CN104805108B - A kind of fast construction method of high copy gene multiple repeats - Google Patents

Abstract

A kind of fast construction method of high copy gene multiple repeats of the present invention, is related to molecular biology field.Series connection multicopy is constructed more particularly to multimerization method.This method is one pot reaction, it does not need to carry out dephosphorylation and purification and recovery to carrier, operating procedure is few and simple, the gene copy number of acquisition is high, the 66%(reference examples that tandem genes more than 8 copies accounts for sum are that 10%), while the gene obtained using the step equally can further obtain the gene of higher copy using recurrence orientation connection method.

Description

A kind of fast construction method of high copy gene multiple repeats

Technical field

The present invention relates to molecular biology fields, more particularly, to a kind of rapid build of high copy gene multiple repeats Method.

Background technique

Biologically active peptide is natural amino acid to be formed and arrangement mode is constituted slave dipeptides to linear, the ring of complexity with different The general name of the biologically active different peptides of shape structure.Active peptide, which has, adjusts Human Physiology and metabolic function, easy to digest It absorbs, there is a variety of effects such as promotion immune, hormone control, antibacterial, antiviral, blood pressure lowering and reducing blood lipid, it is with higher edible Safety is one of the most popular research topic of current international food circle and function factor of great development prospect.

Currently, the method for preparing biologically active peptide is concentrated mainly on using protease hydrolyzed method and fermentation method, but is existed Natural material activity peptide content is low, hydrolysate complicated component, isolates and purifies more link, low yield and product cost height etc. and asks Topic.Chemical synthesis has the shortcomings that more than at high cost, side reaction object and residual compounds.It is using the development of technique for gene engineering Preparation and reorganization albumen provides new method, but the difficulty for producing small-molecular peptides essentially consists in: (1) unstable products, polypeptide Molecular weight is small, is easily identified by host protein enzyme, is easily degraded；(2) product is toxic, restricts the table of host germ grew and small peptide It reaches.

Micromolecule polypeptide and host's label protein amalgamation and expression are conducive to improve polypeptide stability, reduce product toxicity and mention High expression quantity, having a disadvantage in that purpose peptide, proportion is small in the fusion protein, and host expresses potential is caused to waste, and reduces mark Length protein is signed, and reduces fusion protein stability.Polypeptide gene expressing in series can effectively be solved into problem above: (1) being connected Polypeptide gene quantity is increased, is conducive to improve expression quantity；(2) expression of tandem multimers form can effectively shield host's poison Property；(3) polymer expression product is more stable.

Therefore the tandem gene for rapidly and accurately constructing small peptide is just very necessary.Current method is concentrated mainly on more Dimerization method (Multimerization) and recurrence orientation connection method (Recursive directional ligation).Poly Change method refers to that genetic fragment is connected from after connecting, then with carrier according to non-palindrome cohesive end orientation, it can by once constructing It obtains containing there are many libraries of copy number gene.The characteristics of recurrence orientation connection method is using isocaudarner restriction enzyme site, by primary Building circulation doubles the gene copy number on carrier, the available gene for accurately obtaining needing copy number of the method, But to obtain needing more cycle-index compared with high copy number, time-consuming.Connection method, the building of multimerization method are oriented compared to recurrence Speed is fast, but disadvantage is in the gene pool constructed that the copy number of gene is random, it cannot be guaranteed that a certain specific copy can be obtained The gene of shellfish number.The researchers such as McDaniel devise a kind of new thinking, and two methods are used in combination, i.e., first use multimerization Method obtains the gene of some low-copies, and the gene of the high copy of building, this method can greatly shorten construction schedule on this basis. But in the wherein process of multimerization method, operating procedure is more, including carrier enzymatic hydrolysis, carrier dephosphorylation, vector purification return Receive, target gene fragment is from connecting and be connected with carrier from connect product object, while there is genes to copy in the gene pool of building The relatively low problem of shellfish number, and these problems also lack effective solution method.

Summary of the invention

The purpose of the invention is to overcome the problems, such as that prior art exists, a kind of novel multimerization method, Ke Yigeng are provided Add simple and effective building multi-copy in tandem gene.

In order to achieve the above-mentioned object of the invention, specific technical solution is as follows:

1, carrier is transformed

One section, which is inserted into, in cloning vector multiple cloning sites or other regions contains 3 II S(G of class) restriction enzyme The double chain oligonucleotide chain in enzyme site.

Wherein 3 restriction endonucleases share one section of restriction enzyme site, the digestion of two restriction endonucleases A and B on double chain oligonucleotide chain Site is in the side of identification sequence, such asAarⅠ、BbsI HeBveI etc., the two restriction endonucleases reversely share one section of restriction enzyme site, interior Enzyme cutting C recognition site is in the two sides of one section of sequence, and cleavage site is among this section of sequence, such asAasⅠ、AdeI HeBglⅠ.This 3 Restriction endonuclease restriction enzyme site on improved carrier is unique.

2, target gene is obtained

The target gene dsDNA for having 5 ' phosphorylation cohesive ends is obtained, in the cohesive end of the gene should be passed through with carrier Enzyme cutting A(B) cohesive end that is formed after digestion is consistent.

Wherein the acquisition methods of gene have chemical synthesis, PCR product enzyme cutting method and plasmid enzyme restriction method etc., such as take chemistry The gene of method synthesis needs to carry out phosphatizing treatment.

3, one pot reaction

Improved carrier, purpose base is added in supporting the cooperative buffer solution of different kinds of molecules biology toolenzyme Cause, restriction endonuclease A(B) and T4 ligase, 18 ~ 23 DEG C, react 30 ~ 120 min.

After reaction, restriction endonuclease and ligase are inactivated, the method for can be used has heat inactivation and chloroform-ethanol precipitation method etc..

Restriction endonuclease C and T4 ligase is added in system after inactivation, 18 ~ 23 DEG C, reacts 20 ~ 60 min.

4, transformed competence colibacillus cell

System after reaction is used for transformed competence colibacillus Escherichia coli.

This method is one pot reaction, does not need to carry out carrier dephosphorylation and purification and recovery, operating procedure it is few and Simply, the gene copy number of acquisition is high, and the 66%(reference examples that tandem genes more than 8 copies accounts for sum are 10%) while benefit The gene obtained with the step equally can further obtain the gene of higher copy using recurrence orientation connection method.

Detailed description of the invention

Fig. 1 multimerization method: A, one pot reaction multimerization method, B, conventional multimerization method.

The copy number figure of Fig. 2 tandem gene.

Specific embodiment

Below by drawings and examples, technical scheme of the present invention will be described in further detail.

Term as used in the present invention generally has those of ordinary skill in the art usual unless otherwise specified The meaning of understanding.The present invention is described in further detail below with reference to specific embodiment, and referring to data.It should be understood that these Only invention is further explained for embodiment, should not be understood as limiting the scope of the present invention, the skill in the field Art engineer can make some nonessential modifications and adaptations to the present invention according to the content of foregoing invention.

Below in an example, the various processes and method being not described in detail are conventional methods as known in the art. The source of agents useful for same, trade name and it is necessary to list its constituent person, are indicated on the first occurrence, thereafter phase used Unless otherwise specified with reagent, it is the same as indicated for the first time.

Embodiment and reference examples construct process respectively as shown in attached drawing 1A and B, and original clone carrier used is pUC18 load Body, is purchased from Novagen company, and the target gene of phosphorylation is synthesized by Shanghai Sheng Gong bioengineering Co., Ltd.

Fluid nutrient medium LB(Amp): LB culture medium (old 10 g/L containing tryptose, yeast extract 5 g/L, NaCl 10 G/L, pH 7.0), ampicillin is added to final concentration of 100 mg/L.

Biology tool enzyme used be Fermaentas the quick enzyme of FastDigest, concrete operations use according to Specification.

Solid medium LB(Amp): LB culture medium (old 10 g/L containing tryptose, yeast extract 5 g/L, NaCl 10 G/L, agar 15 g/L, pH 7.0), ampicillin is added to final concentration of 100 mg/L.

Reference examples:

1, carrier is transformed

(1) design has synthesized two nucleotide chain (oligonucleotide 1:5 '-pGTACCGCGGAAGACCACCAC GTGGGCAGGTTTA-3 ', oligonucleotide 2:5 '-pAGCTTAAACCTGCCCACGTGGTGGT CTTCCGCG-3 '.

(2) equal proportion of oligonucleotide 1 and 2 is mixed, is slowly cooled to room temperature after being heated to 100 DEG C, annealing forms double Chain DNA (dsDNA).

(3) pUC18 carrier is carried outKpnI HeHindIII double digestion 1 h(37 DEG C), add dephosphorylation enzyme TAP, at 37 DEG C 1 h is managed, agarose electrophoresis is carried out, recycles carrier large fragment using plastic recovery kit.

(4) the carrier large fragment of recycling and the dsDNA to have annealed are mixed, T4 DNA ligase, 22 DEG C of connections 1 is added H, heat shock method convert bacillus coli DH 5 alpha and apply solid LB(Amp) plate, 37 DEG C of 12 h of culture.

(5) choose single colonie and be inoculated in 4 mL LB(100 mg/L Amp) fluid nutrient medium, 37 DEG C of 16 h of culture utilize matter Grain extracts kit extracts plasmid.

(6) plasmid extracted utilizesBamAgarose electrophoresis is carried out after I single endonuclease digestion of H, identifies positive colony.Positive colony is sent To the raw work sequencing in Shanghai, correct plasmid will be sequenced and be named as pUCM.

2, target gene is obtained

(1) design has synthesized two nucleotide chains (oligonucleotide 3:5 '-p CCACATTGGCTGGGGTGAT CCGACCCATATCGGTTGGGGCGACCCGAC-3 ', oligonucleotide 4:5 '-p GTGGGTCGG GTCGCCCCAACCGATA TGGGTCGGATCACCCCAGCCAAT-3’。

(2) equal proportion of oligonucleotide 3 and 4 is mixed, is slowly cooled to room temperature after being heated to 100 DEG C, annealing forms band There is the dsDNA of the non-palindromic sequence cohesive end (CCAC) of 4bp.

3, multimerization

(1) T4 DNA ligase is added in the dsDNA that will have been annealed, and connects 20 min certainly at 22 DEG C.

(2) cloning vector pUCM is carried outBbsI single endonuclease digestion 30 min(37 DEG C), add dephosphorylation enzyme TAP, 37 DEG C of processing 1 h；Then agarose electrophoresis is carried out, recycles carrier using plastic recovery kit.

(3) dsDNA is added from disjunctor system in the cloning vector handled well, 22 DEG C of 40 min of continuation, heat shock method conversion is greatly Enterobacteria DH5 α competent cell, is coated on LB(Amp) plate, 37 DEG C of 12 h of culture.

(4) choose single colonie and be inoculated in 1 mL LB(Amp) fluid nutrient medium, 37 DEG C, 160 rpm, 2 ~ 4 h of culture, picking 10 A bacterium colony send sequencing company to carry out sequencing, and sequencing result is as shown in Fig. 2, error rate 6%, and the above are 10% for 8 copies.

Embodiment:

1, carrier is transformed

Carrier part is transformed with reference examples.

2, target gene is obtained

Target gene part is obtained with reference examples.

3, one pot reaction multimerization

(1) (50 mM Tris-HCl, 100 mM potassium acetates, 15 mM magnesium acetates, 1 mM in general buffer solution DTT, 0.5 mM ATP and 0.1%BSA, pH 8.1), carrier pUCM and target gene is added,BbsI restriction endonuclease, T4 DNA connect Enzyme is connect, 60 min are reacted at 22 DEG C, 75 DEG C of 15 min of heating, add after reactionDraIII and T4 DNA is anti-at 22 DEG C Answer 30 min.

(2) reaction product heat shock method converts bacillus coli DH 5 alpha competent cell, is coated on LB(Amp) plate, 37 DEG C of trainings Support 12 h.

(3) choose single colonie and be inoculated in 1 mL LB(Amp) fluid nutrient medium, 37 DEG C, 160 rpm, 2 ~ 4 h of culture, picking 100 A bacterium colony send sequencing company to carry out sequence, and sequencing result is as shown in Fig. 2, error rate is 7%, and the above are 66% for 8 copies.

Claims (1)

1. a kind of fast construction method for high copy gene multiple repeats, which is characterized in that

(1) carrier is transformed

One section, which is inserted into, in vector multiple cloning site or other regions identifies sequence containing 3 restriction endonuclease of A, B and C The double chain oligonucleotide chain of column；Wherein 3 restriction endonuclease share one section of digestion on double chain oligonucleotide chain Site sequence, wherein the identification sequence of restriction endonuclease A is located at the side of the restriction enzyme site sequence, restriction nuclease The identification sequence of restriction endonuclease B is located at the other side of the restriction enzyme site sequence, and restriction endonuclease A and B are reversely shared The restriction enzyme site sequence；The identification sequence of restriction endonuclease C is located at the two sides of the restriction enzyme site sequence；Described 3 The restriction enzyme site of a restriction endonuclease is unique on improved carrier；Restriction endonuclease A and B are selected fromBbsⅠ、BveI HeAarI, restriction endonuclease C is selected fromAasⅠ、DraIII HeBglⅠ；

(2) target gene is obtained

The target gene dsDNA for having 5 ' phosphorylation cohesive ends is obtained, the cohesive end of the gene is with the carrier through limiting The cohesive end formed after property endonuclease A or B digestion is consistent；Wherein the acquisition methods of the target gene are selected from chemistry and close Cheng Fa, PCR product enzyme cutting method and plasmid enzyme restriction method；

(3) one pot reaction

Improved carrier is added in supporting the cooperative buffer solution of different kinds of molecules biology toolenzyme, target gene, Restriction endonuclease A or B, T4 ligase, react 30 ~ 120 min by 18 ~ 23 DEG C；After reaction, the limitation is inactivated Property endonuclease and ligase, the method for the inactivation is selected from heat inactivation or the chloroform-ethanol precipitation method；System after inactivation Middle addition restriction endonuclease C and T4 ligase, reacts 20 ~ 60 min by 18 ~ 23 DEG C；

(4) transformed competence colibacillus cell

System after reaction is used for transformed competence colibacillus Escherichia coli.