CN104846075B - Based on detection peripheral blood mitochondrial DNA oxidative damage evaluate vivo oxidation stress method - Google Patents
Based on detection peripheral blood mitochondrial DNA oxidative damage evaluate vivo oxidation stress method Download PDFInfo
- Publication number
- CN104846075B CN104846075B CN201510145466.5A CN201510145466A CN104846075B CN 104846075 B CN104846075 B CN 104846075B CN 201510145466 A CN201510145466 A CN 201510145466A CN 104846075 B CN104846075 B CN 104846075B
- Authority
- CN
- China
- Prior art keywords
- dna
- primer
- peripheral blood
- oxidative damage
- hogg1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Abstract
The invention provides detection peripheral blood mitochondrial DNA oxidative damage reagent prepare evaluate vivo oxidation stress reagent in application, and based on detection peripheral blood mitochondrial DNA oxidative damage evaluate vivo oxidation stress method.
Description
Technical field
The invention belongs to molecular diagnostic techniques field.Specifically, the invention provides detection peripheral blood mitochondrial DNA oxygen
Change damage reagent prepare evaluate vivo oxidation stress reagent in application, and based on detection peripheral blood mitochondrial DNA
Oxidative damage evaluate vivo oxidation stress method.
Background technology
Oxidative stress, refers to body active oxygen (reactive oxygen species, ROS) or active nitrogen (reactive
Nitrogen species, RNS) excessive and/or antioxidant ability of organism decrease is produced, ROS or RNS remove deficiency, cause body
Interior ROS or RNS increase, destroy body oxidation/reduction it is normal unbalance, so as to cause tissue and cell to occur oxidative damage
Pathologic process.Therefore, evaluate vivo oxidation stress in medical diagnosis on disease and related science research (such as oxidative stress and aging,
The correlative study of neurodegeneration, metabolic disease etc.) it is significant.
At present, the appraisement system for oxidative stress mainly includes detecting following biomolecule：1) active oxygen/activity
The biomolecule of nitrogen modification：Including protein oxidative damage mark, such as damage of protein carbonylation, nitration, late period oxidation
Protein product (AOPP)；Lipid peroxidation product, such as 4- Hydroxynonenals (HNE) and MDA (MDA), and nucleic acid oxidation are damaged
The 8-OHdG produced when hindering；2) activities of antioxidant enzymes, such as hepatocuprein (superoxide dismutase, SOD), mistake
Hydrogen oxide enzyme (catalase, CAT), glutathione peroxidase (glutathione peroxidase, GSH-Px), paddy Guang
Sweet peptide S transferases enzyme (glutathione S-transferase, GST) and heme oxidase (heme oxygenase, HO)
Deng.Conventional detection method mainly includes at present, 1) with spectrophotometry MDA, SOD, CAT, reduced form/oxidized form GSH,
GPx etc., method is simple, and relatively cheap, but stability is poor；2) using ELISA detections MDA, HNE, 8-OHdG etc., the method compares
Reliably, expense is of a relatively high.In addition, utilizing high performance liquid chromatography-electrochemical (HPLC-ECD) method, gas chromatography mass spectrometry (GC-MS) etc.
Available for the detection of 8-OHdG levels, but due to needing pertinent instruments, and the low shortcoming of cumbersome, sensitivity, it is difficult to promote
And application.
The content of the invention
In the molecule diagnosis research of human peripheral blood, it is believed that the nucleic acid compositions of Peripheral Circulation can turn into reflection morbid state
Preferable index.Peripheral blood includes blood plasma and haemocyte (red blood cell, granulocyte, lymphocyte, monocyte, blood platelet etc.).
The oxidative damage of the genomic DNA of periphery blood lymphocyte, such as 8-OhdG (8-
Hydroxydeoxygumlosine, 8-OHdG)/8- hydroxy guanines (8-oxo-guanine, 8-oxo-G) generation or
The fracture of DNA, has been applied to evaluate oxidative stress status.It is similar to nuclear DNA, mitochondrial DNA
(mitochondrial DNA, mtDNA) there is also similar damage.
MtDNA is located in cell mitochondrial, is ring-type double-strand, the DNA of multicopy.The complete mtDNA of the mankind is close ring
Shape double-stranded DNA, long 16569bp encodes 37 genes.Mitochondria is independently present in extranuclear organelle, is cellular energy
The main place produced with ROS.Because mtDNA is exposed in high activity ROS environment, and lacks histone protection and effectively repair
The system of answering a pager's call, mtDNA is more subject to oxidative attacks and produces oxidative damage, further results in DNA mutation, and its mutation rate is core DNA
20 times.The characteristics of this patent is based on mtDNA oxidizable damages, by analyzing the inside and outside mtDNA level of damage of cell come sensitiveer
Reflection oxidative stress status, and by this method be applied to Metabolic Syndrome Patients and normal healthy controls PMNC,
The detection of blood plasma mtDNA oxidative damage levels.
