CN104844699A - Soybean GmNEK1 protein, and coding gene and application of soybean GmNEK1 protein - Google Patents
Soybean GmNEK1 protein, and coding gene and application of soybean GmNEK1 protein Download PDFInfo
- Publication number
- CN104844699A CN104844699A CN201410049570.XA CN201410049570A CN104844699A CN 104844699 A CN104844699 A CN 104844699A CN 201410049570 A CN201410049570 A CN 201410049570A CN 104844699 A CN104844699 A CN 104844699A
- Authority
- CN
- China
- Prior art keywords
- plant
- gmnek1
- dna molecular
- sequence
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Cell Biology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a soybean GmNEK1 protein, and a coding gene and application of the soybean GmNEK1 protein. The invention provides the application of any one of the following 1)-3) substances to regulate and control plant stress tolerance, plant biomass, and/or plant yield, wherein the 1)-3) substances are 1) protein GmNEK1, 2) a DNA molecular for coding the protein GmNEK1, and 3) a recombinant vector, an expression kit, a transgenic cell line, or a recombinant bacterium containing the DNA molecular for coding the protein GmNEK1. The amino acid sequence of the protein GmNEK1 is the sequence 2 in the sequence table. Experiments in the invention prove that the protein and the coding gene of the protein are of great significance to cultivate a plant variety with stress tolerance and being high in grain yield and biomass.
Description
Technical field
The present invention relates to biological technical field, particularly relate to soybean GmNEK1 albumen and encoding gene thereof and application.
Background technology
The change of physics, chemical factor in environment, such as arid, saline and alkaline, damage to plants caused by sudden drop in temperature, freeze injury, Stress Factors and the biotic factor such as waterlogging, such as disease and pest has important impact to growing of plant, can cause the farm crop extensive underproduction time serious, cultivating resistance of reverse crop is one of major objective of plant husbandry.Improve the resistance of reverse of crop, except utilizing traditional breeding method, at present, molecular genetic breeding has become one of field that scientific worker pays close attention to.Abiotic with under the coercing of biotic stress, higher plant cell has number of ways to experience and replys the change of physico-chemical parameter in external environment, signal outside born of the same parents is become intracellular signal, nucleus is passed the signal along to through a series of phosphorylation cascade reaction, through the functional gene that transcription factor regulation and control are relevant, start the expression of induced gene in adversity, improve the resistance of reverse of plant.
Summary of the invention
An object of the present invention is to provide soybean GmNEK1 albumen and encoding gene thereof.
Albumen provided by the invention is following (a) or (b):
A protein that () is made up of the aminoacid sequence shown in sequence in sequence table 2;
B aminoacid sequence shown in sequence in sequence table 2 is had the protein derived by sequence 2 of identical function through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation by ().
In above-mentioned albumen, the replacement of one or several amino-acid residue described and/or disappearance and/or interpolation refer to the replacement of no more than ten amino-acid residues and/or disappearance and/or interpolation.
The DNA molecular of above-mentioned albumen of encoding also is the scope of protection of the invention.
Above-mentioned DNA molecular is any one DNA molecular in following (1)-(4):
(1) coding region is the DNA molecular shown in the sequence 1 in sequence table;
(2) coding region is for sequence in sequence table 1 is from the DNA molecular shown in 5 ' end 1-1827 position Nucleotide;
(3) DNA sequence dna limited with (1) or (2) is under strict conditions hybridized and has the DNA molecular of the albumen of identical function;
(4) DNA sequence dna limited with (1) or (2) at least has 70%, at least have 75%, at least have 80%, at least have 85%, at least have 90%, at least have 95%, at least have 96%, at least have 97%, at least have 98% or at least have 99% homology and have the DNA molecular of identical function.
Above-mentioned stringent condition is in the solution of 6 × SSC, 0.5%SDS, and hybridize at 65 DEG C, then use 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS respectively wash film once.
Recombinant vectors containing above-mentioned DNA molecular, expression cassette, transgenic cell line or recombinant bacterium are also the scope of protection of the invention.
Above-mentioned recombinant vectors is inserted in expression vector by above-mentioned DNA molecular, obtains the recombinant vectors of expressing above-mentioned albumen.
In an embodiment of the present invention, expression vector is pBIN438, and recombinant vectors is that sequence 1 is inserted from 5 ' end 1-1827 position Nucleotide the recombinant vectors obtained between BamHI and the KpnI restriction enzyme site of pBIN438 plant expression vector.
