CN104833662B

CN104833662B - Glycosylated hemoglobin kit and its detection method based on nucleic acid aptamer fluorescence probe

Info

Publication number: CN104833662B
Application number: CN201510105623.XA
Authority: CN
Inventors: 李寿东; 胡建红; 李戈强; 李朝君; 谢志峰; 李朝志
Original assignee: GUANGXI ANRENXIN BIOTECHNOLOGY CO Ltd
Current assignee: GUANGXI ANRENXIN BIOTECHNOLOGY CO Ltd
Priority date: 2012-11-14
Filing date: 2012-11-14
Publication date: 2017-08-29
Anticipated expiration: 2032-11-14
Also published as: CN104833662A; CN105044053A; CN104833663A; CN102998289B; CN102998289A; CN105044053B; CN104833663B

Abstract

The present invention relates to a kind of glycosylated hemoglobin GHb kits based on nucleic acid aptamer fluorescence probe, while the invention further relates to determine the method for glycosylated hemoglobin GHb concentration, determine reagent composition and composition, belonging to medical test determination techniques field.The kit main component of the present invention includes：Erythrocyte cracked liquid, phosphate buffer PBS, glycosylated hemoglobin GHb standard items, glycosylated hemoglobin GHb nucleic acid aptamer fluorescence probes；Cracked by blood sample, mix ovum and educate processing, with reference to sepectrophotofluorometer detection, so as to calculate glycosylated hemoglobin GHb concentration.The present invention has sample treatment simple, and easy to operate, detection time is short, detects high specificity, and sensitivity is high, the advantages of testing result repeatability is high.

Description

Glycosylated hemoglobin kit and its detection method based on nucleic acid aptamer fluorescence probe

Technical field

The invention belongs to medical test determination techniques field, the saccharification blood more particularly to based on nucleic acid aptamer fluorescence probe Lactoferrin GHb kits and its detection method.

Background technology

Diabetes are the worldwide public health problems of human health, and diabetes are a kind of lifelong disease, its complication It is to residual main cause till death, so it is desirable to find and treat diabetes as early as possible.Traditional diabetes diagnosis and control Monitoring is treated using fasting blood-glucose, postprandial blood sugar and oral glucose tolerance test etc., but glycemic parameters are when only representing blood drawing Moment blood sugar level, and glycosylated hemoglobin (GHb) is as the goldstandard of reflection long-term blood glucose level, is also monitoring diabetes The important indicator for the treatment of.GHb is that hemoglobin slowly, persistently and irreversibly carries out non-enzymatic protein with glucose in red blood cell Be saccharified the product reacted.Formed and be difficult to separate after two weeks.When the concentration of glucose in blood is higher, the GHb that human body is formed contains Amount also can be under of a relatively high normal physiological conditions, and the growing amount of non-enzymatic saccharification reaction product and the concentration of reactant are into just Than.Because protein concentration keeps relative stability, saccharification level depends mainly on concentration of glucose, also with protein and glucose The time length of contact is relevant.GHb can reflect the average blood glucose levels of nearest 2-3 months.American Diabetes Association in 2002 Clear stipulaties answer periodic detection GHb, and are marked as the gold of monitoring diabetes glucose control.Diabetes Mellitus Knowledge is popularized, more New treatment concept, monitors and keeps GHb up to standard, earlier, more reasonably using drug therapies such as insulin, for control diabetes The generation development of complication is particularly important.

Conventional glycosylated hemoglobin GHb detection method has following several types at present：

High pressure liquid phase process (HPLC)：Can automatically separation determination GHb and hemalbumin variant and hypotype, but instrument Operation maintenance requires higher, within CV values 1%, it is difficult to popularized in the hospital of relatively basic unit and laboratory；Microtrabeculae method manual operations step Rapid cumbersome, the quality of chromatography time and microtrabeculae is difficult to control, and is also easy to produce operating technology error, repeatability is not good enough；And disturb because Plain a lot, the change especially to pH value and temperature is sensitive, and HbF and variation hemoglobin (HbS, HbC, HbE etc.) are disturbed result, Depending on disturbing separating capacity of the degree according to post, and collection of illustrative plates is examined, so the method cannot be used generally.