First with 8- oxidation guanine DNA glycosylases (human oxoguanine glycosylase 1, hOGG1)
DNA is digested in vitro, and the enzyme is in vivo to participate in the key enzyme that DNA base excision is repaired, and energy specific recognition simultaneously cuts off DNA double
8-OHdG in chain, produces depurination (AP) site, and then recover normal G through base excision repair mechanism:C base pairings.In body
Outside, hOGG1 enzymes are removed after the 8-OHdG on DNA molecular, by designing primer, utilize quantitative fluorescent PCR specific amplification
mtDNA.Lack base position because mtDNA molecules are produced after hOGG1 digestions, there is the difference of amplification with the mtDNA of non-digestion,
As a result Ct difference is shown as on, Ct differences (Δ Ct values) are reflection mtDNA oxidative damage levels.
In the effect assessment of patent, various concentrations H is utilized2O2Oxidative stress cell model is set up, Mitochondrially targeted property is used
Antioxidant Mitoquinone (MitoQ) builds anti-oxidant cell model.H2O2Function cells cause oxidative stress to be more normal
Method, low concentration (50-200 μM) H in this patent use2O2.MitoQ is a kind of lipophilic positively charged chinol class
Material, may pass through cytolipin bilayer and is directly entered negatively charged mitochondria, reduction mitochondria ROS generation suppresses
The decline of mitochondrial membrane potential and the release of cromoci, with chondriosome protective effect
On the one hand, the internal oxygen of evaluation is being prepared the invention provides the reagent of detection peripheral blood mitochondrial DNA oxidative damage
Change stress reagent in application.
Further, wherein the reagent of the detection peripheral blood mitochondrial DNA oxidative damage is PCR primer and people 8- oxidations
Guanine DNA glycosylases (hOGG1).
Yet further, wherein PCR primer is the primer pair selected from following primer pair：
DLP1：Forward primer ATATCCCGCACAAGAGTGCT (SEQ ID NO.1), reverse primer
GGGAACGTGTGGGCTATTTA(SEQ ID NO.2)；
COX2：Forward primer ACGATCCCTCCCTTACCATC (SEQ ID NO.7), reverse primer
TTGTCAACGTCAAGGAGTCG(SEQ ID NO.8)；
ND1：Forward primer CCTAATGCTTACCGAACGAA (SEQ ID NO.9), reverse primer
GTAGATGTGGCGGGTTTTAG(SEQ ID NO.10)。
Further, PCR primer is selected：
DLP1：Forward primer ATATCCCGCACAAGAGTGCT (SEQ ID NO.1), reverse primer
GGGAACGTGTGGGCTATTTA(SEQ ID NO.2)。
On the other hand, the invention provides answered based on detection peripheral blood mitochondrial DNA oxidative damage to evaluate vivo oxidation
Sharp non-diagnostic method, step includes：
(1) sample DNA is extracted；
(2) using hOGG1 process parts DNA；
(3) qPCR reactions are carried out using DNA treated and untreated hOGG1；
(4) the Ct value differences for comparing the treated and untreated DNA of hOGG1 are different；
(5) it is different according to Ct value differences, judge 8-OhdG (8-OH-dG) content, and reflection DNA oxidations are damaged indirectly
Wound and vivo oxidation stress level.
Further, the primer used in the qPCR reactions of wherein step (3) is selected from following primer pair：
DLP1：Forward primer ATATCCCGCACAAGAGTGCT (SEQ ID NO.1), reverse primer
GGGAACGTGTGGGCTATTTA(SEQ ID NO.2)；
COX2：Forward primer ACGATCCCTCCCTTACCATC (SEQ ID NO.7), reverse primer
TTGTCAACGTCAAGGAGTCG(SEQ ID NO.8)；
ND1：Forward primer CCTAATGCTTACCGAACGAA (SEQ ID NO.9), reverse primer
GTAGATGTGGCGGGTTTTAG(SEQ ID NO.10)。
Yet further, the primer that uses is in the qPCR reactions of wherein step (3)：DLP1：Forward primer
ATATCCCGCACAAGAGTGCT (SEQ ID NO.1), reverse primer GGGAACGTGTGGGCTATTTA (SEQ ID NO.2).