The primer pair of above-mentioned DNA molecular total length or its any fragment of increasing also is the scope of protection of the invention, specific as follows:
NEK1-F 5' CGCGGATCCATGGAGCAGTACGAAATTCTAGAAC 3'
NEK1-R 5' CGGGGTACCGGCCACAGTTTCCTTGAAGCTCT 3'
The application in regulating plant resistance of reverse, regulating plant biomass and/or regulating plant grain yield of above-mentioned albumen, above-mentioned DNA molecular or above-mentioned recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium is also the scope of protection of the invention;
Described regulating plant resistance of reverse is for improving plant stress tolerance;
Described regulating plant biomass is for improving phytomass;
Described regulating plant grain yield is for improving plant seed output.
Described resistance of reverse is specially salt tolerance, drought tolerance and/or low temperature resistant;
Described biomass is the wide and/or long embodiment of leaf especially by leaf.
Described plant is specially dicotyledons or monocotyledons.
Another object of the present invention is to provide a kind of method of cultivating transgenic plant.
Method provided by the invention, for the DNA molecular of the above-mentioned albumen of coding is imported object plant, obtain transgenic plant, described transgenic plant have following 1)-3) middle at least one feature:
1) resistance of reverse of described transgenic plant is higher than described object plant;
2) biomass of described transgenic plant is higher than described object plant;
3) grain yield of described transgenic plant is higher than described object plant.
In aforesaid method, described resistance of reverse is salt tolerance, drought tolerance and/or low temperature resistant;
Described biomass is the wide and/or long embodiment of leaf by leaf;
The DNA molecular of the above-mentioned albumen of described coding imports object plant by above-mentioned recombinant vectors.
In aforesaid method, described object plant is dicotyledons or monocotyledons.
Above-mentioned low temperature is-6 DEG C, and above-mentioned biomass is biomass of individual tree, and above-mentioned grain yield is embodied by 9 strain Seed weight.
Available existing plant expression vector construction contains the recombinant expression vector of GmNEK1 gene.
Described plant expression vector comprises double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment.Described plant expression vector also can comprise 3 ' end untranslated region of foreign gene, namely comprises the DNA fragmentation of polyadenylation signals and any other participation mRNA processing or genetic expression.The bootable polyadenylic acid of described polyadenylation signals joins 3 ' end of mRNA precursor, as Agrobacterium crown-gall nodule induction (Ti) plasmid gene (as kermes synthetic enzyme Nos gene), plant gene (as soybean storage protein genes) 3 ' hold the non-translational region of transcribing all to have similar functions.
When using GmNEK1 to build recombinant plant expression vector, any one enhancement type promotor or constitutive promoter can be added before its transcription initiation Nucleotide, as the ubiquitin promoter (Ubiquitin) of cauliflower mosaic virus (CAMV) 35S promoter, corn, they can be used alone or are combined with other plant promoter; In addition, when using gene constructed plant expression vector of the present invention, also enhanser can be used, comprise translational enhancer or transcriptional enhancer, these enhanser regions can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can be synthesis.Translation initiation region can from transcription initiation region or structure gene.
For the ease of identifying transgenic plant cells or plant and screening, can process plant expression vector used, the coding can expressed in plant as added can produce enzyme or the gene (gus gene, luciferase genes etc.) of luminophor, the antibiotic marker thing (gentamicin marker, kantlex marker etc.) with resistance or the chemical resistance reagent marker gene (as anti-weedkiller gene) etc. of colour-change.From the security consideration of transgenic plant, any selected marker can not be added, directly with adverse circumstance screening transformed plant.
Gene of the present invention imports in host by such as under type: inserted in expression cassette by gene of the present invention, then by expression cassette by the virus of plant expression vector, non-pathogenic self-replacation or do bacillus and import host.The expression vector carrying gene of the present invention is by using Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, conventional biology methods transformed plant cells or the tissue such as agriculture bacillus mediated.