Immunization method：Immunization method is current using more detection means, mainly including following several detection modes.

（1）Turbidimetry：It is measured using the principle of antigen, antibody response.GHb B chains N-terminal provides one easily The epitope recognized by antibody, is constituted with last 4~6 amino acid of monoclonal antibody specific recognition GHb B chain N-terminals Epitope, with reference to turbidimetry for Determination.

（2）Ion capture：Using antigen-antibody reaction principle, parallel connection is electronegative by connecting with fluorescent marker Polyanionic compound, is adsorbed onto the fiber surface of positively charged, after a series of steps such as thoroughly cleanings, determines fluorescence strong Rate of change is spent, GHb concentration is calculated.

（3）Latex Agglutination：The method that HbAlc percentage composition in total lib is directly determined using antigen-antibody reaction.Sample Total Hb and GHb and latex have an identical non-specific adsorption and immobilization in product, when the monoclonal antibody specific for adding HbAlc The compound of the anti-human GHb monoclonal antibodies of the GHb. mouse of latex one is formed afterwards, and this compound forms aggegation due to sheep anti-mouse antibody, Aggegation amount is different and different because the immobilised GHb amounts of latex surface.By determine its absorbance and with the mark of GHb percentage concentrations Directrix curve relatively after can obtain the percentage composition of Hb shared by GHb in sample.Its accuracy of immunization measure glycosylated hemoglobin It is weak with repeatability, measure is disturbed by materials such as high concentration glucose, high triglyceride, high bilirubin, due to sample Turbidity can make photometric determination produce mistake.In addition, antibody is obtained by animal immune, cost is high and the screening cycle is long, batch with Had differences between batch；Antibody is sensitive to temperature humidity, and mutability is difficult to ensure the shortcomings of depositing.

Affinity chromatography：Cleaning Principle is used as by the use of the affine experiment of boronation.The reagent energy lysed erythrocyte of the method is simultaneously special Property the precipitate hemoglobin factor, wherein blueness boric acid conjugate can and glycosylated hemoglobin on Cis-diols be combined.Blood Liquid add reagent in, red blood cell dissolves immediately, whole hemoglobins is all precipitated, boric acid conjugate just and GHb in cis- Diol structures are combined.Filter membrane device is added after blood and reagent mixing, the hemoglobin of all precipitations, either and conjugate With reference to or the uncombined top for remaining on filter membrane.Excessive colour developing conjugate is just washed liquid and washed off.Pass through gold demarcation Measure instrument and determine blueness（Glycosylated hemoglobin）And red（Total hemoglobin）Intensity, the percentage of the GHb in sample can be calculated Than.

Aptamer is the new identification molecule of a class that developed recently gets up, in recent years by the extensive pass of scientist Note, largely is screened out for the aptamer of important physiologically active molecule；The various analysis sides based on aptamer Method and technology have been reported；Aptamer medicine " Macugen " has also been listed in 2005 by FDA official approvals.SELEX skills The oligonucleotide sequence that art screening is obtained is referred to as aptamer, and domestic its, which is translated as aptamer, nucleic acid aptamer, nucleic acid, to be known Body or aptamer etc..SELEX technologies refer to the random oligonucleotide of applied chemistry method synthesis Large Copacity (by consolidating for two ends Sequencing arranges the random sequence composition with centre) library, by applying selection pressure, (with reference to target, elutriation and target are highly The process of specific bond fragment), and Amplification Technologies are combined, the circulation selective enrichment through excessively taking turns is obtained and target substance The oligonucleotide molecules that high special is combined, can be that RNA can also be DNA, length is generally 25 ~ 60 nucleotides.

Pyrene is a kind of flammable faint yellow monoclinic crystal organic compound, and its molecular structure below figure 1 is water insoluble, easily It is dissolved in ethanol, ether.Parental materials, such as halogenation, nitrification, sulfonation reaction can be carried out.Pyrene is primarily present in coal tar asphalt In distillation.Pyrene is organic synthesis raw material, oxidized to produce Isosorbide-5-Nitrae, and 5,8- naphthalenetetracarbacidic acidics for dyestuff, synthetic resin, disperse Property dyestuff and engineering plastics；Can the gorgeous orange GR of reducing dye processed and other a variety of dyestuffs after acylation；Can also insecticide processed, plasticizer Deng；Current pyrene molecule can be used in the detection method based on aptamer as fluorescence probe.

