CN104830974A - Soil microbial diversity analysis method - Google Patents
Soil microbial diversity analysis method Download PDFInfo
- Publication number
- CN104830974A CN104830974A CN201510140434.6A CN201510140434A CN104830974A CN 104830974 A CN104830974 A CN 104830974A CN 201510140434 A CN201510140434 A CN 201510140434A CN 104830974 A CN104830974 A CN 104830974A
- Authority
- CN
- China
- Prior art keywords
- soil
- pcr amplification
- diversity
- analyzing
- mobile phase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a soil microbial diversity analysis method, belonging to the technical field of soil microbial analysis. In order to solve the problems of heavy pollution and long time consumption, the soil microbial diversity analysis method is provided. The soil microbial diversity analysis method includes microbial genome DNA extraction of acquired soil to obtain a genome DNA extract; detection of the genome DNA extract to determine the soil genomic DNA concentration and purity; PCR amplification of DNA extracted from the soil to obtain a PCR amplification product; and microbial diversity analysis of the PCR amplification product by use of denaturing high Performance liquid chromatography. According to the method, primer marking is not needed, glue leaking using toxic substance formamide and acrylamide is not needed, the radioactive pollution is reduced, and the soil microbial diversity analysis method has the effects of less pollution, high degree of automation, short detection time, high sensitivity, and good detection strip separation effect.
Description
Technical field
The present invention relates to a kind of Soil Microorganism method for analyzing diversity, belong to Soil Microbes technical field.
Background technology
At present, for the research of diversity of soil microorganism mainly by means of molecular biological means, the DNA fragmentation directly obtaining microorganism from soil is analyzed, thus makes environmental microorganism diversity analysis become one as far as possible comprehensively method.In recent years, the method report about Soil Microorganism diversity analysis is a lot.But, mainly lay particular emphasis on extraction and the analysis of the STb gene extracting bacterial flora in soil, the extraction of fungal colonization STb gene and analysis in less concern soil.Denaturing gradient gel electrophoresis (DGGE) is generally adopted to analyze at present for soil bacteria and fungal diversity research.As Chinese patent application (publication number: CN102399855A) discloses a kind of analytical procedure detecting diversity of soil microorganism, comprise and carry out DNA extraction, the concentration measuring DNA in DNA extraction liquid and purity from soil, then carry out PCR specific amplification and denaturing gradient gel electrophoresis analysis is carried out to amplified production.Although, conventional DGGE method is a kind of generally acknowledged method, can obtain more accurate detected result comparatively speaking, but the method needs to run glue, waste time and energy, in testing process, the used time is longer, and the methane amide adopted in denaturant gel and acrylamide have toxicity, needs to adopt isotopic labeling primer to improve sensitivity simultaneously, there is radiocontamination, and be unfavorable for actually operating.
Summary of the invention
The present invention is directed to the defect existed in above prior art, propose a kind of Soil Microorganism method for analyzing diversity, the problem of solution realizes having polluting little and few effect consuming time.
The object of the invention is to be achieved by the following technical programs, a kind of Soil Microorganism method for analyzing diversity, the method comprises the following steps:
A, to gather soil carry out microbe genome DNA extraction, obtain extracting genome DNA liquid;
B, extracting genome DNA liquid is detected to the concentration and purity of determining soil genomic dna;
C, the DNA extracted from soil is carried out pcr amplification, obtain pcr amplification product;
D, employing denaturing high-performance chromatography carry out Analysis of Microbial Diversity to pcr amplification product.
A kind of Soil Microorganism method for analyzing diversity of the present invention, traditional DGGE method is replaced by adopting denaturing high-performance liquid chromatography, the fragment being analyzed the conserved sequence of bacterial ribosome small subunit 16S rDNA and fungi small subunit ribosome 18SrDNA by employing denaturing high-performance liquid chromatography is how many, and the situation of soil bacteria and fungal diversity is characterized by calculating diversity index, thus realize without the need to marking primer, also race glue is carried out without the need to adopting containing toxicant methane amide and acrylamide, decrease radiocontamination, have and pollute little effect, meanwhile, adopt denaturing high-performance liquid chromatography can realize the automatization of height, detection time is short, makes to have the higher sensitivity effect few with the detection used time.
In above-mentioned Soil Microorganism method for analyzing diversity, as preferably, denaturing high-performance chromatography described in step D is WAVE nucleotide fragments analyser.This area routine be for separating of nucleotide fragments and detect known sudden change technology platform, also do not find the application in diversity of soil microorganism analysis at present.And the fragment that the present invention can not only analyze the conserved sequence of bacterial ribosome small subunit 16S rDNA and fungi small subunit ribosome 18S rDNA in soil by employing WAVE nucleotide fragments analyser is how many, it is the Distribution center situation in order to determine Soil Microorganism, thus reflect the effect of the microorganism structure in soil more accurately, and also comparatively there is highly sensitive and reproducible effect; In addition, also have the automatization of height, can realize automatic sampling, detecting each sample only needs can complete detection in about 15 minutes, can also adapt to large batch of sample analysis.Certainly, other nucleotide fragments analyser also can be adopted to substitute WAVE nucleotide fragments analyser and to analyze, as Agilent 2100 nucleotide fragments analyser etc.
In above-mentioned Soil Microorganism method for analyzing diversity, microorganism described in step D comprises bacterium and fungi.Method of the present invention can than more comprehensively extracting bacterium and fungal colonization in soil microorganisms, and adopt dhplc analysis method also comprehensively can analyze the situation of bacterium and fungi in soil, thus real biological community structure in soil can be reflected preferably.
In above-mentioned Soil Microorganism method for analyzing diversity, as preferably, the denaturation temperature adopting WAVE nucleotide fragments analyser to carry out fungal diversity analysis to pcr amplification product in step D is 55 DEG C ~ 57 DEG C.As preferably, the denaturation temperature adopting WAVE nucleotide fragments analyser to carry out Phylogenetic diversity of bacteria analysis to pcr amplification product in step D is 60 DEG C ~ 63 DEG C.Due to different denaturation temperature conditions, DNA double chain can form different states of unwinding.The determination of denaturation temperature is conducive to clip size is identical and based composition is different DNA fragmentation separates, and mutability temperature is relevant with the melting temperature(Tm) (Tm) between DNA molecular, and when microbial species is determined, its denaturation temperature is fixing.But soil microorganisms due to kind more, so very checking obtains the denaturation temperature determined, need the denaturation temperature groping by experiment to determine comparatively to fit, to obtain stable band separating effect, make experimental result have stability, reliability and repeatability.Can be good at by adopting denaturation temperature of the present invention playing good keying action with the WAVE nucleotide fragments analyser adopted, if temperature is too low, DNA can not sex change completely, and band can not be separated well; And if temperature is too high, DNA sex change is that the process of single stranded DNA is too fast, band also can be caused not to be separated well, be unfavorable for the analysis of Soil Microorganism.
In above-mentioned Soil Microorganism method for analyzing diversity, as preferably, adopt WAVE nucleotide fragments analyser to carry out to pcr amplification product the moving phase that Phylogenetic diversity of bacteria analysis adopts in step D and comprise acetonitrile and TEAA (triethylamine acetate damping fluid).Because moving phase acetonitrile has significant impact to the rate of migration of DNA in kapillary.Determine the time of the scope that eluent gradient changes and moving phase wash-out, the analysis for diversity of soil microorganism is extremely important.If moving phase acetonitrile ratio is too high, elution time is short, and DNA fragmentation wash-out is very fast, DNA fragmentation go out peak overlapping, fragment is not easily separated; If moving phase acetonitrile ratio is low, elution time is long, and DNA fragmentation goes out peak broadens, and separating effect is bad.Therefore, as further preferred, described moving phase is specially the mixed flow phase adopting mobile phase A and Mobile phase B, and described mobile phase A: the volume ratio of Mobile phase B is 40 ~ 55:45 ~ 60; Described mobile phase A adopts the TEAA pure water constant volume of every 50mL to 1L, and the method adding 200 μ l acetonitriles is formulated; Described Mobile phase B is formulated to the method for 1L with pure water constant volume after adopting the acetonitrile of TEAA and 250mL of every 50mL to mix, and the concentration ratio of each moving phase can adjust as required in corresponding scope.
In above-mentioned Soil Microorganism method for analyzing diversity, as preferably, microorganism described in step C is fungi, and described pcr amplification is three times, first time pcr amplification with
5 '-CCAGTAGTCATATGCTTGTCTC-3 ' and
5 '-ACCTTGTTACGACTTTTACTTCC-3 ' is primer;
Second time pcr amplification with
5 '-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGTTGGAGGGCAAGTCTGG TGCC-3 ' and 5 '-GTTTCCCGTAAGGCGCCGAA-3 ' is primer;
Third time pcr amplification with
5 '-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGTTGGAGGGCAAGTCTGG TGCC-3 ' and 5 '-GCCTGCTTTAAACACTCTA-3 ' is primer.
In above-mentioned Soil Microorganism method for analyzing diversity, as another embodiment, microorganism described in step C is bacterium, and described pcr amplification with
5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCA GCAG-3 ' and 5 '-ATTACCGCGGCTCGTGG-3 ' is primer.
By adopting above-mentioned primer to increase, can be good at the DNA in soil in DNA extraction liquid is effectively increased, thus realize general status and the accuracy of better analyzing Soil Microorganism.
In sum, the present invention compared with prior art, has the following advantages:
1. the analytical procedure of middle microbial diversity of the present invention, by adopting denaturing high-performance liquid chromatography, realizing without the need to marking primer, also carrying out race glue without the need to adopting containing toxicant methane amide and acrylamide, decrease radiocontamination, have and pollute little effect; Meanwhile, adopt denaturing high-performance liquid chromatography can realize the automatization of height, detection time is short, makes to have higher sensitivity, detects used time few and reproducible effect.
2. Soil Microorganism method for analyzing diversity of the present invention, by design denaturation temperature to the different requirements of bacterium and fungi, thus the band realizing detecting is separated well, is conducive to the analysis of Soil Microorganism, has highly sensitive effect.
Accompanying drawing explanation
Fig. 1 is the detection figure of the WAVE nucleotide fragments analyser that in the embodiment of the present invention 1 soil, Phylogenetic diversity of bacteria is analyzed.
Fig. 2 is the detection figure of the WAVE nucleotide fragments analyser that in the embodiment of the present invention 2 soil, fungal diversity is analyzed.
Embodiment
Below by specific embodiments and the drawings, technical scheme of the present invention is described in further detail, but the present invention is not limited to these embodiments.
Embodiment 1
In soil in the present embodiment, the analytical procedure of Phylogenetic diversity of bacteria is as follows:
Soil collecting:
Soil in the present embodiment adopts the soil from Linhai City Caulis et Folium Brassicae capitatae field, Zhejiang Province, and the concrete employing place in fact for soil does not have particular requirement, selects general soil; Be specially the dry branches and fallen leaves first removing upper soll layer, adopt cutting ring to gather the soil of 0-20cm, take back laboratory, and completed DNA extraction in 48 hours;
Soil microorganisms total DNA extraction and quantitatively:
Adopt the soil microbe genome DNA of FastPrep company to extract test kit (FastDNA Spin Kit for Soil) and extract soil microbe genome DNA, then, adopt the micro-ultraviolet spectrophotometer of Nanodrop 2000 to determine DNA concentration and quality again, make A
260/ A
280ratio control is between 1.6-2.0, then it is for subsequent use to adopt sterilized water DNA to be diluted to 20ng/ μ l.
The pcr amplification of bacterial 16 S rDNA in soil:
With primer sequence: F338GC (5 '-CGCCCGCCGCGCGCGGCG GGC GGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCAGCAG-3 ') and R518 (5 '-ATTACCGCGGCTCGTGG-3 ') be primer;
Pcr amplification program is:
94 DEG C of denaturation 5min;
94 DEG C of sex change 1min, 65 DEG C (each circulation minimizing 1 DEG C) annealing 1min, 72 DEG C extend 1.5min, totally 10 circulations;
94 DEG C of sex change 1min, 55 DEG C of annealing 1min, 72 DEG C extend 1.5min, totally 25 circulations; 72 DEG C extend 5min completely;
Be in order to the multiple species in bacterium can be made all to be increased by the pcr amplification object of above-mentioned twice, improve the accuracy analyzed;
The DHLPC of Phylogenetic diversity of bacteria analyzes:
The pcr amplification product obtained by above-mentioned pcr amplification is directly gone up WAVE nucleotide fragments analyser (msf gene company limited of the U.S.) and is analyzed, and each applied sample amount is 5 μ l, and concrete analysis condition is:
The denaturation temperature of above-mentioned WAVE nucleotide fragments analyser is set to 61.8 DEG C: imposing a condition of each parameter of described WAVE nucleotide fragments analyser (load (Loading), gradient starts (Start Gradient), gradient stops (Stop Gradient), cleanly start (Start Clean), cleanly stop (Stop Clean), balance start (StartEquilibrate) and balance end (Stop Equilibrate)) is as follows:
Mobile phase A described in above-mentioned table adopts the TEAA pure water constant volume of every 50mL to 1L, and the method adding 200 μ l acetonitriles is formulated; Described Mobile phase B is formulated to the method for 1L with pure water constant volume after adopting the acetonitrile of TEAA and 250mL of every 50mL to mix.Moving phase D forms for adopting 250mL pure water and 750mL acetonitrile mixed preparing.
Analytical results as shown in Figure 1, can be found out in Fig. 1, and different mobility peaks represents the band of different large base minor quantity, and different heights representative has the abundance of the band of this base quantity.In figure, different digital represents different peaks, as can be seen from Figure 1 specifically different in soil bacterial micro-organism monoids.Soil bacteria diversity can be analyzed according to the kind at the peak of different size.
Embodiment 2
In soil in the present embodiment, the analytical procedure of fungal diversity is as follows:
Soil collecting:
Soil in the present embodiment adopts the soil abandoning wasteland from Dongguan, Guangdong Province, in fact the concrete collecting location for soil does not have particular requirement, select general soil, be specially the dry branches and fallen leaves first removing upper soll layer, cutting ring is adopted to gather the soil of 0-20cm, take back laboratory, and completed DNA extraction in 48 hours;
Soil microorganisms total DNA extraction and quantitatively:
Adopt the soil microorganisms genome of FastPrep company to extract test kit (FastDNA Spin Kit for Soil) and extract soil microbe genome DNA, then, adopt the micro-ultraviolet spectrophotometer of Nanodrop 2000 to determine DNA concentration and quality again, make A
260/ A
280ratio control is between 1.6-2.0, then it is for subsequent use to adopt sterilized water DNA to be diluted to 20ng/ μ l.
The pcr amplification of fungi 18S rDNA in soil, described pcr amplification is three times,
First time pcr amplification with
5 '-CCAGTAGTCATATGCTTGTCTC-3 ' and
5 '-ACCTTGTTACGACTTTTACTTCC-3 ' is primer;
The program of pcr amplification is:
94 DEG C of denaturation 4min; Again with 94 DEG C of sex change 1min, 55 DEG C of annealing 1min, 72 DEG C extend 1.5min, totally 25 circulations; Then 72 DEG C extend 5min completely;
Second time pcr amplification with
5 '-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGTTGGAGGG CAAGTCTGGTGCC-3 ' and 5 '-GTTTCCCGTAAGGCGCCGAA-3 ' is primer;
The program of pcr amplification is:
94 DEG C of denaturation 2min; Again with 94 DEG C of sex change 45s, 65 DEG C of annealing 1min, 72 DEG C extend 45s, totally 30 circulations; Then 72 DEG C extend 5min completely;
Third time pcr amplification with
5 '-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGTTGGAGGGCAAGTCTGG TGCC-3 ' and 5 '-GCCTGCTTTAAACACTCTA-3 ' is primer;
The program of pcr amplification is:
94 DEG C of denaturation 2min; Again with 94 DEG C of sex change 45s, 55 DEG C of annealing 1min, 72 DEG C extend 45s, totally 30 circulations; Then 72 DEG C extend 7min completely;