Experiment of the present invention proves, present invention finds soybean GmNEK1 albumen and encoding gene thereof, and pass through transgenic experiments, verify that this albumen and gene thereof have and improve phytomass, grain yield and resistance of reverse function, proceed to the biomass of the plant of gene of the present invention, grain yield and resistance of reverse apparently higher than wild-type receptor plant, as transgenic arabidopsis, after supersalt, arid or subzero treatment, the recovery situation of transgenic plant significantly better than wildtype Arabidopsis thaliana, and survival rate, bolting rate etc. all comparatively control group be significantly increased.Simultaneously, proceed to every strain biomass of the transgenic plant of gene of the present invention and seed ultimate production also apparently higher than contrast, it is drought-enduring for each transgenic line of overexpression gene of the present invention, salt tolerant and lower temperature resistance and biomass of individual tree and grain yield are all proportionate with the expression amount of gene of the present invention in transfer-gen plant, show that albumen of the present invention and encoding gene thereof are to the resistance to inverse and high yield plant variety of cultivation further, particularly cultivate abiotic stress tolerance as drought-resistant and/or salt tolerant and/or low temperature resistant and high yield plant variety, thus it is significant to improve crop yield.Therefore, albumen of the present invention and encoding gene thereof have broad application prospects.
Accompanying drawing explanation
The expression of GmNEK1 gene when Fig. 1 is Ficus caricaL soybean seedling
Fig. 2 is GmNEK1 over-express vector schematic diagram
Fig. 3 is GmNEK1 process LAN transgenic line Molecular Identification
Fig. 4 is GmNEK1 process LAN Arabidopis thaliana phenotype under normal operation
Fig. 5 is that the biomass of GmNEK1 process LAN plant and grain yield compare
Fig. 6 is GmNEK1 process LAN strain and to the phenotype impinged upon under different salt concn
Fig. 7 is GmNEK1 process LAN strain and to the phenotype impinged upon when soil moisture content is 30%
Fig. 8 is the phenotype of GmNEK1 process LAN strain and contrast subzero treatment 24h
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
Agrobacterium GV3101 bacterial strain is documented in Clough-SJ, Bent-AF.Floral dip:a simplifiedmethod for Agrobacterium-mediated transformation of Arabidopsis thaliana.Plant-Journal.1998,16:6, in 735-743, the public can obtain from Chinese Academy of Sciences's heredity with developmental biology institute.
Columbia ecotype Arabidopis thaliana (col-0): seed purchased from Arabidopsis Biological ResourceCenter (ABRC), hereinafter referred to as wildtype Arabidopsis thaliana.
PBIN438 carrier (binary expression vector) is bestowed by square Rong Xiang academician.Be recorded in Li Taiyuan, Yingchuan, field, Qin Xiaofeng, Deng. the research [J] of efficient pest-resistant transgene tobacco. Chinese science (B collects), 1994,24 (3): 276-282.), public's classical prescription Rong Xiang academician can obtain from Chinese Academy of Sciences's heredity with developmental biology institute after agreeing to.
Soybean in embodiment is that rich No. 1 of large pulse family (Glycine max L.Merr.Kefeng 1) is documented in W.K.Zhang, Y.J.Wang, G.Z.Luo, J.S.Zhang, C.Y.He, X.L.Wu, J.Y.Gai, S.Y.Chen, QTL mapping of ten agronomic traits on the soybean (Glycine max L.Merr.) genetic map and their association with EST markers, Theor.Appl.Genet, 2004, in 108:1131-1139, the public can obtain from Chinese Academy of Sciences's heredity with developmental biology institute.
The clone of embodiment 1, soybean GmNEK1 gene
1, the clone of GmNEK1 gene
The method of guanidinium isothiocyanate-phenol-chloroform is adopted to carry out extracting rich No. 1 of large pulse family (Glycine max L.Merr.Kefeng 1) total serum IgE (Zhang et al.2001 A two-component gene (NTHK1) encodinga putative ethylene-receptor homolog is both developmentally andstress-regulated in tobacco.Theor Appl Genet 102:815-824), Promega test kit (purchased from Promega company) PolyAT tract mRNA isolation system IV is used to carry out mRNA separation and purification, being separated the mRNA ultraviolet spectrophotometer obtained carries out quantitatively, then reverse transcription obtains cDNA.According to corresponding gene sequences in the soybean genomic sequence announced, design primer:
NEK1-F 5' CGCGGATCCATGGAGCAGTACGAAATTCTAGAAC 3'
NEK1-R 5' CGGGGTACCGGCCACAGTTTCCTTGAAGCTCT 3'
The cDNA obtained with reverse transcription is template, carries out pcr amplification with above-mentioned primer.Carry out 0.8% agarose gel electrophoresis detection to PCR primer, result shows, the size of pcr amplification product is about 1.8kb, conforms to expected results.