Fluorescent dye pyrene, when an excited state molecule（*Py）With another ground state molecule（Py）When closely experience Excitation state dimer can be formed（*Py+Py）, a photon can be discharged in the position longer than pyrene monomer wavelength.Pyrene excitation state two Aggressiveness has flat emission peak one wide at 480 to 500nm, and this emission peak is easy to differentiate；Because even pyrene list The emission peak of body is also very wide, but pyrene monomer emission peak 370 between 400nm.With fluorescent resonance energy transfer type seemingly, Forming excitation state dimer has strict distance dependencies, is conducive to Development of Novel nucleic acid probe.Two pyrene molecules are distinguished The two ends of molecular beacon are connected to, " excitation state dimer-monomer conversion hysteria " molecular beacon is designed to, target dna is carried out Detection；One end that two pyrene molecules are connected to molecular beacon is used as fluorophor, other end connection fluorescent quenching group, nucleic acid Fit and measured target combination causes its space structure to change, and makes the pyrene molecule at two ends close and forms excitation state dimerization Body, by detecting the fluorescence intensity and fluorescence lifetime of aptamer probe, it is achieved thereby that the highly sensitive detection to measured target.

Aptamer is combined presented hypersensitivity and high specific with target substance, it is had in medical diagnosis on disease Good application prospect, although clinical practice report ripe at present is less, using the research of fit detection target protein It is on the increase, is also continuously emerged based on fit new detecting technique.Aptamer turns into due to its unique chemical antibody characteristic A new generation is directed to the molecular medicine or targeting vector of specific protein, and for detecting the target molecule material of its specific recognition. But the glycosylated hemoglobin GHb diagnostic reagents that are directed to for being currently based on aptamer also lack very much, and it is directed to HbAle The exploitation of Protein G Hb nucleic acid aptamer fluorescence probe detection kit is there is not yet report.

The content of the invention

The purpose of the present invention is to be also easy to produce that operating technology error, the not good enough, disturbing factor of repeatability be a lot, behaviour for existing Make cumbersome, testing cost it is high etc. it is not enough there is provided a kind of glycosylated hemoglobin GHb kits based on nucleic acid aptamer fluorescence probe and Its detection method.

The solution of the present invention is by being achieved in that：

A kind of glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe, it is characterised in that main component includes： Containing NH₄Cl、Tris、EDTA-Na₂Erythrocyte cracked liquid；Containing MgCl₂0.2M phosphate buffers；Glycosylated hemoglobin standard Product；Glycosylated hemoglobin nucleic acid aptamer fluorescence probe；The glycosylated hemoglobin nucleic acid aptamer fluorescence probe is 5' and 3' two ends The nucleotide single-chain of difference mark fluorescent pyrene molecule monomer, the nucleotide single-chain sequence is SEQ ID NO:1~SEQ ID NO:4 In any one sequence dna fragment, its sequence is：

SEQ ID NO:1：gggaggcatg tgtgctaagg cgtagcaggg ttggaaccc；

SEQ ID NO:2：gggaggcatg tgatttaagg cgcggcagat gttggaaccc；

SEQ ID NO:3：gggaggcatg agacctatgg cgttgcattg gttggaaccc；

SEQ ID NO:4：gggaggcatg ggaaacaatg cgccgcagag ttggaaccc.

A kind of above-described glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe, it is described to contain NH₄Cl、 Tris、EDTA-Na₂Erythrocyte cracked liquid to contain 1 ~ 280 mmol/L NH₄Cl, 1~34 mmol/L Tris,1~2mmol/ LEDTA-Na₂, pH 7.0~7.2；It is described to contain MgCl₂0.2M phosphate buffers to contain 1 ~ 10mmol/L MgCl₂。

A kind of glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe described in any of the above, its feature exists In described to contain NH₄Cl、Tris、EDTA-Na₂Erythrocyte cracked liquid, containing MgCl₂0.2M phosphate buffers, HbAle egg White standard items, glycosylated hemoglobin nucleic acid aptamer fluorescence probe are to prepare the liquid reagent directly used or need to add before using The dry powder of water dissolving.