Due to the kind more complicated of fungi, therefore, by the pcr amplification adopting 3 pairs of primers to go forward one by one, thus improve the accuracy of amplification, more can ensure the diversity analyzing fungi in soil;
The DHLPC of fungal diversity analyzes:
The pcr amplification product obtained by above-mentioned pcr amplification is directly gone up WAVE nucleotide fragments analyser (msf gene company limited of the U.S.) and is analyzed, and each applied sample amount is 5 μ l, and concrete analysis condition is:
The denaturation temperature of above-mentioned WAVE nucleotide fragments analyser is set to 56.7 DEG C; Imposing a condition of each parameter of described WAVE nucleotide fragments analyser (load (Loading), gradient starts (Start Gradient), gradient stops (Stop Gradient), cleanly start (Start Clean), cleanly stop (Stop Clean), balance start (StartEquilibrate) and balance end (Stop Equilibrate)) is as follows:
Mobile phase A described in above-mentioned table adopts the TEAA pure water constant volume of every 50mL to 1L, and the method adding 200 μ l acetonitriles is formulated; Described Mobile phase B is formulated to the method for 1L with pure water constant volume after adopting the acetonitrile of TEAA and 250mL of every 50mL to mix.Moving phase D forms for adopting 250mL pure water and 750mL acetonitrile mixed preparing.
As shown in Figure 2, as can be seen from Figure 2, different mobility peaks represents the band of different large base minor quantity to analytical results, and different heights representative has the abundance of the band of this base quantity.In Fig. 2, different digital represents different peaks, fungi microbe monoids specifically different in instruction soil.Soil fungal diversity can be analyzed according to the kind at the peak of different size.
Embodiment 3
The specific analytical method of the present embodiment is consistent with embodiment 1, here repeats no more, difference be only the denaturation temperature of described WAVE nucleotide fragments analyser be set to 55 DEG C or 57 DEG C specifically implement one by one.
Embodiment 4
The specific analytical method of the present embodiment is consistent with embodiment 2, here repeats no more, difference be only the denaturation temperature of described WAVE nucleotide fragments analyser be set to 60 DEG C or 63 DEG C specifically implement one by one.
Embodiment 5
The specific analytical method of the present embodiment with embodiment 1 or embodiment 2 consistent, here repeat no more, difference is only the difference that imposes a condition of each parameter of adopted WAVE nucleotide fragments analyser, each parameter of concrete described WAVE nucleotide fragments analyser (loads (Loading), gradient starts (Start Gradient), gradient stops (StopGradient), clean beginning (Start Clean), clean stopping (Stop Clean), balance start (Start Equilibrate) and balance end (Stop Equilibrate)) impose a condition as follows:
Mobile phase A in the present embodiment, Mobile phase B are consistent with embodiment 1 with moving phase D, repeat no more here.
Specific embodiment described in the present invention is only to the explanation for example of the present invention's spirit.Those skilled in the art can make various amendment or supplement or adopt similar mode to substitute to described specific embodiment, but can't depart from spirit of the present invention or surmount the scope that appended claims defines.
Although made a detailed description the present invention and quoted some specific embodiments as proof, to those skilled in the art, only otherwise it is obvious for leaving that the spirit and scope of the present invention can make various changes or revise.
Claims (9)
1. a Soil Microorganism method for analyzing diversity, is characterized in that, the method comprises the following steps:
A, to gather soil carry out microbe genome DNA extraction, obtain extracting genome DNA liquid;
B, extracting genome DNA liquid is detected to the concentration and purity of determining soil genomic dna;
C, the DNA extracted from soil is carried out pcr amplification, obtain pcr amplification product;
D, employing denaturing high-performance chromatography carry out Analysis of Microbial Diversity to pcr amplification product.
2. Soil Microorganism method for analyzing diversity according to claim 1, it is characterized in that, denaturing high-performance chromatography described in step D is WAVE nucleotide fragments analyser.
3. Soil Microorganism method for analyzing diversity according to claim 2, it is characterized in that, microorganism described in step D comprises bacterium and/or fungi.
4. Soil Microorganism method for analyzing diversity according to claim 3, it is characterized in that, the denaturation temperature adopting WAVE nucleotide fragments analyser to carry out fungal diversity analysis to pcr amplification product in step D is 55 DEG C ~ 57 DEG C.
5. Soil Microorganism method for analyzing diversity according to claim 3, it is characterized in that, the denaturation temperature adopting WAVE nucleotide fragments analyser to carry out Phylogenetic diversity of bacteria analysis to pcr amplification product in step D is 60 DEG C ~ 63 DEG C.
6. Soil Microorganism method for analyzing diversity according to claim 4 or 5, is characterized in that, adopts WAVE nucleotide fragments analyser to carry out to pcr amplification product the moving phase that Phylogenetic diversity of bacteria analysis adopts and comprise acetonitrile and TEAA in step D.
7. Soil Microorganism method for analyzing diversity according to claim 6, is characterized in that, described moving phase is specially the mixed flow phase adopting mobile phase A and Mobile phase B, and described mobile phase A: the volume ratio of Mobile phase B is 40 ~ 55:45 ~ 60; Described mobile phase A adopts the TEAA pure water constant volume of 50mL to 1L, and the method adding 200 μ l acetonitriles is formulated; Described Mobile phase B is formulated to the method for 1L with pure water constant volume after adopting the mixing of the acetonitrile of TEAA and 250mL of 50mL.
8. Soil Microorganism method for analyzing diversity according to claim 1, it is characterized in that, microorganism described in step C is fungi, and described pcr amplification is three times, first time pcr amplification with
5 '-CCAGTAGTCATATGCTTGTCTC-3 ' and
5 '-ACCTTGTTACGACTTTTACTTCC-3 ' is primer;
Second time pcr amplification with
5 '-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGTTGGAGGGCAAGTCTGG TGCC-3 ' and 5 '-GTTTCCCGTAAGGCGCCGAA-3 ' is primer;
Third time pcr amplification with
5 '-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGTTGGAGGGCAAGTCTGG TGCC-3 ' and 5 '-GCCTGCTTTAAACACTCTA-3 ' is primer.
9. Soil Microorganism method for analyzing diversity according to claim 1, it is characterized in that, microorganism described in step C is bacterium, and described pcr amplification with
5 '-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGACTCCTACGGGAGGCA GCAG-3 ' and 5 '-ATTACCGCGGCTCGTGG-3 ' is primer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510140434.6A CN104830974A (en) | 2015-03-27 | 2015-03-27 | Soil microbial diversity analysis method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510140434.6A CN104830974A (en) | 2015-03-27 | 2015-03-27 | Soil microbial diversity analysis method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104830974A true CN104830974A (en) | 2015-08-12 |
Family
ID=53809169
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510140434.6A Pending CN104830974A (en) | 2015-03-27 | 2015-03-27 | Soil microbial diversity analysis method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104830974A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107653300A (en) * | 2017-11-02 | 2018-02-02 | 浙江大学 | The method for determining pedotheque DNA recovery rates |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005065605A (en) * | 2003-08-25 | 2005-03-17 | Mitsubishi Heavy Ind Ltd | Method for analyzing microorganism community |
| CN101570783A (en) * | 2009-03-20 | 2009-11-04 | 郑秋月 | Detection kit and detection method for 9 species of pathogenic organisms in marine products |
| CN101570781A (en) * | 2009-03-20 | 2009-11-04 | 郑秋月 | Detection kit and species-based detection method for lactobacilli |
-
2015
- 2015-03-27 CN CN201510140434.6A patent/CN104830974A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2005065605A (en) * | 2003-08-25 | 2005-03-17 | Mitsubishi Heavy Ind Ltd | Method for analyzing microorganism community |
| CN101570783A (en) * | 2009-03-20 | 2009-11-04 | 郑秋月 | Detection kit and detection method for 9 species of pathogenic organisms in marine products |
| CN101570781A (en) * | 2009-03-20 | 2009-11-04 | 郑秋月 | Detection kit and species-based detection method for lactobacilli |
Non-Patent Citations (6)
| Title |
|---|
| EDWARD A. BARLAAN: "Profiling and monitoring of microbial populations by denaturing high-performance liquid chromatography", 《JOURNAL OF MICROBIOLOGICAL METHODS》 * |
| J. MOUNIER,ET AL: "Application of denaturing high-performance liquid chromatography (DHPLC) for yeasts identification in red smear cheese surfaces", 《LETTERS IN APPLIED MICROBIOLOGY》 * |
| OLIVER GOLDENBERG,ET AL: "Use of Denaturing High-Performance Liquid Chromatography for Rapid Detection and Identification of Seven Candida Species", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| 余彬彬等: "三种高盐苯胺废水对细菌群落结构的影响", 《生态学报》 * |
| 林飞燕等: "变性高效液相色谱法在微生物检测的应用进展", 《现代科学仪器》 * |
| 魏源: "不同喀斯特小生境中土壤丛枝菌根真菌的遗传多样性", 《植物生态学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107653300A (en) * | 2017-11-02 | 2018-02-02 | 浙江大学 | The method for determining pedotheque DNA recovery rates |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Bacterial populations assimilating carbon from 13C-labeled plant residue in soil: analysis by a DNA-SIP approach | |
| Zheng et al. | Characterization of microbial communities in strong aromatic liquor fermentation pit muds of different ages assessed by combined DGGE and PLFA analyses | |
| Tang et al. | Response of soil microbial community in Jiuduansha wetland to different successional stages and its implications for soil microbial respiration and carbon turnover | |
| Knauth et al. | Comparison of commercial kits for the extraction of DNA from paddy soils | |
| CN103361439A (en) | Method for integrated detection of nine beer-spoilage bacteria | |
| CN105316329A (en) | Flammulina velutipes SSR molecular marker and corresponding primers and application thereof | |
| CN104293778A (en) | Establishing method of cymbidium microsatellite labels, core fingerprint label database and kit | |
| Taipale et al. | Methane-oxidizing and photoautotrophic bacteria are major producers in a humic lake with a large anoxic hypolimnion | |
| CN103882105A (en) | Method for measuring content of saturated hydrocarbon-degrading gene AlkB in petroleum-contaminated soil | |
| Tian et al. | Spatiotemporal transition of bacterioplankton diversity in a large shallow hypertrophic freshwater lake, as determined by denaturing gradient gel electrophoresis | |
| CN102533964B (en) | Predominant bacteria in Leaf of Assam Tea microorganism species and spectrogram thereof | |
| CN104830974A (en) | Soil microbial diversity analysis method | |
| CN113528614B (en) | Plant phyllosphere surface microorganism metagenome detection method | |
| CN104975090A (en) | Method for automatically detecting abundance of butane oxidizing bacteria | |
| CN103305616A (en) | Kit for verifying warehouse booklice based on specific primer | |
| Wagner et al. | A simple method for the enumeration of methanogens by most probable number counting | |
| CN104630356A (en) | Method for analyzing unknown microorganisms in soy source fermented grains | |
| CN102559862B (en) | Dominant fungi in Leaf of Assam Tea microorganism species and spectrogram thereof | |
| CN108642190B (en) | Forensic medicine composite detection kit based on 14 autosomal SNP genetic markers | |
| CN102367472A (en) | Single/duplex PCR (polymerase chain reaction) detection method for botanical adding material in milk or milk powder | |
| Kroeger et al. | Stable isotope probing—detection of active microbes in soil | |
| Wang et al. | Protocols of applification of denaturing gradient gel electrophoresis(DGGE) in studies of environmental microorganism | |
| CN102433385B (en) | Primers for identifying leuconostoc mesenteroides and application thereof | |
| CN103952468A (en) | DGGE analysis method for bacterial diversity in northeast naturally-fermented sauerkraut | |
| CN103060225B (en) | Space enterococcus faecium LCT-EF20 strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150812 |