Reclaim test kit (TIANGEN) with sepharose and reclaim this fragment.By this recovery fragment and pGEM-T Easy(Promega) be connected, with reference to the method for Cohen etc., product conversion bacillus coli DH 5 alpha competent cell being connected, according to the carboxylic Bian penicillin resistance label screening positive colony on pGEM-T Easy carrier, obtaining the recombinant plasmid containing reclaiming fragment.With T7 and the SP6 promoter sequence on this recombinant plasmid vector, for primer pair, it carries out nucleotide sequencing, sequencing result shows that this PCR primer has the nucleotide sequence of the sequence 1 in sequence table, the unnamed gene of this PCR primer is GmNEK1, its ORF be sequence 1 from 5 ' end 1-1830 position Nucleotide.The protein designations of this genes encoding is GmNEK1, and the aminoacid sequence of this albumen is the sequence 2 of sequence table, and the sequence 2 in sequence table is made up of 609 amino acid.
2, the expression pattern under salt stress of GmNEK1 gene
The root system of the soybean seedling in 2 week age is placed in the 200mM NaCl aqueous solution, samples after 0 hour, 3 hours, 6 hours and 12 hours in illumination cultivation respectively.Prepare the total serum IgE of each sample, every swimming lane applied sample amount is 15 μ g, take GmNEK1 as probe, carries out Real-time pcr analysis.
Result as shown in Figure 1, can be found out, 200mM NaCl process 3 is constantly little, and namely the expression of GmNEK1 gene obviously raises, and reaches the highest at 6 hours expression amounts, declines when 12 hours afterwards, but still higher than time untreated.Therefore GmNEK1 is salt responsive genes.
Embodiment 2, the GmNEK1 application in regulation and control Arabidopis thaliana resistance of reverse
One, the acquisition of process LAN GmNEK1 Arabidopis thaliana strain
1, the structure of recombinant vectors
With the cDNA of large pulse family rich 1 for template, carry out pcr amplification with primer NEK1-F and NEK1-R, obtain the PCR primer of 1.8kb, be GmNEK1 full-length cDNA.
By the above-mentioned PCR primer of BamHI and KpnI double digestion, reclaim digestion products, digestion products is connected with the plant expression vector pBIN438 cut through same enzyme, obtains recombinant vectors pBin438-GmNEK1(structural representation as Fig. 2).
Through order-checking, this recombinant vectors is that sequence 1 is inserted from 5 ' end 1-1827 position Nucleotide the recombinant vectors obtained between BamHI and the KpnI restriction enzyme site of pBIN438 plant expression vector, and direction of insertion is the insertion of GmNEK1 forward.
2, the acquisition of process LAN GmNEK1 Arabidopis thaliana strain
Recombinant vectors pBin438-GmNEK1 electric shock conversion method is imported Agrobacterium GV3101 bacterial strain (Clough-SJ, Bent-AF.Floral dip:a simplified method for Agrobacterium-mediatedtransformation of Arabidopsis thaliana.Plant-Journal.1998,16:6,735-743; The public can obtain from Chinese Academy of Sciences's heredity with developmental biology institute.), obtain recombinant bacterium GV3101/pBin438-GmNEK1.
Recombinant bacterium is carried out bacterium liquid PCR to identify, primer is:
RNEK1-F:5’-AATCATCCGCATCTTCAACCTT
RNEK1-R:5’-TTGCTGAATGAGAATCGTTTGC
Obtain about 1.8kb fragment recombinant bacterium extract plasmid order-checking, result for this plasmid be pBin438-GmNEK1, by the recombinant bacterium called after GV3101/pBin438-GmNEK1 containing plasmid.
Single bacterium colony of picking GV3101/pBin438-GmNEK1, in 5mlLB, cultivates 8-12 hour in 28 DEG C, then is transferred to continuation cultivation 3-6 hour in 200mlLB, is resuspended in LB substratum and obtains conversion fluid after receiving bacterium.The flower of wildtype Arabidopsis thaliana (Arabidopsis thaliana) Col-0 is soaked in 10s in conversion fluid, put into MS substratum lucifuge after taking-up and cultivate 8-12 hour, obtain T0 for transformed the seed, being sowed on the MS substratum containing kantlex (50mg/L), being obtained 31 strain T0 for turning GmNEK1 Arabidopis thaliana.