Above-described a kind of glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe, it is characterised in that should Kit is used to detect the glycosylated hemoglobin concentration in anticoagulant heparin whole blood or peripheral blood.

It is a kind of to detect saccharification with the glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe described in any of the above The method of hemoglobin concentration, it is characterised in that method and step includes：

（1）Blood sample is cracked：By blood sample and containing NH₄Cl、Tris、EDTA-Na₂Erythrocyte cracked liquid press 1:0.5 ~ 5 volume ratio Mix, stand 5 ~ 30min, then 5 ~ 10min of medium-speed centrifuge, collect supernatant；

（2）Mixing ovum is educated：Mixing ovum is educated：Take 20 ~ 100 μ l steps 1）Obtained supernatant and 30 ~ 50ul use contains MgCl₂0.2M phosphate buffers, the obtained glycosylated hemoglobin nucleic acid of the dissolving saccharification fit fluorescence probe of haemoglobin nucleic acid Fit fluorescence probe reagent mixing, ovum educates 5 ~ 15min at room temperature, glycosylated hemoglobin nucleic acid aptamer fluorescence probe is filled with blood sample Divide and combine, obtain test fluid；

（3）Fluoroscopic examination：Fluorescence detector detecting step 2）Obtained test fluid 50ul, in fluorescence detector fluorescence excitation Afterwards, read fluorescence excitation after 20 to wavelength in the 100ns periods 480 ~ 500nm fluorescent value；

（4）As a result calculate：Using biomedical mapping software, the standard made with reference to glycosylated hemoglobin standard sample is bent Line, with reference to step 3）In the fluorescent value that detects calculate the concentration of glycosylated hemoglobin in blood sample.

Above-described biomedical software is Sigma plot softwares, in being commercially available on the market.

It is above-described a kind of to detect saccharification blood with the glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe The method of hemoglobin concentration, it is characterised in that HbAle egg in the glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent White nucleic acid aptamer fluorescence probe concentration is 200 ~ 400 nmol/L, and its characteristic is also resided in, the glycosylated hemoglobin aptamer Fluorescence probe is the nucleotide single-chain that mark fluorescent pyrene molecule monomer is distinguished at 5' and 3' two ends, and the nucleotide single-chain sequence is SEQ ID NO:1~SEQ ID NO:Any one sequence dna fragment in 4, its sequence is：

SEQ ID NO:1：gggaggcatg tgtgctaagg cgtagcaggg ttggaaccc；

SEQ ID NO:2：gggaggcatg tgatttaagg cgcggcagat gttggaaccc；

SEQ ID NO:3：gggaggcatg agacctatgg cgttgcattg gttggaaccc；

SEQ ID NO:4：gggaggcatg ggaaacaatg cgccgcagag ttggaaccc；

When glycosylated hemoglobin nucleic acid aptamer fluorescence probe is not combined with glycosylated hemoglobin, aptamer is in relatively more loose Scattered structure, the pyrene molecule monomer at 5' and 3' two ends mutually dissociates, after fluorescence excitation launch wavelength 370 ~ 400nm it Between；When glycosylated hemoglobin nucleic acid aptamer fluorescence probe is combined with glycosylated hemoglobin, glycosylated hemoglobin induces it to tie Structure changes, and the pyrene molecule monomer at aptamer 5' and 3' two ends is close to each other, is excited after forming excitation state dimer, fluorescence excitation State dimer launch wavelength is 480 between 500nm.

It is above-described a kind of to detect saccharification blood with the glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe The method of hemoglobin concentration, it is characterised in that described blood sample be anticoagulant heparin whole blood or peripheral blood, it is described contain NH₄Cl、 Tris、EDTA-Na₂Erythrocyte cracked liquid to contain 1 ~ 280 mmol/L NH₄Cl, 1~34 mmol/L Tris,1~2mmol/ LEDTA-Na₂, pH 7.0~7.2；It is described to contain MgCl₂0.2M phosphate buffers to contain 1 ~ 10mmol/L MgCl₂；It is described Fluorescence detector is the fluorescence detector with time-resolved fluorometry.

It is above-described a kind of to detect saccharification blood with the glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe The method of hemoglobin concentration, it is characterised in that the detection method is used to detect the saccharification blood in anticoagulant heparin whole blood or peripheral blood Hemoglobin concentration.

The present invention substantive distinguishing features and marked improvement be：

（1）Detection is simple to operate quick, processes and separates without complex sample, aptamer probe is directly added into cracking Blood sample liquid afterwards, with can just detect the fluorescent value at 480 ~ 500nm in the sepectrophotofluorometer short time；

（2）This kit and its detection method have sensitivity high, and testing result repeatability is high, and sample detection error exists Between 0.01 ~ 0.1%, high specificity, when glycosylated hemoglobin nucleic acid aptamer fluorescence probe is not combined with glycosylated hemoglobin, core Acid is fit to be in more open structure, and the pyrene molecule monomer at 5' and 3' two ends mutually dissociates, and launch wavelength exists after fluorescence excitation Between 370 ~ 400nm；When it is combined with glycosylated hemoglobin, glycosylated hemoglobin induces it to change, aptamer 5' Pyrene molecule monomer with 3' two ends is close to each other, formation dimer, and dimer launch wavelength is in 480 ~ 500nm after fluorescence excitation Between.

（3）Reagent used can make to prepare the liquid reagent that can be used directly or using being used after being preceding dissolved in water Dry powder, detection reagent can be with storage at normal temperature, convenient transportation.

Brief description of the drawings

Fig. 1 pyrene molecule structure charts.

Embodiment

Below in conjunction with the glycosylated hemoglobin GHb examinations of table 1 and the embodiment description present invention based on nucleic acid aptamer fluorescence probe Agent box and its detection method.

Kit reagent composition composition in the embodiment of table 1.

Embodiment 1

After agent formulations dissolving is prepared needed for embodiment 1 in table 1, bottle is distributed into, is freeze-dried, dry powder is made Reagent；Before use, adding ultra-pure water, used after redissolution.Each sample setting 3 is parallel, and detecting step is as follows：

（1）Blood sample is cracked：By anticoagulant heparin whole blood, erythrocyte cracked liquid by volume 1:0.5 mixes, and stands 30min, then Medium-speed centrifuge 7min, collects supernatant；

（2）Mixing ovum is educated：Take 20 μ l steps 1）Obtained supernatant 45ul use 0.2M phosphate buffers dissolving saccharification blood The glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent mixing that Lactoferrin nucleic acid aptamer fluorescence probe is obtained, ovum is educated at room temperature 5min, obtains test fluid；

3 parallel determination errors of sample are 0.05 ± 0.01%.

Embodiment 2

After agent formulations dissolving is prepared needed for embodiment 2 in table 1, bottle is distributed into, is freeze-dried, dry powder is made Reagent；Before use, adding ultra-pure water, used after redissolution.Each sample setting 3 is parallel, and detecting step is as follows：

（1）Blood sample is cracked：By peripheral blood, erythrocyte cracked liquid by volume 1:2.5 mix, stand 5min, then middling speed from Heart 6min, collects supernatant；

（2）Mixing ovum is educated：Take 50 μ l steps 1）Obtained supernatant 30ul's

The glycosylated hemoglobin core that the saccharification fit fluorescence probe of haemoglobin nucleic acid is obtained is dissolved with 0.2M phosphate buffers Fluorescence probe reagent mixing that acid is fit, ovum educates 6min at room temperature, obtains test fluid；

（4）As a result calculate：Using biomedical mapping software, the standard made with reference to glycosylated hemoglobin standard sample is bent Line, with reference to step 3）In the fluorescent value that detects calculate the concentration of glycosylated hemoglobin in blood sample.3 parallel determinations of sample Error is 0.02 ± 0.01%.

Embodiment 3

After agent formulations dissolving is prepared needed for embodiment 3 in table 1, bottle is distributed into, is freeze-dried, dry powder is made Reagent；Before use, adding ultra-pure water, used after redissolution.Each sample setting 3 is parallel, and detecting step is as follows：

（1）Blood sample is cracked：By peripheral blood, erythrocyte cracked liquid by volume 1:3.5 mix, stand 10min, then middling speed from Heart 5min, collects supernatant；

（2）Mixing ovum is educated：Take 75 μ l steps 1）Obtained supernatant 45ul's

The glycosylated hemoglobin core that the saccharification fit fluorescence probe of haemoglobin nucleic acid is obtained is dissolved with 0.2M phosphate buffers Fluorescence probe reagent mixing that acid is fit, ovum educates 7min at room temperature, obtains test fluid；

3 parallel determination errors of sample are 0.04 ± 0.01%.

Embodiment 4

After agent formulations dissolving is prepared needed for embodiment 4 in table 1, bottle is distributed into, is freeze-dried, dry powder is made Reagent；Before use, adding ultra-pure water, used after redissolution.Each sample setting 3 is parallel, and detecting step is as follows：

（1）Blood sample is cracked：By anticoagulant heparin whole blood, erythrocyte cracked liquid by volume 1:0.5 mixes, and stands 25min, then Medium-speed centrifuge 8min, collects supernatant；

（2）Mixing ovum is educated：Take 100 μ l steps 1）Obtained supernatant 50ul use 0.2M phosphate buffers dissolving saccharification blood The glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent mixing that Lactoferrin nucleic acid aptamer fluorescence probe is obtained, ovum is educated at room temperature 8min, obtains test fluid；

3 parallel determination errors of sample are 0.06 ± 0.01%.

Embodiment 5

After agent formulations dissolving is prepared needed for embodiment 5 in table 1, bottle is distributed into, is freeze-dried, dry powder is made Reagent；Before use, adding ultra-pure water, used after redissolution.Each sample setting 3 is parallel, and detecting step is as follows：

（1）Blood sample is cracked：By anticoagulant heparin whole blood, erythrocyte cracked liquid by volume 1:1.0 mix, and stand 20min, then Medium-speed centrifuge 9min, collects supernatant；

（2）Mixing ovum is educated：Take 80 μ l steps 1）Obtained supernatant 30ul use 0.2M phosphate buffers dissolving saccharification blood The glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent mixing that Lactoferrin nucleic acid aptamer fluorescence probe is obtained, ovum is educated at room temperature 9min, obtains test fluid；

3 parallel determination errors of sample are 0.07 ± 0.01%.

Embodiment 6

After agent formulations dissolving is prepared needed for embodiment 6 in table 1, bottle is distributed into, is freeze-dried, dry powder is made Reagent；Before use, adding ultra-pure water, used after redissolution.Each sample setting 3 is parallel, and detecting step is as follows：

（1）Blood sample is cracked：By anticoagulant heparin whole blood, erythrocyte cracked liquid by volume 1:4.5 mix, and stand 15min, then Medium-speed centrifuge 10min, collects supernatant；

（2）Mixing ovum is educated：Take 30 μ l steps 1）Obtained supernatant 40ul use 0.2M phosphate buffers dissolving saccharification blood The glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent mixing that Lactoferrin nucleic acid aptamer fluorescence probe is obtained, ovum is educated at room temperature 10min, obtains test fluid；

3 parallel determination errors of sample are 0.08 ± 0.01%.

Embodiment 7

After agent formulations dissolving is prepared needed for embodiment 7 in table 1, bottle is distributed into, is freeze-dried, dry powder is made Reagent；Before use, adding ultra-pure water, used after redissolution.Each sample setting 3 is parallel, and detecting step is as follows：

（1）Blood sample is cracked：By peripheral blood, erythrocyte cracked liquid by volume 1:3.0 mix, stand 18min, then middling speed from Heart 8min, collects supernatant；

（2）Mixing ovum is educated：Take 50 μ l steps 1）Obtained supernatant 20ul use 0.2M phosphate buffers dissolving saccharification blood The glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent mixing that Lactoferrin nucleic acid aptamer fluorescence probe is obtained, ovum is educated at room temperature 12min, obtains test fluid；

3 parallel determination errors of sample are 0.1 ± 0.01%.