Brief description of the drawings
Fig. 1：Fluorescence microscope oxidative stress and anti-oxidation stress cell model DCFH-DA fluorescence intensities.
Fig. 2：Flow cytometer monitors ROS levels.
Fig. 3：Different H2O2Cell MDA contents and SOD vigor under concentration.
Fig. 4：Oxidative stress and anti-oxidation stress cell model CAT, GSH-S, SOD vigor and MDA contents.
Fig. 5：Δ Ct values calculate diagram.
Fig. 6：The agarose gel electrophoresis result of the amplification of each pair of primer.
Fig. 7：QPCR amplifications (being above amplification curve exemplified by DLP1 primers, lower is solubility curve)
Fig. 8：Δ Ct values after each pair of primer amplification.
Fig. 9：Oxidative stress and anti-oxidant intracellular and cell conditioned medium mtDNA oxidative damage levels are detected using DLP1.
Figure 10：Metabolic Syndrome Patients and normal healthy controls Content of MDA compare.
Figure 11：Peripheral blood PBMC mtDNA are compared with plasma free mtDNA oxidative damage levels
Embodiment
The design of primers of embodiment 1
According to the NCBI gene pool mankind mtDNA (NC_012920) standard sequence, first against mtDNA D-loop areas
(displacement loop) designs primer.D-loop areas include the ori that mtDNA heavy chains are synthesized, and are that mtDNA is replicated
Control zone, be also the binding site of mtDNA and mitochondrial membrane, easily influenceed by MDA, be mtDNA mutation height
Area is sent out, base mutation rate is higher than other regions 6-8 times.D-loop areas include three hypervariable regions, hypervariable region I (np16024-
16383), hypervariable region II (np57-372) and hypervariable region III (np438-574).Therefore, to ensure the specificity expanded, setting
These three hypervariable regions are avoided during meter primer.
The fragment of the DLP1 primers amplification shown in table 1, is not covered by hypervariable region, and DLP2 primers amplified fragments then wrap by part
Hypervariable region is contained.In addition, devising the primer of amplification COX1 genes, COX2 genes and ND1 genes, to be compared, these areas
Guarded relatively in mtDNA and be difficult missing in domain.
Table 1 is used for the list of primers that mtDNA oxidative damages are detected
Embodiment 2 builds cell model
HUEVC cell culture：With containing 10% hyclone, the culture mediums of 1% Pen .- Strep solution RPMI 1640,37
DEG C, 5%CO2Culture；Passed on after the full culture dish of cell growth, first wash cell twice with PBS during passage, 37 DEG C of trypsase
1640 culture mediums piping and druming cell is added after digestion 1-2min makes it come off, and collects PBS after cell and washes cell twice, continues to cultivate；
Oxidative stress cell model：In HUEVC cell culture mediums (RPMI 1640, containing 10% hyclone, 1% mould
Element-streptomysin) the middle a certain amount of H of addition2O2, make its final concentration of 50,100,150,200 μM；Anti-oxidant group：In cell culture medium
200 μM of H are added simultaneously2O2With antioxidant MtioQ, final concentration is respectively 100,200,300nM；Except H2O2, identical culture
Under the conditions of HUEVC cells as a control group.Cell is collected after effect 2h, BCA methods are surveyed after protein concentration, by determining MDA (third
Dialdehyde), SOD (superoxide dismutase), CAT (catalase), the conventional oxidation such as GST-SH (glutathione-S-transferase)
Damage criterion verifies cell model oxidation level.Simultaneously using ROS specificity fluorescent probes DCFH-DA dye cells, pass through streaming
Cell art and fluorescence microscope ROS productions.
As shown in Figure 1, 2, in constructed cell model, H2O2Function cells cause the rise of ROS levels, and MitoQ
The rise of ROS levels can then be suppressed, the result is consistent with previous investigation.
Fig. 3 shows MDA contents and SOD vigor in H2O2Obvious concentration dependent is not shown during concentration increase, is only existed
(200 μM and 300 μM) SOD vigor is decreased obviously during high concentration.
Fig. 4 is shown in H2O2The rise of MDA contents, SOD activity, CAT activity, GSH-ST activity decline after function cells, carry
Show that cell is in oxidative stress status.And after using MitoQ, the oxidative damage of cell can be intervened.
