CN104830879B - A kind of interference target sequence for having inhibiting effect to foot and mouth disease virus - Google Patents

Abstract

The present invention discloses one section of interference target sequence for having inhibiting effect to foot and mouth disease virus.The interference target sequence for having inhibiting effect to foot and mouth disease virus of the present invention is the RNA interference target sequences being located on milk cow functional gene ENTPDase6 mRNA, and sequence is nucleotide sequence, the nucleotide sequence shown in SEQ ID No.2 and the nucleotide sequence shown in the nucleotide sequence shown in SEQ ID No.3 shown in the SEQ ID No.1 in sequence table.Hairpin DNA complementary series can be determined by above-mentioned sequence respectively, hairpin double-stranded RNA can be transcribed into after the DNA sequence dna is transfected to ox cell using suitable genophore, it can be combined with the SEQ ID No.1 fragments specifics in milk cow functional gene ENTPDase6, so as to inhibit the normal expression of ENTPDase6, make the reduction of its expression product amount, and then inhibit the duplication of foot and mouth disease virus.

Description

A kind of interference target sequence for having inhibiting effect to foot and mouth disease virus

Technical field

There is the sequence for inhibiting immunization the present invention relates to one section, exactly the present invention relates to have suppression to foot and mouth disease virus The interference target sequence of making.

Background technology

Aftosa is a kind of caused by foot and mouth disease virus (foot-and-mouth disease virus, FMDV), master Endanger acute, the hot and high degree in contact infectious diseases common to human beings and animals of artiodactyl beast.It is characterized in that route of transmission is more, spread speed Soon, Epidemic Scope is wide, and infectiousness is strong, and infection rate is high, and cause of disease variation is big, and the extent of injury is strong, is almost all caused every year to aquaculture Huge economic loss.Cross-protection test and serological test confirmation foot and mouth disease virus have 7 serotypes, i.e. O, A, C (Europe Type) and Asia1 (Type Asia 1) and STA1, STA2, STA3 (South Africa type).There is presently no effective medicines for the disease Object mainly still aims at prevention.However it is demonstrated experimentally that resist between variant serotype almost without Immunogenicity, i.e. one kind Serum is only capable of protecting a kind of infection of Virus Type.In addition, aftosa morbidity is rapid, infection is exceedingly fast, infection animal usually 2~ Just serious disease occurs in 3 days.Inactivated vaccine generally could generate protection antibody after being inoculated with 7 days, start to play disease-resistant Toxic action.Therefore, current vaccine is not enough to cope with quick illness outbreak, needs to develop more effective viral resistant strategies to solve Certainly these problems.

Invention content

The present invention provides the matter for having the interference target sequence of inhibiting effect to foot and mouth disease virus and being prepared by these target sequences Grain, it is contemplated that these interference target sequences and plasmid can make milk cow have certain inhibiting effect to foot and mouth disease virus, and can turn cultivating Application in gene foot-and-mouth disease virus resistant milk cow.

The interference target sequence for having inhibiting effect to foot and mouth disease virus of the present invention is to be located at milk cow functional gene On ENTPDase6mRNA RNA interference target sequence, sequence be sequence table in SEQ IDNo.1 shown in nucleotide sequence, The nucleotide sequence shown in the nucleotide sequence shown in nucleotide sequence and SEQ IDNo.3 shown in SEQ IDNo.2.

Above-mentioned sequence SEQ IDNo.1, SEQ IDNo.2 and SEQ IDNo.3 is cultivating transgenosis foot-and-mouth disease virus resistant milk Application in ox.

Hairpin DNA complementary series can determine that according to aforementioned SEQ IDNo.1 target sequences, carried using suitable gene Body can be transcribed into hairpin double-stranded RNA after the DNA sequence dna is transfected to ox cell, can be with milk cow functional gene SEQ IDNo.1 fragments specifics in ENTPDase6 combine, and so as to inhibit the normal expression of ENTPDase6, make its expression production Object amount reduces, and then inhibits the duplication of foot and mouth disease virus.The sense strand sequence of hairpin DNA complementary series is in sequence table SEQ IDNo.4；Antisense strand sequence is SEQ IDNo.5 in sequence table.

Hairpin DNA complementary series can determine that according to aforementioned SEQ IDNo.2 target sequences, carried using suitable gene Body can be transcribed into hairpin double-stranded RNA after the DNA sequence dna is transfected to ox cell, can be with milk cow functional gene SEQ IDNo.2 fragments specifics in ENTPDase6 combine, and so as to inhibit the normal expression of ENTPDase6, make its expression production Object amount reduces, and then inhibits the duplication of foot and mouth disease virus.The sense strand sequence of hairpin DNA complementary series is in sequence table SEQ IDNo.6；Antisense strand sequence is SEQ IDNo.7 in sequence table.

Hairpin DNA complementary series can determine that according to aforementioned SEQ IDNo.3 target sequences, carried using suitable gene Body can be transcribed into hairpin double-stranded RNA after the DNA sequence dna is transfected to ox cell, can be with milk cow functional gene SEQ IDNo.3 fragments specifics in ENTPDase6 combine, and so as to inhibit the normal expression of ENTPDase6, make its expression production Object amount reduces, and then inhibits the duplication of foot and mouth disease virus.The sense strand sequence of hairpin DNA complementary series is in sequence table SEQ IDNo.8；Antisense strand sequence is SEQ IDNo.9 in sequence table.

Above-mentioned each hairpin DNA complementary series can be in the application in cultivating transgenosis foot-and-mouth disease virus resistant milk cow.

Corresponding recombinant plasmid can be prepared into using aforementioned hairpin DNA complementary series.These recombinant plasmids also may be used Application in transgenosis foot-and-mouth disease virus resistant milk cow is cultivated.

It is well known that the infection of virus and pathogenic being decided by virus and the aspect of body two.Viral gene decides virus Intrusion and replication capacity；The immune substance that body is then generated by active or induction plays anti-infectious function.Therefore, it is antiviral Infection research should also be studied in terms of viral gene and body disease-resistant virus gene two.Due to foot and mouth disease virus, there are multiple Serotype and virus easily variation itself, are difficult to reach ideal effect with vaccine to prevent the outburst of aftosa merely Fruit.And start in itself from animal body, it cultivates the transgenic animals with viral infection resisting or duplication and is one and tempting grind Study carefully direction.Study on Transgenic Animal is the mankind according to wish something lost that is purposeful, planned, with good grounds, having pre- insight change animal Composition is passed, is an experimental technique based on modern molecular biology and animal embryo and gamete biotechnology.Transgenosis The generation of animal indicates that transgenic technology can be applied successfully in people, avoids the reproduction isolation of object interspecies sterility, carries out base Because of exchange, break species boundary, break through the limitation of affiliation, it is special to cultivate the tool that nature and conventional breeding are difficult to generate The animal varieties of merit.

RNA interference (RNA interference) is a kind of efficient gene silencing technology, can pass through the homologous virus of silence Gene or the silence host gene related with virus replication inhibit virus infection, and side effect seldom occur, therefore are one strong Strong potential antiviral weapon.RNAi is a kind of posttranscriptional gene silencing process of sequence-specific, passes through 21-23bp's DsRNA molecules cause the degradation process with the mRNA sequence of its homology.

In terms of foot-and-mouth disease virus resistant research, RNAi also plays important role, and many scholars have carried out this courageously It attempts.Chen etc. applies to RNAi technology in the research of anti-FMDV for the first time, the targeting FMDV VP1 genes of design SiRNA, siRNA expression plasmids can make the expression of FMDV VP1 genes reduce by 80%~90% in BHK-21 cells.And SiRNA is expressed using recombinant adenoviral vector, as a result adenovirus can completely inhibit the duplications of FMDV in the cell；It is tried in cavy In testing, the depression effect of adenovirus is also very notable.Then there are many scholars of country variant again to apply different carriers pair FMDV different genes have carried out interference test, all achieve certain antiviral effect.Illustrate RNAi technology in resistant to foot and mouth disease disease There are very big potentiality in the research of poison.However the strategy of this viral interference gene be highly susceptible to virus serotype and its easily The influence of mutation.

Research shows that FMDV is mainly using integrin as receptor, including 8 four kinds of α v β 1, α v β 3, α v β 6, α v β integrins And Heparan sulfate, wherein α v are the common subunits of four kinds of integrins.Therefore using gene Knockout by Contents in Cows The clpp gene of interior coding integrin is removed the silence that lives and is fallen, and then cultivates integrin using Embryonic stem cell clones technology The cow embryo stem cell of gene delection, and then cultivate the milk cow that there is certain resistance to foot and mouth disease virus.Such disease-resistant milk Foot and mouth disease virus is not present the difference of serotype in ox, has a universal resistance, thus with higher actual application value and Vast market prospect.However for silencing virus acceptor gene being relied on to carry out for breeding for disease resistance merely and yet there are no acquirement The relevant report of breakthrough progress.May be since acceptor gene is in itself for the constituent of animal body, metabolism And other physiological functions have important role.

It is found in animal body with the infection of virus, duplication, assembling and the relevant gene pairs breeding for disease resistance of release extremely It is important, by silence or it can modify these genes and achieve the purpose that breeding for disease resistance.Recent research indicate that it destroys ENTPDse6 genes can inhibit foot and mouth disease virus in the intracellular duplication of ox to a certain extent.ENTPDse6, i.e. CD39L2 belong to It is a kind of plasma film egg that can completely hydrolyze film extracellular nucleotides in extracellular ribonucleoside triphosphote-diphosphonic acid hydrolase family In vain, it has already been proven that have expression in heart, brain, lungs, liver, skeletal muscle and endothelial tissue.ENTPDse6 can influence place The main necessary nucleosides quantity of protein glycosylation, and these host proteins for FMDV duplication or it is other it is basic generation step be must It needs.Therefore can be considered and silence transformation is carried out to this gene, kind of a new path is undoubtedly for resistant to foot and mouth disease breeding.

The present invention invention thinking be：

RNA interferes the degradation for causing the mRNA sequence homologous with it by the dsRNA molecules of 21-23bp, is a kind of sequence Special posttranscriptional gene silencing process.Since the most effective siRNA of mammalian cell is 21-23 base size, 3 ' ends There are two the double-stranded RNAs of prominent base.The sequence specificity of siRNA requires very rigorous, a base mistake between said target mrna With can all significantly weaken Gene silencing efficacy, and influenced by factors such as G/C content, self stability and other homologous sequences. It is thus typically necessary to design siRNA using special design tool, directly synthesis siRNA is expensive and unstable, so It needs to design according to carrier and synthesizes DNA complementary therewith, be then attached on carrier so that operation can carry out on DNA level. The DNA fragmentation of synthesis is connected on commercialization plasmid vector, is built into and is carried containing the recombination with target segment homologous DNA fragment Body, then by the recombinant vector containing different DNA fragmentations individually or mixing transfection is to the bovine kidney cells to foot and mouth disease virus sensitivity, The hairpin dsRNA for target sequence is formed after transcription.Challenge viral dosage is carried out with the foot and mouth disease virus of different serotypes and is detected Bovine kidney cells containing recombinant vector select the good RNA interference of antiviral effect to the resistant function of foot and mouth disease virus Target site.It being capable of target segment confrontation mouth hoof in the ENTPDse6 that is interfered of simple and fast verification using the plasmid vector of commercialization The validity of epidemic disease poison can be laying foundation for subsequent cultivation transgenosis foot-and-mouth disease virus resistant milk cow.

The present invention carries out RNA interference to the ENTPDase6 genes of ox first, screens effective interference site.By experiment 3 interference sites of the present invention are determined in screening, i.e., respectively by target sequence SEQ in the ENTPDase6 genes of milk cow Position determined by IDNo.1, SEQ IDNo.2 and SEQ IDNo.3, can show preferable foot-and-mouth disease virus resistant effect.

RNA interference is directed to milk cow functioning gene rather than structural gene in institute of the invention.Experiment confirmation pair These three positions in ENTPDase6 genes, which carry out interference, will not cause the apparent damage of ox cell, therefore can greatly improve and turn The safety and feasibility that gene foot-and-mouth disease virus resistant milk cow is cultivated.

Target sequence according to the present invention is not limited by hoof-and-mouth disease serotypes, to the hoof-and-mouth disease of various serotype Poison has different degrees of inhibiting effect, and be not easy to be influenced by foot and mouth disease virus variability powerful feature.

The present invention is directed inhibit foot and mouth disease virus reproduction process in the cell rather than poisoning intrusion process.It can be with It is complementary to one another with the strategy of silencing virus acceptor gene, accelerates to cultivate the process of transgenosis foot-and-mouth disease virus resistant milk cow.

Technology path used in the present invention is technology more mature and commonly used at present, and operability is strong.

