CN104830858A - Micro RNA molecule related to occurrence and development mechanism of serous ovarian cancer and application of same - Google Patents
Micro RNA molecule related to occurrence and development mechanism of serous ovarian cancer and application of same Download PDFInfo
- Publication number
- CN104830858A CN104830858A CN201510098622.7A CN201510098622A CN104830858A CN 104830858 A CN104830858 A CN 104830858A CN 201510098622 A CN201510098622 A CN 201510098622A CN 104830858 A CN104830858 A CN 104830858A
- Authority
- CN
- China
- Prior art keywords
- ovarian cancer
- mir
- serous ovarian
- application
- serous
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a micro RNA molecule related to the occurrence and development mechanism of serous ovarian cancer and an application of the same, and belongs to the technical field of tumor occurrence mechanism researching. The micro RNA molecule is miR-126-5p and is represented as the SEQ ID No.1. The miR-126-5p in the invention is significantly reduced in expression in serous ovarian cancer tissue and is closely related to serous ovarian cancer cells. After over-expression of the miR-126-5p, proliferation, migration and invasion of the serous ovarian cancer cells are significantly inhibited. The miR-126-5p provides a new target for design of molecular targeting treatment drugs for ovarian cancer, is used for designing and developing new drugs for target treatment on ovarian cancer and provides a potential new bio-marker for early-stage clinical diagnosis of the ovarian cancer.
Description
Technical field
The invention belongs to tumour mechanism studying technological domain, be specifically related to a kind of microRNA molecule relevant to serous ovarian cancer generation development mechanism and application thereof.
Background technology
Ovarian cancer is common gynecologic malignant tumor, and its lethality rate but accounts for the first place of all kinds of gynecological tumor, causes serious threat to women's life and health, wherein common with serous ovarian cancer, accounts for the 60-70% of whole epithelial ovarian cancer.Ovarian tumors mechanism is complicated, not bright so far.The grade malignancy of tumour depends on the propagation, migration and invasion ability etc. of tumour cell.Find the mark that shifts in early days of ovarian cancer cell most important for the molecule parting of ovarian cancer, targeted therapy and prognosis early warning etc.
The research of microRNA in the generation development mechanism of tumour is in recent years more and more deep.The microRNA molecule of differential expression in serous ovarian cancer is filtered out by microRNA chip technology, and verify with Real-Time Fluorescent Quantitative PCR Technique, again by cell function experimental study, likely select the molecule relevant to serous ovarian cancer generation development mechanism.
Ovarian cancer mechanism is complicated, so far not bright, and lack early diagnosis means, lethality rate occupies gynecologic malignant tumor first place, therefore the effect of clearly new microRNA in ovarian cancer generation development mechanism, new clue can be provided, for clinical diagnosis, clinical treatment provide new biological target to select for the generation development mechanism of illustrating ovarian cancer.
Summary of the invention
The object of the present invention is to provide a kind of microRNA molecule relevant to serous ovarian cancer generation development mechanism and application thereof.
The present invention is achieved through the following technical solutions:
A microRNA molecule relevant to serous ovarian cancer generation development mechanism, this microRNA molecule is miR-126-5p, and its nucleotide sequence is as shown in SEQ.ID.NO.1.
MiR-126-5p is as the application of target in the medicine and/or diagnostic reagent of the anti-serous ovarian cancer of preparation.
The application of the mark of development is there is in miR-126-5p as ovarian cancer.
Increase the application in the medicine of carrier, molecule or the composition suppression human epithelial ovarian carcinoma cells proliferation that miR-126-5p expresses in serous ovarian cancer.
Increase carrier, molecule or the composition application in the medicine suppressing Migration of Ovarian Cancer Cells that MiR-126-5p expresses in serous ovarian cancer.
Increase carrier, molecule or the composition application in the medicine suppressing ovarian cancer cells invasion that MiR-126-5p expresses in serous ovarian cancer.
Compared with prior art, the present invention has following useful technique effect:
Involved miR-126-5p provided by the invention is a kind of microRNA molecule, and its nucleotide sequence is as shown in SEQ.ID.NO.1.MiR-126-5p has the characteristic of low expression in serous ovarian cancer, is the mark that development occurs a kind of new ovarian cancer.
MiR-126-5p provided by the invention expresses and significantly reduces in serous ovarian cancer tissue: and relevant to serous ovarian cancer cells into close, the propagation of the serous ovarian cancer cell after process LAN miR-126-5p, migration, invasive ability obviously suppress.
MiR-126-5p provided by the invention is that design ovarian cancer molecular targeted therapy provides new target spot, in order to the new drug of design and development targeted therapy ovarian cancer, also for the early clinical diagnosis of ovarian cancer provides potential new biomarker.
Accompanying drawing explanation
Fig. 1 is that real-time quantitative PCR detects the expression level of MiR-126-5p in serous ovarian cancer;
Fig. 2 is miR-126-5p mimics (the microRNA analogue body of chemosynthesis) transfection ovarian cancer cell line, fluorescent mark transfection efficiency result figure; Wherein, (a) is fluorescence labeled cell picture after transfection, and (b) is cell picture before transfection;
Fig. 3 is that scratch experiment is detected expression miR-126-5p to the impact of Migration of Ovarian Cancer Cells ability;
Wherein, (a) is miR-126-5p mimic; B () is NC group; C () is blank group;
Fig. 4 is that Transwell experiment is detected expression miR-126-5p to the impact of Migration of Ovarian Cancer Cells, invasive ability.Wherein, A is shift image, and B is invasion and attack image;
Fig. 5 is migration experiment statistics result figure;
Fig. 6 is Matrigel statistics figure.
Embodiment
The expression level of the clear and definite MiR-126-5p of 1.1 qRT-PCR in serous ovarian cancer
Its sequence of A.MiR-126-5p: cauuauuacuuuugguacgcg.
1.1.1 design of primers
hsa_miR_126-5p_Primer Forward Primer(20μM):
CATTATTTACTTTGGTACGCG
Downstream primer is carry UniversalPrimer in QIAGEN company miScript SYBR Green PCR Kit
Control Primer:Hs_RNU6-2_1miScript Primer Assay
1.1.2100 routine serous ovarian cancer paraffin embedded tissues and the normal fimbriated extremity of fallopian paraffin embedded tissues Total RNAs extraction of 50 examples, as shown in table 1:
The routine ovarian cancer patients clinical pathological characteristic of table 1 100
Whole RNA leaching process will wear masks and gloves, and rifle head used and EP pipe, all with DEPC process, prevent RNA from degrading.Paraffin-embedded tissue being cut into thin slice × 10 (tissue surface is exposed to the paraffin organization in air, then removes 3 that just start to cut) of 8 μm, is paraffin tissue sections dewaxing with dimethylbenzene.RNA extraction is carried out according to extracting RNA test kit (miRNeasy FFPE Kit) reagent specification sheets from paraffin organization.Gene Company Limited nucleic acid-protein analyser NanoDROP2000 is adopted to detect RNA solution D 260/D280 optical density(OD) (OD) value, RNA concentration and purity, 1.8<D260/D280<2 can be used for further detection.
By the RNA extracted, carry out reverse transcription experiment with the Reverse Transcriptase kit (miScript RT Kit) of QIAGEN company, reaction system is as shown in table 2:
Table 2
Above-mentioned reverse transcription reaction system mixing is put and operates on ice.Hatch 60min for 37 DEG C, hatch 5min for 95 DEG C, with deactivation ThermoScript II mix, be then placed on ice.If be not PCR immediately, the cDNA after reverse transcription is in-20 DEG C of preservations.
Carry out qRT-PCR experiment
A. miScript SYBR Green PCR Kit test kit is used to test
B. by reaction system application of sample extremely every hole, as shown in table 3
Table 3
C. reaction conditions: denaturation 95 DEG C of 15min, three steps one are followed, and (sex change 94 DEG C of 15sec, anneal 55 DEG C of 15sec, extends to add to gather fluorescent signal 70 DEG C of 34sec, totally 40 circulations.
D. carry out data analysis with SSPS software and tabulate.
The expression level of large sample the result prompting miR-126-5p in serous ovarian cancer tissue is starkly lower than normal oviduct tissue, as shown in Figure 1.Show thus, the down-regulated expression of miR-126-5p may be relevant to serous ovarian cancer generation development mechanism.
1.2 cell migrations-scratch experiment detects miR-126-5p on cell migration function influence
For whether clear and definite miR-126-5p affects to some extent on the transfer ability of ovarian cancer cell, the miR-126-5p mimics/NC by by chemosynthesis:
has-miR-126-5p mimics:
sense:5’-CAUUAUUACUUUUGGUACGCG-3’,Anti-sense:5’
-CGUACCAAAAGUAAUAAUGUU-3’;
Negative control:sense:
5’-UUCUCCGAACGUGUCACGUTT-3’,Anti-sense:5’-ACGU
GACACGUUCGGAGAATT-3’;
Transfection is to ovarian cancer Skov3 cell respectively, makes miR-126-5p increase at Skov3 cells and be detected and expresses miR-126-5p to the impact of ovarian cancer cell cut healing ability.In transfection fluorescently-labeled miRNA mimic to ovarian cancer Skov3 cell, to take pictures with fluorescence microscope after 24h, see Fig. 2, wherein, a () is fluorescence labeled cell picture after transfection, b () is cell picture before transfection, checking transfection efficiency, and result display fluorocyte number > 70% is transfection success.
Digestion transfection after 48 hours mimics group, NC group, blank group 60mm Tissue Culture Plate cell, be inoculated in 24 orifice plates, 37 DEG C, constant temperature, 5%CO
2saturated humidity incubator in cultivate, cover with after making it spend the night.Morning next day respectively organizes cell cut with 10 μ l rifle heads perpendicular to 24 orifice plates, with PBS washed cell 1 time, changes pure culture base, in 37 DEG C after taking pictures, and constant temperature, 5%CO
2saturated humidity incubator in continue cultivate, observe after 24h and take pictures.
See Fig. 3, wherein, (a) is miR-126-5p mimic; B () is NC group; C () is blank group; Result shows, and the migration of process LAN miR-126-5p to ovarian cancer cell serves restraining effect.
1.3 cell migrations, Qin Xi – Transwell test and detect miR-126-5p on cell migration, invasive ability impact
A. in 1:8 ratio Matrigel glue and serum-free McCoy ' s substratum fully mixed and be made into matrigel, add the matrigel 50 μ L prepared in each Transwell cell, hatch 3-4h in 37 DEG C of incubators and make it solidify.
B. by the miR-126-5p mimics of 24h after transfection, mimics NC and normal Skov3 cell dissociation, resuspended with serum free medium.The Transwell cell completing glue adds 200 μ L containing 1 × 10 in room
5the cell suspension of individual cell, lower room adds the substratum of 600 μ L containing 10% foetal calf serum, is placed in 37 DEG C, 5%CO
2cellar culture in incubator.
C.24h stop afterwards cultivating, dab with cotton swab cell and the matrigel that film is not worn on striping upper strata.1% formaldehyde fixes bottom cell, 0.1% violet staining, under the microscope random selecting 5 visual field countings, and takes pictures, and takes the mean as wearing theca cell number.
D. carry out data analysis with SSPS software and tabulate.
Migration test is similar to Matrigel step, and difference is not spread Matrigel glue in migration test room.
Be detected see Fig. 4, Transwell experiment and express miR-126-5p to the impact of Migration of Ovarian Cancer Cells, invasive ability.Wherein, A is shift image, and B is invasion and attack image; Result prompting process LAN miR-126-5p serves restraining effect to the migration of ovarian cancer cell, invasion and attack.Analyze the result of migration experiment and Matrigel as shown in Figure 5, Figure 6.After Fig. 5 result display display process LAN miR-126-5p, the transporting action of ovarian cancer cell organizes obvious being suppressed with negative control group and blank.After Fig. 6 result display process LAN miR-126-5p, the invasion and attack effect of ovarian cancer cell organizes obvious being suppressed with negative control group and blank.
In sum, involved MiR-126-5p provided by the invention is a kind of microRNA molecule, there is the characteristic of low expression in serous ovarian cancer, it is the mark that development occurs a kind of new ovarian cancer, ovarian cancer mechanism is complicated, so far not bright, and lack early diagnosis means, lethality rate occupies gynecologic malignant tumor first place, therefore the effect of clearly new microRNA in ovarian cancer generation development mechanism, can provide new clue for the generation development mechanism of illustrating ovarian cancer, be clinical diagnosis, and clinical treatment provides new biological target to select.
MiR-126-5p molecule provided by the invention has the characteristic of low expression in serous ovarian cancer tissue, and in serous ovarian cancer cell, play the effect suppressing its cell proliferation, migration, invasion and attack, be therefore the mark that a kind of potential new ovarian cancer shifts in early days.MiR-126-5p expresses and obviously to lower and relevant to serous ovarian cancer cells into close in serous ovarian cancer, and the cell proliferation of transfection miR-126-5p group, migration, invasive ability significantly organize cell lower than other.
Claims (6)
1. a microRNA molecule relevant to serous ovarian cancer generation development mechanism, is characterized in that, this microRNA molecule is miR-126-5p, and its nucleotide sequence is as shown in SEQ.ID.NO.1.
2. miR-126-5p according to claim 1 is as the application of target in the medicine and/or diagnostic reagent of the anti-serous ovarian cancer of preparation.
3. there is the application of the mark of development in miR-126-5p according to claim 1 as ovarian cancer.
4. increase the application in the medicine of carrier, molecule or the composition suppression human epithelial ovarian carcinoma cells proliferation that miR-126-5p expresses in serous ovarian cancer.
5. increase carrier, molecule or the composition application in the medicine suppressing Migration of Ovarian Cancer Cells that MiR-126-5p expresses in serous ovarian cancer.
6. increase carrier, molecule or the composition application in the medicine suppressing ovarian cancer cells invasion that MiR-126-5p expresses in serous ovarian cancer.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510098622.7A CN104830858A (en) | 2015-03-05 | 2015-03-05 | Micro RNA molecule related to occurrence and development mechanism of serous ovarian cancer and application of same |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510098622.7A CN104830858A (en) | 2015-03-05 | 2015-03-05 | Micro RNA molecule related to occurrence and development mechanism of serous ovarian cancer and application of same |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104830858A true CN104830858A (en) | 2015-08-12 |
Family
ID=53809058
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510098622.7A Pending CN104830858A (en) | 2015-03-05 | 2015-03-05 | Micro RNA molecule related to occurrence and development mechanism of serous ovarian cancer and application of same |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104830858A (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2104736A2 (en) * | 2006-12-08 | 2009-09-30 | Asuragen, INC. | Mir-126 regulated genes and pathways as targets for therapeutic intervention |
CN102573856A (en) * | 2009-09-10 | 2012-07-11 | 弗莱明·韦林 | Method for the preparation of micro-RNAand its therapeutic application |
-
2015
- 2015-03-05 CN CN201510098622.7A patent/CN104830858A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2104736A2 (en) * | 2006-12-08 | 2009-09-30 | Asuragen, INC. | Mir-126 regulated genes and pathways as targets for therapeutic intervention |
CN102573856A (en) * | 2009-09-10 | 2012-07-11 | 弗莱明·韦林 | Method for the preparation of micro-RNAand its therapeutic application |
Non-Patent Citations (2)
Title |
---|
ANA等: "The small RNA expression profile of the developing murine urinary and reproductive systems", 《FEBS LETTERS》 * |
JEANNETTE等: "miR-126 and miR-126: New Players in Cancer", 《THE SCIENTIFIC WORLD JOURNAL》 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Yang et al. | MiR-1246 promotes metastasis and invasion of A549 cells by targeting GSK-3β‒mediated Wnt/β-catenin pathway | |
Drakaki et al. | Functional microRNA high throughput screening reveals miR-9 as a central regulator of liver oncogenesis by affecting the PPARA-CDH1 pathway | |
Kim et al. | Human lung cancer-associated fibroblasts enhance motility of non-small cell lung cancer cells in co-culture | |
Ma et al. | LncRNA FER1L4 suppressed cancer cell growth and invasion in esophageal squamous cell carcinoma. | |
Gao et al. | Long non-coding RNA LINC00324 exerts pro-tumorigenic effects on liver cancer stem cells by up-regulating Fas ligand via PU box binding protein | |
Dai et al. | Role of miR-139 as a surrogate marker for tumor aggression in breast cancer | |
Liu et al. | MicroRNA-494-dependent WDHDI inhibition suppresses epithelial-mesenchymal transition, tumor growth and metastasis in cholangiocarcinoma | |
Wang et al. | Role of lncRNAHCP5/microRNA-525–5p/PRC1 crosstalk in the malignant behaviors of ovarian cancer cells | |
Chen et al. | Long noncoding RNA (lncRNA) FOXD2-AS1 promotes cell proliferation and metastasis in hepatocellular carcinoma by regulating MiR-185/AKT axis | |
Paudel et al. | MicroRNA-130b functions as a tumor suppressor by regulating RUNX3 in epithelial ovarian cancer | |
Jia et al. | A common MicroRNA signature consisting of miR-133a, miR-139-3p, and miR-142-3p clusters bladder carcinoma in situ with normal umbrella cells | |
Wang et al. | MicroRNA‑873 inhibits the proliferation and invasion of endometrial cancer cells by directly targeting hepatoma‑derived growth factor Retraction in/10.3892/etm. 2022.11475 | |
CN107630092A (en) | The 3p of miR 505 are applied to diagnosis, prognosis and the treatment of prostate cancer with osseous metastasis | |
Zhang et al. | CMIP is oncogenic in human gastric cancer cells | |
Zhao et al. | Long non-coding RNA BBOX1-antisense RNA 1 enhances cell proliferation and migration and suppresses apoptosis in oral squamous cell carcinoma via the miR-3940-3p/laminin subunit gamma 2 axis | |
CN108374048A (en) | A kind of lncRNA markers for diagnosing and treating hepatocellular carcinoma | |
CN106834486A (en) | Osteosarcoma molecule diagnosis and treatment mark and its application | |
CN105925719A (en) | Gene related to liver cancer differentiation and application of gene | |
CN109055561A (en) | LncRNA-AP003774.1 is diagnosing and/or treating the application in breast cancers | |
CN116103403B (en) | Biomarker for diagnosis and prognosis of ovarian cancer and application thereof | |
Xiao et al. | CD44 affects the expression level of FOS‑like antigen 1 in cervical cancer tissues | |
CN104873984B (en) | Purposes of the microRNA 548k inhibitor in treating and/or preventing esophageal squamous cell carcinoma | |
US8664191B2 (en) | Use of two microRNA moleculars in lung cancer prognosis and medicine preparation | |
CN104830858A (en) | Micro RNA molecule related to occurrence and development mechanism of serous ovarian cancer and application of same | |
CN110628791B (en) | Application of tRNA (transfer RNA) modified enzyme gene in non-small cell lung cancer |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
EXSB | Decision made by sipo to initiate substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150812 |