Embodiment 8

After agent formulations dissolving is prepared needed for embodiment 8 in table 1, bottle is distributed into, is freeze-dried, dry powder is made Reagent；Before use, adding ultra-pure water, used after redissolution.Each sample setting 3 is parallel, and detecting step is as follows：

（1）Blood sample is cracked：By peripheral blood, erythrocyte cracked liquid by volume 1:2.0 mix, stand 26min, then middling speed from Heart 6min, collects supernatant；

（2）Mixing ovum is educated：Take 60 μ l steps 1）Obtained supernatant 25ul use 0.2M phosphate buffers dissolving saccharification blood The glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent mixing that Lactoferrin nucleic acid aptamer fluorescence probe is obtained, ovum is educated at room temperature 13min, obtains test fluid；

3 parallel determination errors of sample are 0.02 ± 0.01%.

Embodiment 9

After agent formulations dissolving is prepared needed for embodiment 9 in table 1, bottle is distributed into, is freeze-dried, dry powder is made Reagent；Before use, adding ultra-pure water, used after redissolution.Each sample setting 3 is parallel, and detecting step is as follows：

（1）Blood sample is cracked：By peripheral blood, erythrocyte cracked liquid by volume 1:4.0 mix, stand 8min, then middling speed from Heart 7min, collects supernatant；

（2）Mixing ovum is educated：Take 40 μ l steps 1）Obtained supernatant 35ul use 0.2M phosphate buffers dissolving saccharification blood The glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent mixing that Lactoferrin nucleic acid aptamer fluorescence probe is obtained, ovum is educated at room temperature 15min, obtains test fluid；

3 parallel determination errors of sample are 0.01 ± 0.01%.

Sequence table

<110>The glad bio tech ltd in Guangxi Anren

<120>Glycosylated hemoglobin kit and its detection method based on nucleic acid aptamer fluorescence probe

<130> 2012

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 39

<212> DNA

<213>Artificial sequence

<400> 1

gggaggcatg tgtgctaagg cgtagcaggg ttggaaccc 39

<210> 2

<211> 40

<212> DNA

<213>Artificial sequence

<400> 2

gggaggcatg tgatttaagg cgcggcagat gttggaaccc 40

<210> 3

<211> 40

<212> DNA

<213>Artificial sequence

<400> 3

gggaggcatg agacctatgg cgttgcattg gttggaaccc 40

<210> 4

<211> 39

<212> DNA

<213>Artificial sequence

<400> 4

gggaggcatg ggaaacaatg cgccgcagag ttggaaccc 39

Claims

1. a kind of glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe, it is characterised in that main component includes：Contain NH₄Cl、Tris、EDTA-Na₂Erythrocyte cracked liquid；Containing MgCl₂0.2M phosphate buffers；Glycosylated hemoglobin standard items； Glycosylated hemoglobin nucleic acid aptamer fluorescence probe；The glycosylated hemoglobin nucleic acid aptamer fluorescence probe is distinguished for 5' and 3' two ends The nucleotide single-chain of mark fluorescent pyrene molecule monomer, the nucleotide single-chain sequence is SEQ ID NO:3： gggaggcatgagacctatggcgttgcattggttggaaccc。

2. a kind of glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe according to claim 1, its feature It is, it is described to contain NH₄Cl、Tris、EDTA-Na₂Erythrocyte cracked liquid to contain 1~280 mmol/L NH₄Cl, 1~34 mmol/L Tris,1~2mmol/L EDTA-Na₂, pH 7.0~7.2；It is described to contain MgCl₂0.2M phosphate buffers to contain 1 ~10mmol/L MgCl₂。

3. a kind of glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe according to claim 1, its feature It is, it is described to contain NH₄Cl、Tris、EDTA-Na₂Erythrocyte cracked liquid, containing MgCl₂0.2M phosphate buffers, HbAle Protein standard substance, glycosylated hemoglobin nucleic acid aptamer fluorescence probe are to prepare the liquid reagent directly used or needed before using The dry powder being dissolved in water.

4. a kind of glycosylated hemoglobin reagent based on nucleic acid aptamer fluorescence probe according to any one of claim 1 ~ 3 Box, it is characterised in that the kit is used to detect the glycosylated hemoglobin concentration in anticoagulant heparin whole blood or peripheral blood.

5. one kind is examined with the glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe described in any one of claim 1 ~ 3 The method for surveying glycosylated hemoglobin concentration, it is characterised in that method and step includes：

（1）Blood sample is cracked：By blood sample and containing NH₄Cl、Tris、EDTA-Na₂Erythrocyte cracked liquid press 1:0.5 ~ 5 volume ratio is mixed It is even, 5 ~ 30min, then 5 ~ 10min of medium-speed centrifuge are stood, supernatant is collected；

（2）Mixing ovum is educated：Take 20 ~ 100 μ l steps 1）Obtained supernatant and 30 ~ 50ul's contains MgCl₂0.2M phosphoric acid buffers Liquid, the glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent that the dissolving saccharification fit fluorescence probe of haemoglobin nucleic acid is obtained is mixed Close, ovum educates 5 ~ 15min at room temperature, glycosylated hemoglobin nucleic acid aptamer fluorescence probe is fully combined with blood sample, obtains test fluid；

（3）Fluoroscopic examination：Fluorescence detector detecting step 2）Obtained test fluid 50ul, after fluorescence detector fluorescence excitation, Read fluorescence excitation after 20 to wavelength in the 100ns periods 480 ~ 500nm fluorescent value；

（4）As a result calculate：Using biomedical mapping software, the standard curve made with reference to glycosylated hemoglobin standard sample, With reference to step 3）In the fluorescent value that detects calculate the concentration of glycosylated hemoglobin in blood sample.

A kind of detected 6. according to claim 5 with the glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe The method of glycosylated hemoglobin concentration, it is characterised in that be saccharified in the glycosylated hemoglobin nucleic acid aptamer fluorescence probe reagent Fluorescence probe concentration that haemoglobin nucleic acid is fit is 200 ~ 400 nmol/L, the glycosylated hemoglobin nucleic acid aptamer fluorescence probe The nucleotide single-chain of mark fluorescent pyrene molecule monomer is distinguished for 5' and 3' two ends, the nucleotide single-chain sequence is SEQ ID NO:3： gggaggcatgagacctatggcgttgcattggttggaaccc。

A kind of detected 7. according to claim 6 with the glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe The method of glycosylated hemoglobin concentration, it is characterised in that described glycosylated hemoglobin nucleic acid aptamer fluorescence probe not with saccharification When hemoglobin is combined, aptamer is in more open structure, and the pyrene molecule monomer at 5' and 3' two ends mutually dissociates, glimmering Light excites rear launch wavelength between 370 ~ 400nm；Described glycosylated hemoglobin nucleic acid aptamer fluorescence probe and saccharification blood When Lactoferrin is combined, glycosylated hemoglobin induces its recurring structure to change, the pyrene molecule single phase at aptamer 5' and 3' two ends It is mutually close, form excitation state dimer, after fluorescence excitation excitation state dimer launch wavelength 480 between 500nm.

A kind of detected 8. according to claim 5 with the glycosylated hemoglobin kit based on nucleic acid aptamer fluorescence probe The method of glycosylated hemoglobin concentration, it is characterised in that described blood sample be anticoagulant heparin whole blood or peripheral blood, it is described to contain NH₄Cl、Tris、EDTA-Na₂Erythrocyte cracked liquid to contain 1 ~ 280 mmol/L NH₄Cl, 1~34 mmol/L Tris,1~ 2mmol/L EDTA-Na₂, pH 7.0~7.2；It is described to contain MgCl₂0.2M phosphate buffers to contain 1 ~ 10mmol/L MgCl₂；The fluorescence detector is the fluorescence detector with time-resolved fluorometry.

9. it is a kind of with the glycosylated hemoglobin reagent based on nucleic acid aptamer fluorescence probe according to any one of claim 5 ~ 7 Box is come the method that detects glycosylated hemoglobin concentration, it is characterised in that the detection method is used to detect anticoagulant heparin whole blood or end Glycosylated hemoglobin concentration in tip blood.