3, process LAN GmNEK1 Arabidopis thaliana strain Molecular Identification
Extract the RNA that above-mentioned 31 strain T0 generations turn GmNEK1 Arabidopsis plant, and reverse transcription obtains cDNA, carry out RT-PCR qualification respectively, primer is the same.
Partial results is shown in Fig. 3, is the expression amount of GmNEK1 in process LAN plant and the expression amount ratio contrasted in Col0, can finds out, the expression amount of GmNEK1 in contrast wildtype Arabidopsis thaliana is almost 0.In identified 5 transgenic lines, in 1-26, the relative expression quantity of GmNEK1 is the highest, takes second place in 1-27, in 1-25 in the three, 1-22 the 4th, though and in 1-18 GmNEK1 expression amount higher than contrast, low compared with other plant.
Therefore, T0 is process LAN GmNEK1 Arabidopis thaliana strain for turning GmNEK1 Arabidopis thaliana.
In above-mentioned T0 generation, turns GmNEK1 Arabidopis thaliana strain 1-25,1-26,1-27,1-18 and 1-22 through the step sizing of 3 generations, obtains T3 respectively for turning GmNEK1 Arabidopis thaliana pure lines 1-25,1-26,1-27,1-18 and 1-22.
Adopting and use the same method, empty carrier pBIN438 carrier is proceeded in wildtype Arabidopsis thaliana (Arabidopsisthaliana) Col-0, obtaining T0 for turning empty carrier Arabidopis thaliana, detect according to the method described above, there is no the expression of goal gene, selfing, until obtain T3 generation to turn empty carrier Arabidopis thaliana.
Two, process LAN GmNEK1 Arabidopis thaliana strain phenotype analytical
Is turned GmNEK1 Arabidopis thaliana pure lines 1-25,1-26,1-27,1-18 and 1-22 T3 generation, T3 generation turns empty carrier Arabidopis thaliana and wildtype Arabidopsis thaliana Col-0 kind in vermiculite, observe each plant phenotype.Experiment repetition 3 times, results averaged.
As shown in Figure 4, be the phenotype in wildtype Arabidopsis thaliana Col-0 and transgenic line seedling stage, heading stage and ripening stage, as seen from the figure, interim all three time, in T3 generation, turns GmNEK1 Arabidopis thaliana pure lines strain growing way and is all obviously better than wildtype Arabidopsis thaliana Col-0 result.
Fig. 5 has added up wildtype Arabidopsis thaliana Col-0 and T3 generation and has turned that GmNEK1 Arabidopis thaliana is sheerly that each strain leaf is wide, leaf is long and every 9 strain Seed weight (because the seed of Arabidopis thaliana is very little, for convenience of weighing, in units of 9 strains), and result is as follows:
The leaf of Col-0,1-18,1-22,1-25,1-26 and 1-27 is wide to be about respectively: 5.7,7.2,6.7,8.4,8.6 and 8.5 millimeters, and leaf is long to be about respectively: 19.0,27.0,22.5,30.5,30.0 and 31.0 millimeters; Every 9 strain Seed weight of Col-0,1-22,1-25 and 1-26 are about respectively: 0.98,0.97,1.20 and 1.19 gram.
The above results shows, under normal operation, the Ye Kuanjun of all transgenic lines is extremely significantly greater than Col-0, and the leaf length of 1-18,1-25,1-26 and 1-27 is extremely significantly greater than Col-0 1-22 and is then significantly greater than Col-0.Seed weight mean number shows, 1-25 and 1-26 significantly overweights Col-0, and 1-22 and Col-0 does not have notable difference.In 1-22 strain, the expression amount of foreign gene GmNEK1 is starkly lower than other transgenic line, and the biomass represented by Ye Kuan, leaf are long and Seed weight statistical number all show that the difference of itself and Col-0 is lower than other transgenic line.
In T3 generation, turns empty carrier Arabidopis thaliana and wildtype Arabidopsis thaliana Col-0 result as significant difference.
Therefore, the character mutation turning GmNEK1 Arabidopis thaliana is relevant to the expression level of GmNEK1, and the expression amount of the biomass of transgenic line and Seed weight and GmNEK1 is proportionate.
Three, the salt tolerant of process LAN GmNEK1 Arabidopis thaliana strain, drought-enduring and low temperature resistant qualification
1, Salt-Tolerance Identification
In T3 generation, is turned GmNEK1 Arabidopis thaliana pure lines 1-25,1-26,1-27,1-18 and 1-22, T3 generation turn empty carrier Arabidopis thaliana grow 5 days on MS substratum with wildtype Arabidopsis thaliana Col-0 and grow consistent seedling move to contain 125mM and 150mM NaCl respectively MS substratum on continued growth 9 and 7 days.Each 15 strains of all kinds of strain, test in triplicate, results averaged.
As shown in Figure 6, A is Phenotypic Observation (left figure) and numerical statistic result (right figure) under 125mM NaCl process to survival rate statistics, and B is Phenotypic Observation (left figure) and numerical statistic result (right figure) under 150mM NaCl process;
Can find out, Col-0 and 1-18,1-22,1-25,1-26 and 1-27 are when 125mM NaCl process, and survival rate is about respectively: 55%, 72%, 62%, 94%, 96% and 94%; During 150mM NaCl process, survival rate is about respectively: 29%, 50%, 40%, 66%, 85% and 63%.
In transfer-gen plant, the expression amount of GmNEK1 is minimum in 1-22, takes second place in 1-18, is that in 1-26 and 1-27,1-26, expression amount is the highest afterwards.
In T3 generation, turns empty carrier Arabidopis thaliana and wildtype Arabidopsis thaliana Col-0 result as significant difference.
The result of Fig. 6 shows, under two salt concn are coerced, the survival rate of 1-25,1-26 and 1-27 is all significantly higher than contrast in pole, and the survival rate of 1-18 is significantly higher than contrast, and the survival rate of 1-22 is higher than contrast, but not remarkable.In all transgenic lines, the survival rate of 1-26 is the highest, and in this result and transgenic line, the expression amount of GmNEK1 is proportionate.Therefore the salt tolerance of transgenic line is caused by the process LAN due to GmNEK1.
2, drought tolerance qualification
Is turned GmNEK1 Arabidopis thaliana pure lines 1-25,1-26,1-27,1-18 and 1-22 T3 generation, T3 generation turns after empty carrier Arabidopis thaliana and wildtype Arabidopsis thaliana Col-0 grown to 2 true leaves on MS substratum, grow consistent transplantation of seedlings to recover 3 days to vermiculite, water content in vermiculite is made to be held in 30%, after 14 days, get over-ground part, individual plant is dried, and weighs.In experiment, each strain all gets 15 strains, tests in triplicate, results averaged.
Result as shown in Figure 7, Col-0,1-18,1-22,1-25,1-26 and 1-27 total dry weight is about respectively: 0.0180,0.0220,0.0205,0.0240,0.0265 and 0.0270, wherein, 1-26 and 1-27 has pole significant difference compared with the control, the dry weight of 1-25 and 1-18 is significantly higher than contrast, and the dry weight of 1-18 is higher than contrast.The above results and the GmNEK1 expression in transgenic line conforms to substantially.
In T3 generation, turns empty carrier Arabidopis thaliana and wildtype Arabidopsis thaliana Col-0 result as significant difference.
Therefore the process LAN of GmNEK1 gene can improve the drought tolerance of plant.
3, low temperature resistant qualification
Is turned GmNEK1 Arabidopis thaliana pure lines 1-25,1-26,1-27,1-18 and 1-22 T3 generation, T3 generation turns after empty carrier Arabidopis thaliana and wildtype Arabidopsis thaliana Col-0 grow to 7 days on MS substratum, grow consistent transplantation of seedlings to recover 3 days to vermiculite, process 24 hours-4 DEG C and-6 DEG C respectively, recover 4 days at normal temperatures.
Observe phenotype as shown in Figure 8, can find out, after-4 DEG C of process, in T3 generation, turns GmNEK1 Arabidopis thaliana and compares with wildtype Arabidopsis thaliana Col-0, and-4 DEG C of process process 24 hours GmNEK1 process LAN strains and contrast have no notable difference; After-6 DEG C of process, in T3 generation, turns GmNEK1 Arabidopis thaliana and compares with wildtype Arabidopsis thaliana Col-0, and growth conditions is better than wildtype Arabidopsis thaliana Col-0.
Add up the survival rate of-6 DEG C of subzero treatment 24h, as shown in Figure 8, the survival rate of Col-0,1-18,1-22,1-25,1-26 and 1-27 is about respectively: 13%, 38%, 25%, 87%, 95% and 79%, the survival rate of 1-22 is significantly higher than contrast, and other transgenic line all pole is significantly higher than Col-0.
In T3 generation, turns empty carrier Arabidopis thaliana and wildtype Arabidopsis thaliana Col-0 result as significant difference.
The expression amount of this result and GmNEK1 is proportionate, and shows that the overexpression of GmNEK1 improves low temperature resistant (-6 DEG C) proterties of transfer-gen plant.
In sum, the overexpression of GmNEK1, improves the biomass of transfer-gen plant, grain yield and salt tolerant, drought-enduring and low temperature resistant proterties.And the expression amount of above-mentioned proterties and GmNEK1 is proportionate.Therefore, process LAN GmNEK1 gene in recipient plant, is expected to the output and the resistance of reverse that improve recipient plant.
Claims (10)
1. an albumen is following (a) or (b):
A protein that () is made up of the aminoacid sequence shown in sequence in sequence table 2;
B aminoacid sequence shown in sequence in sequence table 2 is had the protein derived by sequence 2 of identical function through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation by ().
2. the DNA molecular of albumen described in coding claim 1.
3. DNA molecular as claimed in claim 2, is characterized in that: described DNA molecular is any one DNA molecular in following (1)-(4):
(1) coding region is the DNA molecular shown in the sequence 1 in sequence table;
(2) coding region is for sequence in sequence table 1 is from the DNA molecular shown in 5 ' end 1-1827 position Nucleotide;
(3) DNA sequence dna limited with (1) or (2) is under strict conditions hybridized and has the DNA molecular of the albumen of identical function;
(4) DNA sequence dna limited with (1) or (2) at least has 70%, at least have 75%, at least have 80%, at least have 85%, at least have 90%, at least have 95%, at least have 96%, at least have 97%, at least have 98% or at least have 99% homology and have the DNA molecular of identical function.
4. the recombinant vectors containing DNA molecular described in Claims 2 or 3, expression cassette, transgenic cell line or recombinant bacterium.
5. recombinant vectors as claimed in claim 4, is characterized in that:
Described recombinant vectors, for being inserted in expression vector by DNA molecular described in Claims 2 or 3, obtains the recombinant vectors of expressing albumen described in claim 1.
6. the primer pair of DNA molecular total length or its any fragment described in Claims 2 or 3 of increasing.
7. recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium application in regulating plant resistance of reverse, regulating plant biomass and/or regulating plant grain yield described in DNA molecular described in albumen, Claims 2 or 3 described in claim 1 or claim 4;
Described resistance of reverse is specially salt tolerance, drought tolerance and/or low temperature resistant;
Described biomass is the wide and/or long embodiment of leaf especially by leaf.
Described plant is specially dicotyledons or monocotyledons.
8. cultivate a method for transgenic plant, for the DNA molecular of albumen described in coding claim 1 is imported object plant, obtain transgenic plant, described transgenic plant have following 1)-3) middle at least one feature:
1) resistance of reverse of described transgenic plant is higher than described object plant;
2) biomass of described transgenic plant is higher than described object plant;
3) grain yield of described transgenic plant is higher than described object plant.
9. method according to claim 8, is characterized in that: described resistance of reverse is salt tolerance, drought tolerance and/or low temperature resistant;
Described biomass is the wide and/or long embodiment of leaf by leaf;
The DNA molecular of albumen described in described coding claim 1 imports object plant by the recombinant vectors described in claim 4 or 5.
10. method according to claim 8 or claim 9, is characterized in that:
Described object plant is dicotyledons or monocotyledons.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410049570.XA CN104844699B (en) | 2014-02-13 | 2014-02-13 | Soybean GmNEK1 albumen and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410049570.XA CN104844699B (en) | 2014-02-13 | 2014-02-13 | Soybean GmNEK1 albumen and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104844699A true CN104844699A (en) | 2015-08-19 |
| CN104844699B CN104844699B (en) | 2018-06-05 |
Family
ID=53844724
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410049570.XA Expired - Fee Related CN104844699B (en) | 2014-02-13 | 2014-02-13 | Soybean GmNEK1 albumen and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104844699B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110938119A (en) * | 2018-09-20 | 2020-03-31 | 中国农业科学院作物科学研究所 | Soybean stress resistance related protein GmBES and application of coding gene thereof |
-
2014
- 2014-02-13 CN CN201410049570.XA patent/CN104844699B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| XP_003518907.1: "XP_003518907.1", 《GENBANK》 * |
| 俞嘉宁: "小麦耐旱、耐盐相关基因的克隆、分析与功能研究", 《中国博士学位论文全文数据库农业科技辑》 * |
| 杨乐等: "植物抗逆相关蛋白激酶的结构与功能", 《植物遗传资源学报》 * |
| 陈新: "大豆耐盐基因GmZnF1和GmPK6的耐逆功能研究", 《中国优秀硕士学位论文全文数据库基础科学辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110938119A (en) * | 2018-09-20 | 2020-03-31 | 中国农业科学院作物科学研究所 | Soybean stress resistance related protein GmBES and application of coding gene thereof |
| CN110938119B (en) * | 2018-09-20 | 2021-05-18 | 中国农业科学院作物科学研究所 | Soybean stress resistance related protein GmBES and application of coding gene thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104844699B (en) | 2018-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11566053B2 (en) | Plant traits conferred by isolated polynucleotides and polypeptides | |
| CN101503467B (en) | Plant stress tolerance related transcription factor GmNAC20, coding gene and use thereof | |
| CN101173002B (en) | Plants stress tolerance correlation transcription factor GmWRKY54, encoding gene and application thereof | |
| WO2011015985A2 (en) | Polynucleotides and polypeptides for increasing desirable plant qualities | |
| BRPI0712507A2 (en) | method for enhancing yield-related characteristics of plants, plants or parts thereof, construction use of a plant, plant part or plant cell construction, method for producing a transgenic plant, harvestable parts of a plant, products, use of a nucleic acid, isolated nucleic acid molecule and isolated polypeptide | |
| US20190085355A1 (en) | Drought tolerant maize | |
| CN111153975B (en) | Plant drought-resistant related protein TaNAC15, and coding gene and application thereof | |
| US20140245497A1 (en) | Drought tolerant plants and related constructs and methods involving genes encoding ferredoxin family proteins | |
| CN102399268B (en) | Plant stress tolerance-related transcription factor GmNAC11, coding gene and application thereof | |
| CN102105590B (en) | Plants having altered agronomic characteristics under nitrogen limiting conditions and related constructs and methods involving genes encoding LNT1 polypetides and homologs thereof | |
| US20140068811A1 (en) | Drought tolerant plants and related constructs and methods involving genes encoding zinc-finger (c3hc4-type ring finger) family polypeptides | |
| CN101659699B (en) | Plant stress resistance-related protein GmSIK2 and coding gene and application thereof | |
| WO2019130018A1 (en) | Methods of increasing yield and/or abiotic stress tolerance | |
| MX2014007711A (en) | Methods for improving crop yield. | |
| CN111072762B (en) | Mao bamboo senescence-associated NAP transcription factor, and coding gene and application thereof | |
| CN102653556B (en) | Plant adverse resistance related transcription factor GmWRKY78 as well as encoding gene and application thereof | |
| WO2018009600A2 (en) | Modulation of rice mpg1 activity to increase biomass accumulation, grain yield, and stress tolerance in plants | |
| CN114591409B (en) | Application of TaDTG6 protein in improving drought resistance of plants | |
| CN114560919B (en) | Plant drought tolerance related transcription factor VcMYB and coding gene and application thereof | |
| CN103588866A (en) | Plant stress tolerance related transcription factor TaWRKY16, and coding gene and application thereof | |
| CN103588867B (en) | Soybean transcription factor GmMYB174a, and coding gene and applications thereof | |
| CN104945492A (en) | Plant stress tolerance associated protein TaAREB3 as well as encoding gene and application thereof | |
| CN105175522B (en) | Crowtoe AP2/ERF transcription factors and its encoding gene and application | |
| CN114015700A (en) | Application of soybean gene GmFER1 in salt stress resistance of plants | |
| CN104140462A (en) | Plant salt tolerance related protein GhSnRK2-6, and coding gene and applications thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180605 Termination date: 20200213 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |