTGATCTTAGTAGCAACAAGTTACAAGGGCAATTCCCAATGTCTATGTTTGAACTCCATGGTCTGAAGTTGCT ATCCCTTTCTTCAAACAACTACAGTGGCTCGATACCAATGAGTGCCTTTCAGAACTTGAGGAATCTTTCTTACCTTG ATCTCTCATATAACAGGTTGTCTATTGATGCCACTGATACTAATATTTCCTCACTTTCTTTCCCTACCATCGTCACA TTGAAGTTGACATCTTGCAACTTAACGGAGTTCCCTGATTTCTTGAAATATCAGTCTAGATTATCATATCTAGACCT TTCAAACAACCAGATTCAAGGGAAAATACCGAATTGGATTTGGAAAGTGAGAAGCCTTGGACACCTAAATCTTTCTC AAAACTTCATTGTAGAATTTGATAAATCTTTGAAGAATATAAATTCTACTCTCAATGTTTTGGACCTGCATGGCAAT CAATTGCAAGGGCAAATCCAAATTCTTCCACCATATGTCACTTATTTGGATTACTCAAACAACAATTTCAGCTCTGT TTTACCAGCTCAGCTCGGTGACTTCCTCCAGTTTGCTTATTTCTTCTCTGTCTCAGGCAATAACTTCAATGGGAGTA TTCCCAAGTCGATATGCAGTAGCTTATATCTCAAAGTACTTGATATGTCTTATAATTACTTGAGTGGGTCAATTCCT AAATGCCTGACTCAAATGAGTGCATCTCTTGGAGTACTGAATCTAAAGGGAAACAACCTCAGTGGCATCATTTCCGA CGCTTTTCCAGAAAGTTGTAAGTTACAAACTCTAGATCTCAATCAGAACCGATTGGAAGGAAAGGTTCCAGAATCAT TGGGGAATTGCAAAGAGCTGGAGGTTGTAGACATTGGCAACAATCAGATCAGTGGCAGCTTCCCATGCCATTTGGAG AATATATCCAAGTTGCGTGTCCTTGTTTTACGATCTAACAAATTCAACGGCAGTATTCATTGTCACAAGAACAATAC CAGCTGGCCAATGCTTCAGATTGTTGACTTAGCATCCAACAATTTTAGTGGTAAACTGCATCTAACTGGTTTGGGGA CCTGGGAGGCTATGCGGCCTAATCATGATAAAAACCAATCAGAGCTCCAACATCTCATGTTTGAGGTCTTAGCAAAT AATGACCAATATTACTA

SEQUENCE LISTING

<110>Jiangsu Province Agriculture Science Institute

<120>A kind of molecular labeling of cotton verticillium wilt functional gene and its application

<130> 0

<160> 3

<170> PatentIn version 3.1

<210> 1

<211> 1549

<212> DNA

<213>Manually

<220>

<221> Gbvds1549

<222> (1)..(1549)

<223>

<400> 1

ttgagcaatt gacaagaata gagcttgcga cttgcaattt cagtggagcc atacccaaaa 60

caatgaagaa acttacccaa cttgtgtatc tggatttttc ctttaaccgt ttttctggtc 120

caataccatc attctcatca gccagaaatc ttatatacct aagccttagt tataatcagt 180

taaatggtgg aattcattcc actgattggt caagtctttc taagctagaa attgtttact 240

taggaaacaa caagttaagt ggaaccattc caccggcttt gttttgcatt ccatcactgc 300

gtggacttca cccttatcaa aaccaattca agggtaacct taatgacctt catggtaagg 360

cctctttatt gcttgaggac cttgatctta gtagcaacaa gttacaaggg caattcccaa 420

tgtctatgtt tgaactccat ggtctgaagt tgctatccct ttcttcaaac aactacagtg 480

gctcgatacc aatgagtgcc tttcagaact tgaggaatct ttcttacctt gatctctcat 540

ataacaggtt gtctattgat gccactgata ctaatatttc ctcactttct ttccctacca 600

tcgtcacatt gaagttgaca tcttgcaact taacggagtt ccctgatttc ttgaaatatc 660

agtctagatt atcatatcta gacctttcaa acaaccagat tcaagggaaa ataccgaatt 720

ggatttggaa agtgagaagc cttggacacc taaatctttc tcaaaacttc attgtagaat 780

ttgataaatc tttgaagaat ataaattcta ctctcaatgt tttggacctg catggcaatc 840

aattgcaagg gcaaatccaa attcttccac catatgtcac ttatttggat tactcaaaca 900

acaatttcag ctctgtttta ccagctcagc tcggtgactt cctccagttt gcttatttct 960

tctctgtctc aggcaataac ttcaatggga gtattcccaa gtcgatatgc agtagcttat 1020

atctcaaagt acttgatatg tcttataatt acttgagtgg gtcaattcct aaatgcctga 1080

ctcaaatgag tgcatctctt ggagtactga atctaaaggg aaacaacctc agtggcatca 1140

tttccgacgc ttttccagaa agttgtaagt tacaaactct agatctcaat cagaaccgat 1200

tggaaggaaa ggttccagaa tcattgggga attgcaaaga gctggaggtt gtagacattg 1260

gcaacaatca gatcagtggc agcttcccat gccatttgga gaatatatcc aagttgcgtg 1320

tccttgtttt acgatctaac aaattcaacg gcagtattca ttgtcacaag aacaatacca 1380

gctggccaat gcttcagatt gttgacttag catccaacaa ttttagtggt aaactgcatc 1440

taactggttt ggggacctgg gaggctatgc ggcctaatca tgataaaaac caatcagagc 1500

tccaacatct catgtttgag gtcttagcaa ataatgacca atattacta 1549

<210> 2

<211> 25

<212> DNA

<213>Manually

<220>

<221>Primer Gbvds1549 is left

<222> (1)..(25)

<223>

<400> 2

ttgagcaatt gacaagaata gagct 25

<210> 3

<211> 23

<212> DNA

<213>People

<220>

<221>Primer Gbvds1549 is right

<222> (1)..(23)

<223>

<400> 3

tagtaatatt ggtcattatt tgc 23

Claims (1)

1. a kind of application of the molecular labeling of cotton verticillium wilt functional gene, it is characterised in that：

Use molecular labeling primer Gbvds1549：

Left end primer sequence is:TTGAGCAATTGACAAGAATAGAGCT

Right-hand member primer sequence is:TAGTAATATTGGTCATTATTTGC

The disease-resistant material of amplification cotton verticillium wilt or kind DNA, without amplified production；And susceptible material or kind DNA are expanded, obtain Amplified fragments be 1549bp, this labeled fragment is present in the susceptible material of cotton verticillium wilt, and in disease-resistant material disappearance or Mutation, the fragment is dominant molecular labeling.