The inside and outside mtDNA oxidative damages level detection of the cell of embodiment 3
Extract various H2O2With the cell DNA of MitoQ concentration processing, paramagnetic particle method extracts cell conditioned medium dissociative DNA.Will be certain
Measure DNA and hOGG137 DEG C of water-bath 2h.Equal amount DNA is not added with hOGG1 as control, and other conditions are consistent.Then above-mentioned 5 are utilized
Carry out qPCR reactions respectively to primer, calculate the DNA sample of identical source, the difference of Ct values when adding and being not added with hOGG1, with this
To react 8-OH-dG content, and reflect the level of DNA oxidative damages indirectly.
Prepare hOGG1 endonuclease reaction systems
Mix, 37 DEG C of water-bath 2h, 65 DEG C of enzymes inactivate 15mim
Quantitative fluorescent PCR
1) PCR reaction systems are prepared
2) PCR reaction conditions：
3) Δ Ct values=digestion group Ct values of each sample-(computational methods example is shown in Fig. 5, DLP2 to control group Ct values are calculated
Amplification example is shown in Fig. 7)
4) PCR primer electrophoresis：1% Ago-Gel is prepared, in (each pair of primer amplification production of electrophoresis 20min under 120V voltages
Thing electrophoresis result is shown in Fig. 6).
In the result (Fig. 8) detected above for mtDNA oxidative damages level, expanded using DLP1, COX2 and ND1 primer
Obvious H is presented in the Δ Ct values of fragment2O2Concentration dependent, wherein during using DLP1 primers, amplified fragments Δ Ct values are in low concentration
(50μM)H2O2When be detected obvious rise, the just performance in higher concentration of COX2 and ND1 primer amplified fragments Δ Ct values
Go out obvious rise, and Δ Ct values are low compared with DLP1 amplifications Δ Ct values.
In addition, with the MDA contents and SOD expression activitiys that are detected with spectra photometric method, mtDNA8- of this patent based on qPCR
The detection of OHdG levels is more sensitive, the Δ Ct values and H calculated after being expanded using primer DLP1, COX2, ND12O2Concentration is respectively provided with
Preferable concentration dependent, and Δ Ct values are expanded more than other primers after the amplification of DLP1 primers, group difference is also larger and cleverer
It is quick.Therefore also demonstrate that this patent, when detecting mtDNA oxidative damage levels, other primers (Fig. 9) is better than using DLP1 primers.
Embodiment 4 utilizes the oxidative stress in the method detection Metabolic Syndrome Patients and normal healthy controls of the present invention
Meet 112 metabolic syndrome diseases of IDF (international diabetes federation) diagnostic criteria
Example and 111 ages, the normal healthy controls of sex matching.Utilize Content of MDA and PMNC (PBMC) gene
Chip analysis research object oxidative stress.
The Metabolic Syndrome Patients of table 2 and normal healthy controls PBMC gene expression dose comparative results
In the above-mentioned analysis to research object oxidative stress, Content of MDA is obvious in Metabolic Syndrome Patients
Higher than normal healthy controls (Figure 10).In the variance analysis to gene expression dose, the gene LOX1 related to oxidationreduction,
MPO, ABCG1, GLRX2 gene become on expression reveals notable difference, and reaction patient is in oxidative stress status.In this base
On plinth, using this patent, human peripheral blood PBMC and plasma free mtDNA oxidative damage levels are detected, as a result such as Figure 11 institutes
Show.
In peripheral blood, the inside and outside mtDNA oxidative damages of cell are above normal healthy controls in Metabolic Syndrome Patients, extracellular
That is the difference of plasma free mtDNA oxidative damages becomes apparent.The oxidative stress detection of the result and early stage is consistent and more simple
It is single easy, also preferably prove feasibility of this patent in the peripheral blood sample of detection patient.
Claims (2)
1. detect peripheral blood mitochondrial DNA oxidative damage reagent prepare evaluate vivo oxidation stress reagent in application,
The reagent of wherein described detection peripheral blood mitochondrial DNA oxidative damage is PCR primer and people 8- oxidation guanine DNA glycosylations
Enzyme (hOGG1), PCR primer is：DLP1：Forward primer ATATCCCGCACAAGAGTGCT (SEQIDNO.1), reverse primer
GGGAACGTGTGGGCTATTTA (SEQIDNO.2)。
2. evaluated based on detection peripheral blood mitochondrial DNA oxidative damage vivo oxidation stress non-diagnostic method, step includes：
(1) sample DNA is extracted；(2) using hOGG1 process parts DNA；(3) carried out using DNA treated and untreated hOGG1
QPCR reacts；(4) the Ct value differences for comparing the treated and untreated DNA of hOGG1 are different；(5) it is different according to Ct value differences, judge 8- hydroxyls
The content of base deoxyguanosine (8-OH-dG), and indirectly reflection DNA oxidative damages and vivo oxidation stress level, wherein step
(3) primer that uses is in qPCR reactions：DLP1：Forward primer ATATCCCGCACAAGAGTGCT (SEQIDNO.1), reversely
Primer GGGAACGTGTGGGCTATTTA (SEQIDNO.2).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510145466.5A CN104846075B (en) | 2015-03-31 | 2015-03-31 | Based on detection peripheral blood mitochondrial DNA oxidative damage evaluate vivo oxidation stress method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510145466.5A CN104846075B (en) | 2015-03-31 | 2015-03-31 | Based on detection peripheral blood mitochondrial DNA oxidative damage evaluate vivo oxidation stress method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104846075A CN104846075A (en) | 2015-08-19 |
| CN104846075B true CN104846075B (en) | 2017-09-29 |
Family
ID=53846058
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510145466.5A Active CN104846075B (en) | 2015-03-31 | 2015-03-31 | Based on detection peripheral blood mitochondrial DNA oxidative damage evaluate vivo oxidation stress method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104846075B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| MX2015003700A (en) * | 2012-09-21 | 2015-10-30 | Reoxcyn Discoveries Group Inc | Cell for electrolyzing a liquid. |
-
2015
- 2015-03-31 CN CN201510145466.5A patent/CN104846075B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| Mitochondrial Impairment Mechanism in D-galactose-induced Senescence in Experimental Fibroblast Cell Model;Wei YE,et al;《International Conference on Biological Sciences and Technology》;20161231;113-124 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104846075A (en) | 2015-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lucena-Aguilar et al. | DNA source selection for downstream applications based on DNA quality indicators analysis | |
| Pesce et al. | Age-related mitochondrial genotypic and phenotypic alterations in human skeletal muscle | |
| Miriyala et al. | Novel role of 4-hydroxy-2-nonenal in AIFm2-mediated mitochondrial stress signaling | |
| Nino et al. | Phosphodiesterase 1 regulation is a key mechanism in vascular aging | |
| EP3150718A1 (en) | Method for sensitive detection of target dna using target-specific nuclease | |
| Baek et al. | Protective role of mitochondrial peroxiredoxin III against UVB-induced apoptosis of epidermal keratinocytes | |
| ES2741591T3 (en) | Method to help the detection of Alzheimer's disease or a moderate cognitive disability | |
| Azimzadeh et al. | Comparison of three methods for mitochondria isolation from the human liver cell line (HepG2) | |
| WO2005123953A2 (en) | Genetic screening for polymorphisms in human genes that increase or decrease sensitivity to toxic agents | |
| CN111676269B (en) | Nucleic acid nano-structure probe and preparation method and application thereof | |
| Jarrett et al. | Assessment of mitochondrial damage in retinal cells and tissues using quantitative polymerase chain reaction for mitochondrial DNA damage and extracellular flux assay for mitochondrial respiration activity | |
| Soon et al. | Mitochondrial DNA mutations in grade II and III glioma cell lines are associated with significant mitochondrial dysfunction and higher oxidative stress | |
| ATE545708T1 (en) | CANCER ANTIGEN MAGE-A9 AND USES THEREOF | |
| Wei et al. | From fluorescent probes to the theranostics platform | |
| Pérez-Rivero et al. | Telomerase deficiency promotes oxidative stress by reducing catalase activity | |
| CN104846075B (en) | Based on detection peripheral blood mitochondrial DNA oxidative damage evaluate vivo oxidation stress method | |
| Detsika et al. | HO-1 expression control in the rat glomerulus | |
| Špaková et al. | Fluorescence biomarkers of malignant melanoma detectable in urine | |
| Wei et al. | A simple “signal off–on” fluorescence nanoplatform for the label-free quantification of exosome-derived microRNA-21 in lung cancer plasma | |
| CN109825585A (en) | A kind of biomarker of nasopharyngeal carcinoma diagnosis and/or prognosis evaluation | |
| CN108441550A (en) | Primer combination, detection kit and its application of pigeon sex identification | |
| CN102925580A (en) | Quick detection method for Notch1 gene mutation | |
| Chang-jie et al. | Programmed cell death features in apple suspension cells under low oxygen culture | |
| CN108676852B (en) | Primer pair group and kit for detecting epigenetic modification difference of P53 gene in peripheral blood free DNA | |
| CN109355379B (en) | Kit for detecting autosomal dominant hereditary deafness family-induced deafness gene mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |