CN104830811B - The gene-deletion attenuated live vaccine Candidate Strains of H9N2 subtype avian influenza virus NS1 and its construction method and application - Google Patents
The gene-deletion attenuated live vaccine Candidate Strains of H9N2 subtype avian influenza virus NS1 and its construction method and application Download PDFInfo
- Publication number
- CN104830811B CN104830811B CN201510307375.7A CN201510307375A CN104830811B CN 104830811 B CN104830811 B CN 104830811B CN 201510307375 A CN201510307375 A CN 201510307375A CN 104830811 B CN104830811 B CN 104830811B
- Authority
- CN
- China
- Prior art keywords
- rtx
- gene
- avian influenza
- virus
- influenza virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to the gene-deletion attenuated construction methods of live vaccine Candidate Strain rTX NS1 128 of H9N2 subtype avian influenza virus NS1 and application.The gene-deletion attenuated live vaccine Candidate Strain rTX NS1 128 of H9N2 subtype avian influenza virus NS1, it is using A/chicken/Taixing/10/2010TX strains as female parent, the length of NS1 genes is lacked so that NS1 albumen only retains 128 amino acid as shown in SEQ ID NO.15.The vaccine candidate strain is only capable of replicating in tracheae, is not in contact propagation, and security is good.The vaccine candidate strain both can be used alone, and turn into the effective tool of H9 subtype avian influenza prevention and control, can be also used in combination with inactivated vaccine, there is provided more certain immanoprotection action.Particularly important effect will be played in H9 subtype avian influenza prevention and control.
Description
Technical field
H9N2 subtype avian influenza virus (AIV) NS1 length proteins are entered by Reverse Genetics the present invention relates to one kind
The method of row modification structure broad spectrum activity H9N2 hypotype AIV attenuated live vaccines, the AIV related generally to is BJ-94-like and Y280-
The strain of like pedigrees.
Background technology
H9N2 subtype avian influenza virus is in worldwide prevalence, from its in 1994 after China's Mainland chicken cluster time separation it is wide
To propagate, endemic conditions disease is gradually formd in China, the aquaculture to China causes huge economic loss.Except sense
Contaminate outside poultry, H9N2 hypotypes AIV can also infect mammal (pig and people etc.).Although H9N2 hypotypes AIV infection people simply cause
Subclinical or slight clinical symptoms, but H9N2 hypotypes AIV can be recombinated with other subtype avian influenza virus so as to produce newly
Lethal people influenza virus, such as H5 subtype avian influenza virus and H7N9 subtype influenza virus.Therefore, H9N2 subtype avian influenzas
Prevention and control are also significant in public health.
Vaccine immunity is the effective means of prevention and control of fowl influenza.Genome yet with AIV is that segmented RNA virus is easy
Generation is matched somebody with somebody again, and the poor replication fidelity that RNA polymerase replicates is easily caused the quick variation of virus, and therefore, existing inactivated vaccine flows to fowl
It is unsatisfactory to feel control effect.The existing strain for early stage of inactivated virus vaccine that China uses at present, such as Ck/SH/F/
98 and Ck/SD/6/96 (BJ/94 pedigrees) (Li C, Yu K, Tian G, et al Evolution of H9N2influenza
viruses from domestic poultry in Mainland China.Virology,2005,340:70-83).Also have
For recent epidemic strain (Y280 pedigrees) (Zhang Y, Yin Y, Bi Y, et al.Molecular and antigenic
characterization of H9N2avian influenza virus isolates from chicken flocks
Between 1998and 2007in China.Vet Microbiol 2012,156,285-293.), vaccinated flock is still frequently
There is H9N2 hypotypes AI Epidemic outbreak of disease.Under laboratory condition, after SPF chickens group is inoculated with inactivated vaccine prepared by early stage strain, use
The H9N2 hypotypes AIV of current popular carries out attacking poison in a manner of collunarium, and high-caliber toxin expelling (Sun Y, Pu J, Jiang can still occur
Z,et al.Genotypic evolution and antigenic drift of H9N2influenza viruses in
China from1994to 2008.Vet Microbiol,2010,146:215-225.)；And prepared using part epidemic strain
Inactivated vaccine can not protect well SPF chickens resist H9N2 virus attack (Liu Dong, Gong Xiao, Liu Xiaodong, etc.
.2013.H9N2 the screening China animal quarantine .2013.30. (6) of subtype avian influenza Epidemic analysis and vaccine strain:45-50；
Wan Xiaopeng, Zeng Xianying, Tian Guobin, wait the screening China Preventive Veterinary Medicine of .H9N2 subtype avian influenza epidemic strain inactivated vaccines kind poison
Report .2010.32 (4):277-280).Therefore, the vaccine that there is intersecting protective for different pedigree H9 hypotypes AIV strains is developed
It is extremely urgent.