Description of the drawings

Fig. 1 is pSilencer 4.1-CMV puro Vector maps；

Fig. 2 is recombinant plasmid BamH I, III double digestions of Hind and BamH I, III single endonuclease digestion figures of Hind；

Fig. 3 is transfection recombinant plasmid and normal MDBK cytological maps under the conditions of puromycin-resistant；

Fig. 4 is transfection recombinant plasmid and normal MDBK cells Western-blot collection of illustrative plates；

Fig. 5 is to the inhibition figure of different serotypes FMDV after target sequence gene silencing；

Specific embodiment

Specific embodiment of the invention material therefor and equipment source：

1st, cell and virus：Bovine kidney cells (MDBK), A types are O-shaped, Asia I type foot-and-mouth disease virus.

2nd, strain and carrier used：Competent escherichia coli cell DH5 α (are purchased from Dalian treasured biotech firm), carrier pSilencer^TM4.1-CMV puro (are purchased from Ji Tai bio tech ltd).

3rd, toolenzyme and biochemical reagents：The small extraction reagent kit of ordinary plasmids, ampicillin, T4DNALigase, BamH I, Hind III, DNAMarker (are purchased from TaKaRa companies)；Liposome Lipofection 2000 is purchased from GIBCO companies；Purine is mould Plain (Puromycin) is purchased from Amersco companies；Cell culture DMEM, fetal calf serum are purchased from TBD companies；Other reagents are Domestic and imported analysis is pure.

4th, equipment and equipment

GHP-9080 water isolation type constant incubators, the permanent Science and Technology Ltd. in Shanghai one；

SWCJ-1F superclean benches, safe and sound company of Su Jing groups；

HH.S-1-Ni electric-heated thermostatic water baths, Beijing Chang'an scientific instrument factory；

17 microcentrifuges of MICROCL, Shanghai San Diego bio tech ltd；

XDS-1B inverted biologic microscopes, the good Asource industry Science and Technology Ltd. in Beijing；

SWCJ-1CU clean benches, SuZhou Antai Air Tech Co., Ltd.；

DYCP-31DN type electrophoresis tanks, Liuyi Instruments Plant, Beijing；

DYY-6C type electrophoresis apparatuses, Liuyi Instruments Plant, Beijing；

JY04S-3C Labworks image acquisition and analysis softwares, Beijing Jun Yi east electrophoresis equipment Co., Ltd.

U.S.'s Shellab carbon dioxide incubators, Shanghai Princeton biotechnology Development Co., Ltd；

Embodiment 1：The specific structure of recombinant vector and preparation method in the present invention：

1st, siRNA stencil designs

MRNA sequence (the GeneBank accession number of ox ENTPDase6 genes is downloaded from GeneBank：NM_ 001045991), following three interference target segment is filtered out using siRNA design softwares：

SEQ ID No.1：AATGTACAGTTCTCGAAATAA

SEQ ID No.2：AAGTGCTCATGCAGAAGCTGT

SEQ ID No.3：AAGCCAGGTCTTTCTGCTTAT

It is required, is determined respectively for above-mentioned each target sequence RNA interference sequence according to pSilencer 4.1-CMV carriers (Fig. 1) Row template, these artificial synthesized length are the DNA sequence dna of 55bp：

(1) the hairpin DNA complementary series determined according to SEQ ID No.1

SEQ ID No.4：

Positive-sense strand：

5'-GATCCTGTACAGTTCTCGAAATAATTCAAGAGATTATTTCGAGAACTGTACATTA-3'SEQ ID No.5：

Antisense strand：

5'-AGCTTAATGTACAGTTCTCGAAATAATCTCTTGAATTATTTCGAGAACTGTACAG-3'

(2) the hairpin DNA complementary series determined according to SEQ ID No.2

SEQ ID No.6：

Positive-sense strand：

5'-GATCCGTGCTCATGCAGAAGCTGTTTCAAGAGAACAGCTTCTGCATGAGCACTTA-3'SEQ ID No.7：

Antisense strand：

5'-AGCTTAAGTGCTCATGCAGAAGCTGTTCTCTTGAAACAGCTTCTGCATGAGCACG-3'

(3) the hairpin DNA complementary series determined according to SEQ ID No.3

SEQ ID No.8：

Positive-sense strand：

5'-GATCCGCCAGGTCTTTCTGCTTATTTCAAGAGAATAAGCAGAAAGACCTGGCTTA-3'SEQ ID No.9：

Antisense strand：

5'-AGCTTAGCCAGGTCTTTCTGCTTATTCTCTTGAAATAAGCAGAAAGACCTGGCG-3'

2nd, construction of recombinant vector

(1) annealing conditions：Annealing buffer is dissolved in by above-mentioned synthetic DNA is single-stranded, makes a concentration of 1ng/ μ L.It is isometric mixed It closes, 90 DEG C of 3min, 37 DEG C of 1h annealing form the double-strand with cohesive end corresponding with pSilencer 4.1-CMV carriers DNA。

(2) linked system：Take after above-mentioned annealing 1 μ L, pSilencer 4.1-CMVvector of DNA solution, 1 μ L, 10 × 6 μ L of T4DNA Ligase Buffer 1 μ L, T4DNAligase (5U/ μ L) 1 μ L, Nuclease-free Water, mixing are equal It is even, 16 DEG C of connections overnight.

3rd, culture medium and conversion tablet are prepared：

(1) LB fluid nutrient mediums prepare (400ml)：Tryptone 4g, Yeast Extract 2g, NaCl 4g, add 300mlddH₂O, being sufficiently stirred makes its dissolving, and about 80 μ L of 5N NaOH are added dropwise, adjusts PH about 7.0, adds ddH₂O is settled to 400ml. 121 DEG C, 0.1MPa, high pressure sterilization 20min, 4 DEG C save backup.

(2) the LA solid mediums containing antibiotic (ampicillin) prepare (400ml)：Tryptone 4g,Yeast Extract 2g, NaCl 4g, Agra powder 4.8g, add 300mlddH₂O, being sufficiently stirred makes its dissolving, and 5N NaOH are added dropwise About 80 μ L adjust PH about 7.0, add ddH₂O is settled to 400ml.121 DEG C, 0.1MPa, high pressure sterilization 20min, it is cooled to 60 DEG C of left sides The right side adds in antibiotic (ampicillin) 200 μ L to it in super-clean bench, is down flat plate after mixing, 4 DEG C save backup.

4th, transformed competence colibacillus cell DH5 α

(1) the above-mentioned connection products of 5 μ L are added in 50 μ L competent cell DH5 α, mixing, ice bath 30min；

(2) 42 DEG C of heat stress 90s, immediately after ice bath 3min；

(3) it adds in 300 μ L to shift to an earlier date in 37 DEG C of preheated LB culture mediums without antibiotic, 37 DEG C, the training of 150rpm shaking tables Support 1h；

(4) LB culture mediums in 200 μ L (3) is taken to apply conversion tablet, after dry, 37 DEG C are inverted tablet culture about 14h.

(5) in the middle part of tablet, medium sized single bacterium colony is inoculated into the LB fluid nutrient mediums containing ammonia benzyl picking, 37 DEG C of shaking tables, 150rpm cultures about 14h.

5th, plasmid extraction, double digestion identification and sequencing

(1) plasmid is extracted in bacterium night from above-mentioned (5), and according to 50% glycerine and bacterium solution 1 according to the small specification that carries of plasmid: 1 ratio preserves strain in -20 DEG C.

(2) BamH I is to plasmid, the experiment of III double digestions of Hind sequentially adds above-mentioned matter into the 1.5ml EP pipes of sterilizing Grain DNA 10 μ L, BamH I and Hind III each 1 μ L, 10 × K buffer 2 μ L, ddH₂O supplies total system to 20 μ L, mixing；37 Digestion 2h under DEG C water bath condition, 70 DEG C of 10min terminate digestions.

(3) above-mentioned double digestion product into row agarose gel electrophoresis is detected, the ideal recombinant plasmid of digestion result is sent It is sequenced to Jin Wei intelligence biotech firm.

6th, a large amount of preparations of recombinant plasmid

(1) the 50 correct bacterium solutions of μ L sequencing results are drawn from the glycerol stock of -20 DEG C of preservations, is inoculated into the LB liquid of 3-4mL In culture medium, 37 DEG C of shaken cultivations to OD600 are more than 1.6-1.8.

(2) bacterium solution of 1mL is taken in 400mL LB fluid nutrient mediums, and 37 DEG C of shaken cultivations to OD600 are more than more than 2.0. Ampicillin is added to 170 μ g/mL, 37 DEG C of shaken cultivations shake 15h.

(3) plasmid is extracted from above-mentioned bacterium solution according to Promega Midiprep System specifications, -20 DEG C of preservations are standby With.

The results are shown in Figure 2 for recombinant plasmid double digestion, and swimming lane 1-4 is respectively：III double digestion of BamH I, Hind；BamH I is single Digestion；III single endonuclease digestions of Hind；5000marker.Plasmid vector overall length 4781bp, close to 5000bp；Junction fragment is only 55bp (not observing in electrophoretogram).In addition plasmid order-checking result complies fully with theoretical value, it was demonstrated that successfully constructs above-mentioned recombination Carrier.

Embodiment 2：Cell transfecting and screening experiment

1st, material

(1) cell and carrier

MDBK cells (laboratory preservation), recombinant plasmid vector pSilencer-SEQ4, pSilencer-SEQ5, pSilencer-SEQ6；

(2) reagent

Plasma-free DMEM medium, 10% fetal calf serum, lipofectamine box Lipofection Reagent 2000 are purchased from GIBCO companies；Puromycin (Puromycin) is purchased from Amersco companies；Trypsase is public purchased from Promega Department, other reagents are analyzed pure for domestic and imported.

2nd, experimental facilities and equipment

6 porocyte culture plates, Corning companies of the U.S.；

XDS-1B inverted biologic microscopes, the good Asource industry Science and Technology Ltd. in Beijing；

HH.S-1-Ni electric-heated thermostatic water baths, Beijing Chang'an scientific instrument factory；

SWCJ-1CU clean benches, SuZhou Antai Air Tech Co., Ltd.；

The common laboratory equipments such as cell bottle, liquid-transfering gun, EP pipes.

3rd, experimental method

(1) for 24 hours in advance, by bovine kidney cells according to 3 × 10⁵Density be inoculated into 6 porocyte culture plates.

(2) transfection liquid is prepared：Following two liquid are prepared in EP pipes, are the amount used in each hole cell.

A liquid：The above-mentioned each 2 μ L of three kinds of recombinant plasmids of 94 μ L+ of culture medium without serum measure 100 μ L eventually, (incubating 5min)；

B liquid：Not 95 μ L+5 μ L lipofectamine 2000 of serum-containing media measure 100 μ L eventually.

(3) A, B liquid are gently mixed, places 20min under room temperature.

(4) serum free medium of the cell in 6 orifice plates is rinsed twice, adds in 1ml serum free mediums.

(5) mixed liquor of A liquid and B liquid is added dropwise in hole, gently shakes culture plate, mixing.37 DEG C, 5%CO₂Culture 6 hours are kept the temperature in case.

After (6) 6 hours, the complete medium containing serum is replaced, at 37 DEG C, 5%CO₂After being cultivated for 24 hours in incubator, with 1：10 dilution ratio is inoculated into new tissue culture plate.

(7) plus puromycin carries out screening and culturing, is connected with the serum free medium of the final concentration of 4 μ g/ml of purine-containing mycin It is continuous to cultivate for 24 hours, then with the complete medium continuous passage culture 5-6 generations of the final concentration of 3 μ g/ml of puromycin.

4th, experimental result

As shown in figure 3, figure is the upgrowth situation figure for the MDBK cells for transfecting recombinant plasmid and untransfected.By puromycin Resistance screening, most cells in 48h are rounded and come off cellular control unit, and transfect the cell passage 5-6 of recombinant plasmid Generation still well-grown.

5th, conclusion

The result shows that recombinant plasmid vector successfully is imported MDBK cells, having existing for puromycin selection pressure In the case of, recombinant plasmid can continue to exist in the cell and can stablize expression.

Embodiment 3：The identification and analysis of SDS-PAGE and Western-blot

1st, material

(1) cell

Normal MDBK cells transfect the MDBK cells for reaching for the 6th generation after recombinant plasmid.

(2) reagent

PBS, SDS Buffer, separation gel and concentration glue, destainer；Anti- ENTPDase6 polyclonal antibodies, ELIAS secondary antibody (laboratory preservation), other reagents are that domestic and Import Analysis is pure.

2nd, experimental facilities and equipment

17 microcentrifuges of MICROCL, Shanghai San Diego bio tech ltd；

LBC-20BA2 electromagnetic ovens, Guangdong Luo Bei Electronics Co., Ltd.s；

WD9405B horizontal shakers, Beijing Liuyi Instrument Factory；

164-5050 electrophoresis apparatuses, electrophoresis tank, U.S. BIORAD；

JY300C type electrophoretic blotting instrument, Beijing Jun Yi east electrophoresis equipment Co., Ltd；

Ultra low temperature freezer, power ＆ light company of the U.S.；

3rd, experimental method

(1) sample treatment：The 6th generation MDBK positive cell of transfection recombinant plasmid and normal MDBK cells are collected, with Cell is collected by centrifugation in 800rmp, 4min, and wash MDBK positive cells with PBS removes remaining culture medium 3 times as possible.Add in 100 μ L PBS suspension cells again, quick-frozen speed is melted three times under the conditions of -80 DEG C, then adds in 100 μ L2 × SDS Buffer [50mmol/L Tris-HCL pH6.8；100mmol/L dithiothreitol (DTT)s (DTT)；2%SDS；0.1% bromophenol blue；10% is sweet Oil] it is made fully to be sufficiently mixed with PBS- cell suspending liquids, 10min is boiled, 12000rmp centrifugations obtain supernatant.

(2) 12% separation gel and 5% concentration glue and electrophoretic buffer is prepared：

The separation glue formula of 5ml 12%：ddH₂O 2.17ml；40% sol solution 1.5ml；1.5M Tris HCl(PH 8.8)1.25ml；50 μ L of 10%SDS；25 μ L of 10%APS；TEMED 2.5μL.

5% concentration glue formula：ddH₂O 3ml；40% sol solution, 625 μ L；0.5M Tris HCl(PH 6.8) 1.25ml；50 μ L of 10%SDS；25 μ L of 10%APS；TEMED 5μL.

SDS-PAGE running buffer formula of liquid：Glycine 4.32g；Tris alkali 0.91g, 10%SDS 3ml；DdH2O constant volumes To 300ml.

(3) above-mentioned 20 μ L loadings of sample are taken using micro sample adding appliance, with 80 volts of electrophoresis during beginning, treats that sample enters separation gel After be adjusted to 120 volts, continue electrophoresis to bromjophenol blue and reach separation gel bottom, electrophoresis terminates, and removes gel, Coomassie brilliant blue [25% Isopropanol (V/V), 10% (V/V) glacial acetic acid, 0.1% (W/V) coomassie brilliant blue R_250] dyeing liquor is removed after dyeing 2h, with de- Color liquid [10% (V/V) glacial acetic acid, 5% (V/V) ethyl alcohol] decolourizes, and replaces destainer therebetween 2~3 times, until decoloration is abundant, observation Electrophoresis situation.

(4) Western Blot related liquids are prepared：

Transfering buffering liquid (1L)：2.93g glycine, 5.28g Tirs alkali, 0.37g SDS, 200ml methanol, ddH₂O constant volumes To 1L；

Immunoblotting substrate solution：15mg DAB (dimethylbenzidine), 9mg CoCl2 are dissolved in 30ml PBST 6H₂O, the H of 10 μ L 30%₂O₂Mixing.

(5) transferring film：3 times after polyacrylamide gel after SDS-PAGE is rinsed with deionized water, lie against with transfer On nitrocellulose (NC) film that buffer solution is prewetted, bubble is eliminated.It places to use respectively under nitrocellulose filter and on gel and turn Four accurate alignments or be slightly less than nitrocellulose filter and the filter paper of gel size that liquid relief is prewetted, are placed in half dry type electrotransfer instrument In so that gel transfers 150min in cathode, NC films in anode, ice bath, crossing current 120mA.

(6) cellulose membrane containing Protein Marker is cut, 5min is dyed, then decolourized with destainer with amino black. After the remaining cellulose membrane containing detection sample is fully rinsed three times with PBST, the skimmed milk power for adding in 5% is closed overnight, so Film is washed with 20ml PBST three times, add in the diluted anti-ENTPDase6 polyclonal antibodies of confining liquid 1: 150,25 DEG C of effects afterwards 1h.Film is washed on shaking table with PBST 4~5 times, add in 1: 20000 diluted ELIAS secondary antibody, be incubated at room temperature 1h, 3 are rinsed with PBST It is secondary.It after addition 15ml substrate solutions are protected from light the colour developing several seconds, are terminated and reacted with deionized water, observe result.

4th, experimental result

As shown in figure 4, in figure 1,2,3 be respectively standard protein, transfect recombinant vector MDBK cell proteins, normal MDBK Cell protein.Target protein ENTPDase6 sizes are 56kDa.

5th, experiment conclusion

Compared with normal MDBK, the ENTPDase6 expression quantity for transfecting the MDBK of recombinant vector is substantially reduced, and illustrates that recombination carries Body can interfere with the normal expression of ENTPDase6 genes in bovine kidney cells, its expression quantity is made to decrease.

Embodiment 4：Attack poison and test experience

1st, material

(1) cell and virus

Normal and transfection recombinant vector MDBK cells, BHK-21 cells, the viral (laboratory of A, O, Asia I type foot-and-mouth disease It preserves)；

(2) reagent

DMEM culture mediums, 10% fetal calf serum, Hanks liquid, other reagents are that domestic and Import Analysis is pure.

2nd, experimental facilities and equipment

96 porocyte culture plates, Corning companies of the U.S.；

LD4-2 low speed centrifuges, Beijing medical centrifuge are long；

XDS-1B inverted biologic microscopes, the good Asource industry Science and Technology Ltd. in Beijing；

SWCJ-1CU clean benches, SuZhou Antai Air Tech Co., Ltd.；

The common laboratory equipments such as cell bottle, liquid-transfering gun, EP pipes.

3rd, experimental method

After (1) the 6th generation MDBK positive cell and normal MDBK cell culture 20-24h, with 4 × 10²TCID50/ holes FMDV infection, 37 DEG C, 5%CO₂1h is incubated in incubator, makes virus infected cell, to three A, O, Asia I type different serotypes FMDV does parallel laboratory test.

(2) after 1h, cell is collected by centrifugation with 800rmp, 2min, with dcq buffer liquid (150mM NaCl, 20mM morpholine second Sulfonic acid acid, PH 6.0) rinse with kill culture medium and cell surface residual virus, then change continuous with fresh DMEM medium Culture.

(3) cell culture supernatant (virus liquid) in different time periods is collected, titrates BHK-21 cells, during measuring different Between section supernatant TCID50.

(4) TCID50 of virus is measured according to Reed-Muench methods.Specific method is as follows：

1. per hole 1ml cultured BHK-21 cells, 37 DEG C of 5%CO₂Culture grows up to individual layer to cell in incubator.

2. above-mentioned virus liquid maintaining liquid work is serially diluted for 10 times, it is respectively 10 to make its concentration^-1、10^-2…10^-10。

3. discarding the growth-promoting media on BHK-21 tissue culture plates, washed 3 times with Hanks liquid, different dilutions are added in per hole Virus liquid 1ml, each 3-4 hole of dilution, control wells add 1ml maintaining liquids, 37 DEG C of 5%CO₂1h is adsorbed in incubator, is sucked out 1ml maintaining liquids are added after malicious sample.It gently shakes up, 37 DEG C of 5%CO₂It is cultivated in incubator.Day by day the cytopathy feelings in each hole are observed Condition is observed continuously 4 days.

4. all there is CPE for (++++) in cell；There is CPE for (+++) in 50%-70% cells；2%-50% cells go out Existing CPE is (++)；25% there is CPE as (+) using inner cell；No CPE is (-), and TCID50 is carried out by Reed-Munch calculating methods.

4th, experimental result

As shown in figure 5, Fig. 5 (A), 5 (B), 5 (C) represent right with different serotypes FMDV (A types, O-shaped, Asia I type) respectively MDBK cells attack the TCID50 of the different time cell culture fluid after poison, can reflect the toxin expelling situation of MDBK cells.

As seen from Figure 5, the MDBK cells of recombinant vector are transfected in the different detection times after attacking poison, culture solution In virus quantity all be significantly lower than normal MDBK cells.This experiment proves that above-mentioned three kinds of target sequences can be to a certain degree after being disturbed Upper inhibition foot and mouth disease virus well should have in terms of foot-and-mouth disease virus resistant transgenic dairy cultivation in duplication intracellular MDBK Use potential.

Claims (6)

1. a kind of interference target sequence group for having inhibiting effect to foot and mouth disease virus, which is characterized in that it is described interference target sequence group be SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3.

2. a kind of hairpin DNA groups determined for interference target sequence group described in claim 1, it is characterised in that：The hair The sense strand sequence of clip-like DNA groups is SEQ ID No.4, SEQ ID No.6 and SEQ ID No.8；Its antisense strand sequence is SEQ ID No.5, SEQ ID No.7 and SEQ ID No.9 in sequence table.

3. the recombinant plasmid prepared using the hairpin DNA groups described in claim 2.

4. the interference target sequence group described in claim 1 for having inhibiting effect to foot and mouth disease virus is cultivating transgenosis resistant to foot and mouth disease Application in viral milk cow.

5. application of the hairpin DNA groups in transgenosis foot-and-mouth disease virus resistant milk cow is cultivated described in claim 2.

6. application of the recombinant plasmid in transgenosis foot-and-mouth disease virus resistant milk cow is cultivated described in claim 3.