Compared with traditional inactivated vaccine, attenuated live vaccine can induce body to produce mucous membrane and cellullar immunologic response, tool
There is the good advantage of cross-protection.Moreover, attenuated live vaccine can be immunized by way of spraying or drinking water, it is easy to use,
Greatly reduce human cost.By taking live Newcastle disease vaccine as an example, it is not required to injection and only just can quickly and easily completes chicken with drinking-water
Mass immunization (Senne DA, King D J, Kapczynski D R.Control of Newcastle disease only
by vaccination.Developments in biologicals,2004,119 165-70.).Some researchs show, lead to
The activity for crossing the NS1 albumen for hindering or reducing influenza virus being capable of attenuated virus (Quinlivan M, Zamarin D, Garcia-
Sastre A,et al.Attenuation of equine influenza viruses through truncations of
the NS1protein.Journal of virology,2005,79(13):8431-9.Zhou B,Li Y,Belser JA.,
et al.NS-based live attenuated H1N1pandemic vaccines protect mice and
ferrets.Vaccine,2010,28(50):8015-8025.), and NS1 albumen is non-structural protein, and it is transformed simultaneously
The viral antigenicity of itself is not interfered with.Development and maturation with influenza virus Reverse Genetics, can be in vitro to disease
The virulence associated gene of poison is modified and quickly obtains and cause weak recombinant virus, obtains potential attenuated live vaccine Candidate Strain.
In this research, we are with A/chicken/Taixing/10/2010 (TX) strain (Zhu Y, Yang, Liu W, et
al.Comparison of biological characteristics of H9N2avian influenza viruses
isolated from different hosts,Archives of virology,2015,160:It is 917-927) female parent, it is right
The length of its NS1 gene carries out different degrees of missing so that NS1 albumen retains 73,100 and 128 amino acid respectively, passes through
Reverse Genetics save out 3 plants of H9 hypotype AIV NS1 gene-deleted strains.The virulence and immune efficacy of gene-deleted strain are determined, picks out poison
Power is minimum and and can keeps the recombinant virus of immune efficacy to observe it to different pedigrees after chicken is immunized as vaccine candidate strain simultaneously
H9 hypotypes AIV attacks the protection cross-protection of poison offer.
The content of the invention
H9N2 hypotypes AIV, which infects, causes huge economic loss to aviculture, and H9N2 hypotypes fowl stream is currently mainly used
Sense inactivated vaccine carrys out the prevention and control diseases.Higher HI antibody is produced because H9N2 subtype avian influenzas inactivated vaccine can only induce, it is impossible to
Cellular immunity and mucosa-immune are provided, they are difficult that cross protection is provided to the H9N2 hypotypes AIV that antigenic variation easily occurs, it occur frequently that
Immuning failure.Therefore, it is necessary to develop energy inducing cell, body fluid and mucosa-immune, the new weak poison of intersecting protective is produced
Live vaccine.
Using A/chicken/Taixing/10/2010 (TX) strains of the Y280 pedigrees of current popular as female parent, to NS1 genes
Length carry out different degrees of missing so that NS1 albumen retains 73,100 and 128 amino acid respectively；Wild type NS1 albumen
Amino acid sequence as shown in SEQ ID NO.12；The sequence of above-mentioned 73,100 and 128 amino acid of reservation is SEQ ID respectively
NO.13, SEQ ID NO.14 and SEQ ID NO.15.3 plants of H9 hypotypes restructuring AIV are saved out using Reverse Genetics.Measure
The Virulence Indices and immune antiboidy production of recombinant virus, filter out the recombinant virus conduct that security is good and immunogenicity is good
Vaccine candidate strain, it is evaluated after immune chicken different pedigree H9 hypotypes AIV are attacked with the protective effect of poison offer, friendship can be provided by filtering out
Pitch the attenuated live vaccines of protection.
The technical solution adopted in the present invention is：The gene-deletion attenuated live vaccine candidates of H9N2 subtype avian influenza virus NS1
Strain rTX-NS1-128, it is using A/chicken/Taixing/10/2010TX strains as female parent, and the length of NS1 genes is lacked
Lose so that NS1 albumen only remains 128 amino acid；The sequence of 128 described amino acid is as shown in SEQ ID NO.15.
The present invention further discloses rTX-NS1-128 construction method, is with A/chicken/Taixing/10/
2010TX strains are female parent, expand NS genes with NS full length gene primer NS-1 and NS-2 reverse transcription PCR, are cloned intoCarry
Body, positive plasmid pCR2.1-TX-NS is constructed, using pCR2.1-TX-NS as template, primer NS-1 and NS-128- is applied in combination
OL-F, and NS-128-OL-R and NS-2 amplify NS1 genes epimere and hypomere band respectively；By two sections with 1:1 mixing
Primer NS-1 and NS-2 is used to amplify 810bp NS-128 full-length genes as template afterwards；By this gene cloning extremelyCarrier, structure positive plasmid pCR2.1-TX-NS1-128；By pCR2.1-TX-NS1-128 and transcriptional expression plasmid
PHW2000 is respectively with being attached structure transcriptional expression plasmid pHW2000-TX-NS1-128 after Bsm I digestions；By turning for acquisition
The host cell of expression plasmid cotransfection avian influenza virus license is recorded, harvest Transfected cells supernatant inoculated into chick embryo allantoic cavity obtains
Rescue recombinant virus rTX-NS1-128.
The invention also discloses the described gene-deletion attenuated live vaccine Candidate Strain rTX- of H9N2 subtype avian influenza virus NS1
Applications of the NS1-128 in broad spectrum activity H9N2 hypotype AIV attenuated live vaccines are prepared.
The vaccine candidate strain is only capable of replicating in tracheae, is not in contact propagation, and security is good.Can be produced after immune chicken compared with
High HI antibody, good cross protection can be provided to the H9 hypotypes AIV in China popular two pedigrees BJ/94 and Y280.
The vaccine candidate strain both can be used alone, and turn into the effective tool of H9 subtype avian influenza prevention and control, and can also combine with inactivated vaccine makes
With, there is provided more certain immanoprotection action.Particularly important effect will be played in H9 subtype avian influenza prevention and control.
Brief description of the drawings
Fig. 1 is NS1 gene delections recombinant virus structure route map.
Fig. 2 is the PCR primer (M of NS1 gene delections:100bp mark；1:WT-TX；2:rTX-NS1-73；3:rTX-
NS1-100；4:rTX-NS1-128).
Fig. 3 is duplication situation of H9 parental virus TX and rTX-NS1 gene delection the restructuring poison in chicken tracheal tissue.
Fig. 4 is duplication situation of H9 parental virus TX and rTX-NS1 gene delection the restructuring poison in chicken lung tissue.
Fig. 5 is the antibody duration monitoring that chicken induction is immunized in recombinant virus rTX-NS1-128.
Embodiment
Specific testing program in the present invention：
1. the rescue of gene delection and vaccine strain
1.1 design of primers
According to A/chicken/Taixing/10/2010 (TX) strain virus NS gene order (Genbank sequence numbers：
JN653684, A/chicken/Taixing/10/2010 (TX) strain (Zhu Y, Yang Y, Liu W, et al.Comparison
of biological characteristics of H9N2avian influenza viruses isolated from
different hosts,Archives of virology,2015,160:917-927) design NS1 gene delection primer (tables
1)。
The design of primers of table 1
1.2Overlapping-PCR carries out missing modification to NS1 genes
Using TX strain totivirus nucleic acid as template, total length primer (NS-1 and NS-2) reverse transcription PCR (RT-PCR) amplification NS bases
Cause, using 25 μ L systems：10 × Buffer 2.5 μ L, Mg2+1.5 μ L, dNTP 0.5 μ L, each 0.5 μ L of primer NS-1 and NS-2 are (dense
Degree is 25 μm of ol/ μ L), Taq DNA polymerase (1U/ μ L) 0.5 μ L, the μ L of DNA profiling 2.5, mended with sterile ultra-pure water to 25 μ L.
Response procedures：94 DEG C of pre-degeneration 4min, 94 DEG C of denaturation 45s, 54 DEG C of annealing 45s, 72 DEG C of extension 60s, 30 circulations, 72 DEG C extend
10min.It will be added to after PCR primer plus sample-loading buffer in 1% Ago-Gel, using 100bp marker as standard reference,
With 80V electrophoresis 1h, result is observed after dyeing, TX strain NS genetic fragments total lengths are 879bp.Gel-purified QIAquick Gel Extraction Kit is returned
PCR primer is received, concentration is determined, is cloned intoVector (is purchased from Invitrogen companies), connection product conversion
Competent cell, spot, small upgrading grain are chosen, plasmid send Jin Sirui bioengineering Co., Ltd sequence verification, and positive plasmid is named as
pCR2.1-TX-NS。
Using pCR2.1-TX-NS as template, total length primer (NS1 and NS-73-OL-R) and (NS-73-OL-F and NS- are used
2) respectively PCR amplify NS genes upper (233bp), under two sections of (437bp), by two sections with 1:Template is used as after 1 mixing
The full-length gene SEQ ID NO.9 of NS-73 (NS1 albumen retains 73 amino acid) are amplified using primer (NS1 and NS2)
(645bp).Using pCR2.1-TX-NS as template, using total length primer (NS1 and NS-100-OL-R) and (NS-100-OL-F and
NS-2) respectively PCR amplify NS genes upper (314bp), under two sections of (437bp), by two sections with 1:Mould is used as after 1 mixing
Plate amplifies the full-length gene SEQ ID of NS-100 (NS1 albumen retains 100 amino acid) using primer (NS1 and NS2)
NO.10(726bp).Using pCR2.1-TX-NS as template, total length primer (NS1 and NS-128-OL-R) and (NS-128-OL- are used
F and NS-2) respectively PCR amplify NS genes upper (398bp), under two sections of (437bp), by two sections with 1:Make after 1 mixing
The full-length gene SEQ ID of NS-128 (NS1 albumen retains 128 amino acid) are amplified using primer (NS1 and NS2) for template
NO.11 (810bp) (Fig. 2).Gel-purified QIAquick Gel Extraction Kit reclaims PCR primer, determines concentration, is cloned into
Vector, connection product transformed competence colibacillus cell choose spot, small upgrading grain, and plasmid send Jin Sirui bioengineering Co., Ltd to be sequenced
Checking, positive plasmid are respectively designated as pCR2.1-TX-NS1-73, pCR2.1-TX-NS1-100 and pCR2.1-TX-NS1-128,
Saved backup in -20 DEG C.
1.3 expression plasmids are built
Positive plasmid (pCR2.1-TX-NS1-73, pCR2.1-TX-NS1-100 and pCR2.1-TX-NS1-128) limitation
Property restriction endonuclease Bsm I (NEB Products) digestion, obtain NS genetic fragments, by its with through Bsm I (NEB Products) digestion
PHW2000 (Hoffmann E, Neumann G, Kawaoka Y, et al.A DNA transfection system for
generation of influenza A virus from eight
Plasmids.Proc.Natl.Acad.Sci.U.S.A.2000,97,6108-6113.) connection, conversion, picking positive plasmid mirror
It is fixed.Positive plasmid is respectively designated as pHW2000-TX-NS1-73, pHW2000-TX-NS1-100 and pHW2000-TX-NS1-
128.The expression plasmid of acquisition is expanded and extracted after cultivating with the small plasmid kit (QIAGEN Products) that carries, while prepares TX
Other 7 genes of strain transcriptional expression plasmid (pHW2000-TX-PB2, pHW2000-TX-PB1, pHW2000-TX-PA,
PHW2000-TX-HA, pHW2000-TX-NP, pHW2000-TX-NA, pHW2000-TX-M) (voluntarily build, method is the same as NS bases
Cause), plasmid concentration is determined respectively, and its concentration is adjusted to 300ng/ μ L and is used to transfect.
The rescue of 1.4 viruses
Virus rescue is with reference to (Hoffmann E, Neumann G, Kawaoka Y, et al.A DNA such as Hoffmann
transfection system for generation of influenza A virus from eight
Plasmids.Proc.Natl.Acad.Sci.U.S.A.2000,97,6108-6113.) method is carried out.Respectively by 3 NS1 bases
It is well mixed because the transcriptional expression plasmid of missing is added in 1.5ml dactylethraes with TX each 300ng of other 7 plasmids.Again to
Added in dactylethrae in DMEM culture mediums of the 100 μ L without antibiotic and serum, micropipettor is gently blown and beaten so that plasmid exists
Fully mixed in DMEM culture mediums, add 10 μ L transfection reagents and mix again, 20min is acted in room temperature.Will be in 6mm dish
In co-cultivation MDCK and 293T cells (1:2, degrees of fusion is in 60-80% or so) washed 2 times without blood DMEM with nonreactive, add
1ml contains the DMEM of 10% hyclone.After liposome effect completely, by 800 μ L 10% DMEM add in dactylethrae with
Terminating reaction, the liquid in dactylethrae is added dropwise in culture dish afterwards.By culture dish in 37 DEG C of CO2gas incubators
After cultivating 8-10h, TPCK pancreatin is added to final concentration of 2 μ g/ml, and 37 DEG C are continued after cultivating 60h or so, will be whole with sealed membrane
Culture dish seals, and is placed in -70 DEG C of refrigerators multigelation three times.Collect the cell conditioned medium Jing Guo freeze thawing treatment and be inoculated with 7 age in days SPF
Chicken embryo (0.3ml/ embryos), is cultivated in 35 DEG C of incubators.After cultivating 72h, the HA potency of chick embryo allantoic liquid is surveyed, collects potency highest
Allantoic fluid.Then, the allantoic fluid of harvest is inoculated with instar chicken embryo on the 10th and carries out continuous passage, it is continuous to pass for 5 generations, by the restructuring of rescue
Virus is respectively designated as rTX-NS1-73, rTX-NS1-100 and rTX-NS1-128, and be stored in after being dispensed -70 DEG C it is ultralow
Temperature refrigerator preserves.Determine the chicken embryo median infective dose (EID of recombinant virus50), as a result show recombinant virus rTX-NS1-73, rTX-
NS1-100 and rTX-NS1-128 EID50Respectively 7.47,7.66 and 7.6Log10EID50/ 0.1ml, than the value of parental virus
(8.08Log10EID50/ 0.1ml) it is lower slightly.
2.SPF chicken pathogenics are tested
In order to determine recombinant virus that parental virus lack in various degree with NS1 genes to the pathogenic of chicken.44 4 week old
SPF chickens, random packet, every group 11, with 106EID50The virus quantities of/200 μ L/ only attack poison in a manner of collunarium, are continuously seen after attacking poison
Examine 21 days.
2.1 recombinant virus tissue replication capacities determine
In order to determine replication capacity of the recombinant virus in chicken organ-tissue, flutter respectively within the 3rd day and the 5th day after poison is attacked
3 chickens are killed, collect respiratory tract and lung tissue.The tissue for taking a part to collect, in electronic after 1g/0.3ml ratio addition PBS
Homogenised tissue, 8,000rpm × 10min collected after centrifugation supernatants.By supernatant inoculation SPF chicken embryo measure EID50With titrate tracheae and
Virus titer in lung tissue.All recombinant viruses can not cause obvious clinical symptoms after infected chicken.Virus is in tracheae
Content titrimetry is shown in tissue, the 3rd day after virus inoculation, the titre highests of parental virus TX groups (5.00 ±
0.43log10EID50/ g), the titres of rTX-NS1-73 groups is taken second place (3.75 ± 0.66log10EID50/ g), rTX-NS1-100 groups are again
Take second place (3.66 ± 0.80log10EID50/ g), the minimum (3.16 ± 0.64log of titre of rTX-NS1-128 groups10EID50/g)；
5th day, only parental virus TX (2.83 ± 0.29log after virus inoculation10EID50/ g) and recombinant virus rTX-NS1-73
(1.74±0.20log10EID50/ g) it can replicate (Fig. 3).Statistical analysis in viral tracheal tissue is shown, is being inoculated with
The 3rd day after virus, the titre of only rTX-NS1-128 groups is substantially less than parental virus TX groups (P<0.05).Virus is in lung tissue
Middle content titrimetry shows that the 3rd day after virus inoculation, only parental virus TX can be replicated；The 5th after virus inoculation
My god, parental virus TX can not also replicate (Fig. 4).
2.2 recombinant virus toxin expellings determine
In order to detect toxin expelling situation of the recombinant virus in chicken.Chicken is gathered respectively within the 3rd day, the 5th day and the 7th day after poison is attacked
Respiratory tract and cloacal swabs, after processing, inoculated into chick embryo detection toxin expelling situation.As a result the 3rd day after inoculation is shown, parent
The toxin expelling rate highest (100%) of viral TX groups, and the toxin expelling rate of rTX-NS1-128 groups is minimum (80%), with parental virus group it
Between difference it is not notable.The 5th day after virus inoculation, parental virus TX groups still keep 100% toxin expelling rate, rTX-NS1-73 and
The toxin expelling rate of rTX-NS1-100 groups is declined slightly, and the toxin expelling rate of rTX-NS1-128 groups then drops to 50%, is substantially less than parent
Toxin expelling rate (the p of this virus group<0.05).The 7th day after virus inoculation, only low-level toxin expelling is still presented in parental virus TX groups
(20%), recombinant virus group not toxin expelling.Qualitative analysis is carried out to cloacal swabs, as a result shown, only parental virus TX
Group can be by cloaca high efficiency toxin expelling, and 3 plants of NS1 gene delection recombinant viruses groups can not pass through cloaca toxin expelling (table
2)。
Table 2.NS1 gene delections recombinate malicious toxin expelling situation
aLarynx tracheal swab；bCloacal swab
Quantitative analysis is carried out to the cotton swab for being defined as the positive through qualitative detection.As a result show, rTX-NS1-73, rTX-
The virus titer that NS1-100 and rTX-NS1-128 groups gather in tracheal swab on the 3rd day after virus infects is respectively 3.55 ±
0.26log10EID50/0.1ml、2.94±0.50log10EID50/ 0.1ml and 1.94 ± 0.27log10EID50/0.1ml.It is and close
The virus titer of this viral TX group is 6.05 ± 0.55log10EID50/ ml, is significantly higher than (P<0.05) any recombinant virus group.
Statistical analysis discovery is carried out to restructuring virus titer, significant difference (P between rTX-NS1-128 and rTX-NS1-73 groups<
0.05) difference is not significantly (table 3), and between rTX-NS1-100 groups.
The viral tracheal swab toxin expelling quantitative analysis of table 3.
2.3 recombinant virus immunogenicity determinings
21 days after infection, chicken serum is gathered, detects the HI antibody titers in serum, judges its humoral immune response level.
As a result show, NS1 gene delection recombinant virus groups are the same with parental virus group, and body can be induced to produce preferable immune response water
It is flat, its average HI potency (table 2) between 9-10log2.
In summary, recombinant virus rTX-NS1-128 and recombinant virus rTX-NS1-73, rTX-NS1-100 and parent's disease
Malicious TX is compared, and virulence is most weak, security highest, and still keeps good immunogenicity, therefore selects recombinant virus rTX-NS1-
128 make further security and immune efficacy evaluation.
3. the propagated experiment of chicken and the monitoring of antibody duration
Propagation test of 3.1 viruses in chicken
50 SPF chickens, random packet, 10/group, wherein being only inoculated with different dilution factors for every group 5 respectively (from 103-
107EID50Totally 5 dilution factors) virus as donor group, be put into 5 chickens as contact in same cage after it attacks malicious 24h
Group.The tracheae and cloacal swab for attacking chicken in malicious group and contact group, processing are gathered respectively within the 3rd, 5 and 7 day after attacking poison and exposing
Afterwards, inoculated into chick embryo measure toxin expelling situation.After infecting or exposing 21 days, blood sampling, its HI antibody titer is determined, while observe serum
Turn positive phenomenon.As a result show, when parental virus are respectively with 105EID50、106EID50With 107EID50After dose inoculation, all inoculations
The chicken of group can pass through respiratory tract and cloaca high efficiency toxin expelling；Chicken in contact group can also lead to for the 3rd day and the 5th day after exposure
Respiratory tract and cloaca toxin expelling are crossed, and toxin expelling is horizontal similar with toxin expelling time with attacking malicious group.And when dosage of inoculation is 104EID50,
Inoculation group and the toxin expelling efficiency of the chicken in contact group have declined.When dosage of inoculation is 103EID50When, although failing from inoculation
Virus is separated in the cotton swab of group and contact group chicken, but there occurs strong blood in 21 days after inoculation or exposure for all chickens
Turn positive phenomenon clearly, show high contact transmission ability (table 4).
Different from parental virus, recombinant virus rTX-NS1-128 has completely lost contact transmission ability, even if using up to
107EID50The virus of dosage is inoculated with, and the chicken of all contact groups can not be propagated by respiratory tract and cloaca, and in exposure
Any serum does not occur within the 21st day afterwards and turns sun.And the chicken of direct infection occurs serum for 21 days and turns sun after inoculation.And use
105EID50When dosage is tested, although not isolating virus in the tracheae and cloaca of chicken from inoculation group, after inoculation
Still there is within 21 days part chicken that serum occurs and turn positive phenomenon (table 5).
The parental virus dose response of table 4. and propagation test
aAfter being inoculated with or exposing 21 days, collection chicken serum detection HI valencys.If HI values<4log2, then judge that serum does not occur to be turned
Positive phenomenon
The recombinant virus dose response of table 5. and propagation test
aAfter being inoculated with or exposing 21 days, collection chicken serum detection HI potency.If HI<4 judge that serum does not occur turns positive phenomenon
3.2 antibody durations monitor
In order to observe antibody level and duration, by the recombinant virus rTX-NS1- of the NS1 gene delections filtered out
128 with 106EID50After/200 μ L dosage is inoculated with 4 week old SPF chickens in a manner of collunarium, collected serum every 7 days and determine its HI
Potency.Antibody test result significantly rises as shown in figure 5, rear 2nd week antibody level is immunized, and reaches peak value to the 3rd week HI
(10log2Left and right), high-caliber HI valencys continue 8 weeks or so afterwards.After 9th week, antibody level is begun to decline, and by the 11st week
HI antibody titers drop to 5log2Left and right.
4. Immunoprotection test
40 4 week old SPF chickens, random packet, immune group are immunized 10 in a manner of collunarium6EID50/ 200 μ L rTX-NS1-
128, while PBS groups are set as control.After immune 21 days, with 106EID50Homotype (the homologous viral TX and heterologous of/200 μ L dosage
Viral F98) virus by collunarium mode attacks poison.Tracheae and cloacal swabs, processing are gathered within the 3rd, 5 and 7 day respectively after attacking poison
Cotton swab, SPF chicken embryos are inoculated with, isolated viral, detect toxin expelling situation.
Protest test result shows it is homologous (TX strains) or different no matter the chicken being immunized through rTX-NS1-128 receives
The attack of source (F98 strains) H9N2 subtype avian influenza virus, the tracheae gathered of the 3rd, 5 and 7 day and cloaca cotton after poison is attacked
Do not isolate virus in swab, toxin expelling rate is 0%.And control group can pass through breathing the 3rd day and the 5th day after poison is attacked
Road and the efficient toxin expelling of cloaca, toxin expelling rate are up to more than 90%, are significantly higher than (p<0.05) any immune group (table 6).
Protest test after table 6.SPF chicken immunes
aTracheal swab；bCloacal swab.
Claims (4)
- The gene-deletion attenuated live vaccine Candidate Strain rTX-NS1-128 of 1.H9N2 subtype avian influenza virus NS1, it is characterised in that it It is using A/chicken/Taixing/10/2010TX strains as female parent, the length of NS1 genes is lacked so that NS1 albumen is only Remain 128 amino acid；The sequence of 128 described amino acid is as shown in SEQ ID NO.15.
- 2. the gene-deletion attenuated live vaccine Candidate Strain rTX-NS1- of H9N2 subtype avian influenza virus NS1 described in claim 1 128, it is characterised in that obtain by the following method：It is using A/chicken/Taixing/10/2010TX strains as female parent, with NS bases Because total length primer NS-1 and NS-2 reverse transcription PCR expand NS genes, it is cloned into- carrier T, constructs positive plasmid PCR2.1-TX-NS, using pCR2.1-TX-NS as template, primer NS-1 and NS-128-OL-R, and NS-128- is applied in combination OL-F and NS-2 amplifies NS genes epimere and hypomere band respectively；By two sections with 1:Use and draw as template after 1 mixing Thing NS-1 and NS-2 amplify NS-128 full-length genes；By this gene cloning extremely- carrier T, build positive plasmid pCR2.1-TX-NS1-128；PCR2.1-TX-NS1-128 and transcriptional expression plasmid pHW2000 is laggard with Bsm I digestions respectively Row connection structure transcriptional expression plasmid pHW2000-TX-NS1-128；By the transcriptional expression plasmid co-transfection avian influenza virus of acquisition The host cell of license, harvest Transfected cells supernatant inoculated into chick embryo allantoic cavity are rescued recombinant virus rTX-NS1-128；Its In, the primer sequence is as follows：NS-1：TATTCGTCTCAGGGAGCAAAAGCAGGGTG；NS-2：ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT；NS-128-OL-F：ACAAAAACATCTAGGAAGGAGCAAT；NS-128-OL-R：ATTGCTCCTTCCTAGATGTTTTTGT.
- 3. the gene-deletion attenuated live vaccine Candidate Strain rTX-NS1-128 of H9N2 subtype avian influenza virus NS1 described in claim 1 Construction method, it is characterised in that be using A/chicken/Taixing/10/2010TX strains as female parent, drawn with NS full length genes Thing NS-1 and NS-2 reverse transcription PCR expand NS genes, are cloned into- carrier T, construct positive plasmid pCR2.1-TX- NS, using pCR2.1-TX-NS as template, primer NS-1 and NS-128-OL-R, and NS-128-OL-F and NS-2 points are applied in combination NS genes epimere and hypomere band are not amplified；By two sections with 1:After 1 mixing primer NS-1 and NS-2 are used as template Amplify NS-128 full-length genes；By this gene cloning extremely- carrier T, structure positive plasmid pCR2.1-TX-NS1- 128；By pCR2.1-TX-NS1-128 and transcriptional expression plasmid pHW2000 respectively with being attached structure transcription after Bsm I digestions Expression plasmid pHW2000-TX-NS1-128；The host that the transcriptional expression plasmid co-transfection avian influenza virus of acquisition is permitted is thin Born of the same parents, harvest Transfected cells supernatant inoculated into chick embryo allantoic cavity are rescued recombinant virus rTX-NS1-128；Wherein, the primer sequence Row are as follows：NS-1：TATTCGTCTCAGGGAGCAAAAGCAGGGTG；NS-2：ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT；NS-128-OL-F：ACAAAAACATCTAGGAAGGAGCAAT；NS-128-OL-R：ATTGCTCCTTCCTAGATGTTTTTGT.
- 4. the gene-deletion attenuated live vaccine Candidate Strain rTX-NS1-128 of H9N2 subtype avian influenza virus NS1 described in claim 1 Application in broad spectrum activity H9N2 hypotype AIV attenuated live vaccines are prepared.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510307375.7A CN104830811B (en) | 2015-06-05 | 2015-06-05 | The gene-deletion attenuated live vaccine Candidate Strains of H9N2 subtype avian influenza virus NS1 and its construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510307375.7A CN104830811B (en) | 2015-06-05 | 2015-06-05 | The gene-deletion attenuated live vaccine Candidate Strains of H9N2 subtype avian influenza virus NS1 and its construction method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104830811A CN104830811A (en) | 2015-08-12 |
| CN104830811B true CN104830811B (en) | 2018-01-09 |
Family
ID=53809013
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510307375.7A Active CN104830811B (en) | 2015-06-05 | 2015-06-05 | The gene-deletion attenuated live vaccine Candidate Strains of H9N2 subtype avian influenza virus NS1 and its construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104830811B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2694123T3 (en) | 2004-06-01 | 2018-12-18 | Icahn School Of Medicine At Mount Sinai | Swine influenza virus modified by genetic engineering and uses thereof |
| CN108220217B (en) * | 2018-01-25 | 2021-02-09 | 上海理工大学 | Attenuated listeria monocytogenes for delivering and expressing exogenous antigen and application thereof |
| CN109880835B (en) * | 2019-03-28 | 2022-03-25 | 扬州大学 | Recombinant H9N2 avian influenza virus strain, preparation method thereof, avian influenza vaccine and application thereof |
| CN111647610B (en) * | 2020-06-02 | 2021-09-03 | 扬州大学 | H9N2 subtype avian influenza virus with exchanged HA and NS1 deletion gene packaging signals and construction method and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105849270B (en) * | 2013-10-28 | 2020-02-28 | 蓝天疫苗有限责任公司 | Novel influenza virus vectors for viral therapy |
-
2015
- 2015-06-05 CN CN201510307375.7A patent/CN104830811B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| Development of a dual-protective live attenuated vaccine against H5N1 and H9N2 avian influenza viruses by modifying the NS1 gene;Eun-hye Choi等;《Arch Virol》;20150512;第160卷(第7期);摘要，图1，第1731页左栏第2段 * |
| Live Attenuated Influenza Viruses Containing NS1 Truncations as Vaccine Candidates against H5N1 Highly Pathogenic Avian Influenza;John Steel等;《JOURNAL OF VIROLOGY》;20081210;第83卷(第4期);第1742-1753页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104830811A (en) | 2015-08-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104830811B (en) | The gene-deletion attenuated live vaccine Candidate Strains of H9N2 subtype avian influenza virus NS1 and its construction method and application | |
| CN104178505A (en) | Recombinant virus for expressing swine fever virus E2 gene, and preparation method and application thereof | |
| CN103849632B (en) | S1 gene of low virulent strain of infectious bronchitis and low virulent strain and application thereof | |
| CN104017775A (en) | Influenza virus capable of infecting canids and use thereof | |
| CN104232594B (en) | Recombination classes fowl type H1N1 inactivated influenza virus vaccines strain (JS40/PR8) and its preparation method and application | |
| CN102851257A (en) | Attenuated vaccine strain for avian infectious bronchitis virus and application thereof | |
| Mansour et al. | Avian paramyxovirus type 1 in Egypt: epidemiology, evolutionary perspective, and vaccine approach | |
| JP2017212976A (en) | Infectious bronchitis vaccines derived from ib-qx-like strains | |
| CN110305898A (en) | The rescue of the non-susceptible H9N2 hypotype acclimatization to cold avian influenza virus of mammalian cell | |
| Santos Fernando et al. | Assessment of molecular and genetic evolution, antigenicity and virulence properties during the persistence of the infectious bronchitis virus in broiler breeders | |
| CN109182282A (en) | The dual-gene deletion of vaccine strain of porcine pseudorabies virus gE/gI and its construction method and application | |
| CN102994534A (en) | Duck plague virus gE gene transfer vector pUC-Delta gE-EGFP and recombinant strain DPV-Delta gE-EGFP | |
| Xia et al. | Evolution of prevalent H9N2 subtype of avian influenza virus during 2019 to 2022 for the development of a control strategy in China | |
| CN106421771A (en) | H7N9 subtype avian influenza genetic engineering vaccine taking baculovirus as carrier as well as preparation method and application of vaccine | |
| Abdel Hamid et al. | Pathogenicity of an Avian Influenza H9N2 Virus isolated From Broiler Chickens in Egypt. | |
| CN103937753B (en) | H9N2 subtype avian influenza virus strain and inactivated vaccine thereof and application | |
| CN109207438A (en) | Porcine pseudorabies virus velogen strain and its preparing the application in inactivated vaccine | |
| CN106031793A (en) | Active vaccine, and preparation method and application thereof | |
| CN104073470A (en) | Spinner-flask culture method for H9N2 subtype of avian influenza virus | |
| Bourogâa et al. | Evaluation of protection conferred by a vaccination program based on the H120 and CR88 commercial vaccines against a field variant of avian infectious bronchitis virus | |
| CN108300702B (en) | Chicken-derived H9N2 avian influenza virus cold-adapted strain screening method and application thereof | |
| Ugochukwu et al. | Peste des petits ruminants: aetiology, pathology, immunology, disease status in Africa, diagnosis, control, prevention and treatment: a review | |
| CN105087502B (en) | H9N2 subtype avian influenza virus temperature sensitivity attenuated live vaccine Candidate Strains CA 28（AH）And its application | |
| CN105802921A (en) | Recombination pesudorabies virus variant for expressing hog cholera virus E2 protein and establishment method and application of recombination pesudorabies virus variant | |
| CN109943576A (en) | A kind of recombinant rabies virus of chimeric canine distemper virus principal immune gene and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |