CN104774818A - Fructosyl transferase as well as gene and application thereof - Google Patents
Fructosyl transferase as well as gene and application thereof Download PDFInfo
- Publication number
- CN104774818A CN104774818A CN201510179652.0A CN201510179652A CN104774818A CN 104774818 A CN104774818 A CN 104774818A CN 201510179652 A CN201510179652 A CN 201510179652A CN 104774818 A CN104774818 A CN 104774818A
- Authority
- CN
- China
- Prior art keywords
- fructosyl transferase
- fts
- sequence
- gene
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to the field of genetic engineering, in particular to fructosyl transferase FTS-8 as well as a gene and application thereof. The invention provides the fructosyl transferase FTS-8 from Aspergillus niger, and an amino acid sequence of the fructosyl transferase FTS-8 is as shown in sequence 1. The invention provides a coding gene fts-8 for coding the fructosyl transferase. The fructosyl transferase provided by the invention has the following properties: 1) a relatively wide pH stabilizing range under a condition with pH of 4.0-8.0; 2) relatively high catalytic efficiency with Km and Kcat of 145.3g/L and 3.8*10<3>/min respectively, and 3) a relatively fructo-oligosaccharide conversion rate with concentration of 60% (w/w).
Description
Technical field
Invention relates to genetically engineered field, particularly, the present invention relates to a kind of fructosyl transferase FTS-8 and gene thereof and application.
Background technology
Oligofructose is also known as oligofructose or FOS, and molecular formula is: G-F-F
n, n=1 ~ 3 (G is glucose, and F is fructose).Oligofructose be sucrose molecules residue of fructose on logical β-1-2 glycosidic link connect 1 ~ 3 fructosyl and the fructooligosaccharides that formed: kestose, GF3, GF4 and composition thereof.Compared with traditional carbohydrate, novel oligofructose can be used as prebiotics, promotes the growth of bifidus bacillus, reduces harmful bacteria.Oligofructose has effect of water-soluble dietary fibre, and without any side effects.Oligofructose is extensively present in the plants such as barley, tomato, rye, but its content less (<1%), it is more difficult to develop.Utilize microorganism oligofructose production enzyme (fructosyl transferase) can obtain the oligofructose of high purity, high yield, fructosyl transferase is a kind of enzyme with fructosyl transfer activity, can act on sucrose catalysis and obtain the oligose such as kestose.
In fructose-transferring enzyme research, domesticly mainly concentrate on the aspects such as wild mushroom screening, property testing at present.Wang Limei etc. study a strain aspergillus fructose-transferring enzyme zymologic property and substrate specificity, and at pH 5.5, under 30 DEG C of conditions, fructosyl transferase has most high reactivity.Zheng Shi Jin Yun etc. have studied under different sucrose from the saccharase (INV) of aspergillus niger AS0023 purifying and the enzyme catalysis vigor of fructose-transferring enzyme (FTS).?
In research process in the future, excavation and the discovery with the excellent fructosyl transferase gene of superior catalytic performance seem particularly important.
Summary of the invention
The object of this invention is to provide a kind of catalysing sucrose to produce the fructosyl transferase of high-purity fructo oligosaccharides, its aminoacid sequence, the gene of this fructosyl transferase of encoding, the recombinant vectors containing this gene, the recombinant bacterial strain containing this recombinant vectors, a kind ofly prepare the gene engineering method of fructosyl transferase, the application of this fructosyl transferase.
Specifically comprise:
The invention provides a kind of fructosyl transferase FTS-8, its aminoacid sequence is as shown in sequence 1.
Sequence 1:
MKLQTASVLLGSAAAASPSMQTRASVVIDYNVAPPNLSTLPNGSLFETWRPRAHVLPPNGQIGDPCLHYTDPSTGLFHVGFLHDGSGISSATTDDLATYKDLNQGNQVIVPGGINDPVAVFDGSVIPSGINGLPTLLYTSVSFLPIHWSIPYTRGSETQSLAVSSDGGSNFTKLDQGPVIPGPPFAYNVTAFRDPYVFQNPTLDSLLHSKNNTWYTVISGGLHGKGPAQFLYRQYDPDFQYWEFLGQWWHEPTNSTWGNGTWAGRWAFNFETGNVFSLDEYGYNPHGQIFSTIGTEGSDQPVVPQLTSIHDMLWVSGNVSRNGSVSFTPNMAGFLDWGFSSYAAAGKVLPSTSLPSTKSGAPDRFISYVWLSGDLFEQAEGFPTNQQNWTGTLLLPRELRVLYIPNVVDNALARESGASWQVVSSDSSAGTVELQTLGISIARETKAALLSGTSFTESDRTLNSSGVVPFKRSPSEKFFVLSAQLSFPASARGSGLKSGFQILSSELESTTVYYQFSNESIIVDRSNTSAAARTTDGIDSSAEAGKLRLFDVLNGGEQAIETLDLTLVVDNSVLEIYANGRFALSTWVRSWYANSTNISFFQNGVGGVAFSNVTVSEGLYDAWPDRQS
Wherein, this enzyme genes encoding 628 amino acid, its theoretical molecular is 69.08kDa.
The invention provides the gene fts-8 of above-mentioned fructosyl transferase of encoding, concrete, the gene order of this enzyme is as shown in sequence 2:
ATGAAGCTTCAAACGGCTTCCGTACTGCTCGGCAGTGCTGCTGCTGCCTCGCCTTCCATGCAGACGCGGGCCTCCGTTGTCATCGACTACAATGTCGCACCTCCAAACCTATCCACTCTGCCCAATGGCTCCCTCTTCGAAACATGGCGTCCCCGCGCCCACGTCCTGCCCCCCAACGGCCAGATCGGTGACCCCTGCCTGCATTACACCGATCCCTCCACGGGCCTCTTCCACGTCGGCTTCCTTCACGATGGCAGCGGCATCTCCAGCGCCACCACTGATGATCTAGCCACCTACAAGGACCTCAACCAAGGCAACCAAGTCATTGTTCCCGGGGGTATCAACGACCCCGTCGCCGTCTTCGATGGCTCCGTCATCCCCAGCGGCATCAACGGCCTCCCCACTCTCCTCTACACCTCCGTCTCCTTCCTTCCCATCCACTGGTCCATCCCCTACACCCGCGGCAGTGAGACCCAATCCCTCGCTGTCTCCTCGGATGGCGGCAGCAACTTCACCAAGCTCGACCAGGGCCCCGTCATCCCTGGCCCTCCCTTCGCCTACAACGTCACCGCATTCCGGGACCCCTACGTCTTCCAAAACCCCACCCTCGACTCCCTCCTGCACAGCAAGAACAACACCTGGTATACCGTCATCTCCGGTGGTCTGCACGGCAAGGGCCCCGCCCAGTTCCTCTACCGCCAGTACGACCCGGACTTCCAGTACTGGGAGTTCCTCGGCCAATGGTGGCACGAGCCCACCAACTCCACTTGGGGTAACGGCACCTGGGCCGGCCGATGGGCCTTCAACTTCGAGACCGGCAACGTCTTCAGTCTCGACGAGTACGGATACAACCCCCACGGCCAGATCTTCTCCACGATCGGCACCGAGGGCTCTGACCAGCCCGTCGTGCCCCAGCTCACCAGCATCCACGACATGCTCTGGGTGTCCGGCAACGTCTCTCGCAATGGCTCTGTCTCGTTCACCCCGAACATGGCGGGCTTCCTCGACTGGGGCTTCTCCTCTTACGCAGCTGCCGGAAAGGTCCTCCCCTCGACTTCTCTGCCCTCGACGAAGAGCGGCGCCCCGGACCGCTTCATCTCGTACGTCTGGCTGTCCGGTGACCTGTTCGAACAGGCCGAAGGGTTCCCCACGAACCAGCAGAATTGGACCGGTACGCTGTTGCTTCCGCGAGAGTTGCGCGTGCTGTATATCCCCAACGTGGTGGACAATGCTCTGGCTCGGGAATCTGGTGCCTCGTGGCAGGTCGTGAGCAGCGATAGCAGTGCGGGCACCGTCGAGCTGCAGACCCTGGGTATCTCCATTGCCCGGGAAACCAAGGCCGCCCTGCTGTCGGGAACGTCGTTCACCGAGTCCGACCGTACTCTGAACAGCAGTGGTGTCGTGCCGTTCAAGCGCTCCCCGTCCGAGAAGTTCTTTGTTTTGTCCGCGCAGCTGTCCTTCCCTGCTTCGGCTAGGGGATCGGGACTCAAGAGTGGATTCCAGATTCTCTCGTCGGAGCTGGAGAGTACTACCGTGTACTACCAGTTCTCGAATGAGTCGATTATCGTCGACCGCAGTAACACCAGTGCTGCGGCGCGCACGACGGATGGTATCGATAGCAGCGCGGAGGCTGGCAAGTTGCGCCTGTTTGACGTGTTGAATGGCGGAGAGCAGGCGATTGAGACGTTGGATTTGACTCTCGTGGTGGATAACTCGGTCTTGGAGATCTATGCCAATGGTCGCTTTGCGTTGAGTACTTGGGTTCGTTCTTGGTACGCCAATTCCACGAACATCAGTTTCTTCCAGAATGGCGTGGGTGGTGTTGCGTTCTCCAACGTGACTGTTTCCGAGGGCTTGTATGATGCTTGGCCGGATCGTCAGTCT
The present invention has cloned fructosyl transferase gene fts-8 by RT-PCR method, and DNA complete sequence analysis result shows, the encoding gene fts-8 total length 1884bp of fructosyl transferase FTS-8.
Above-mentioned fructosyl transferase gene fts-8 sequence and the aminoacid sequence derived are carried out BLAST comparison in GenBank, this gene and the fructosyl transferase sequence similarity the highest (94%) deriving from A.niger strain QU10, illustrate that FTS-8 is a kind of new fructosyl transferase.
Present invention also offers the recombinant vectors comprising above-mentioned fructosyl transferase gene fts-8, is pPIC9K-fts-8.Fructosyl transferase gene of the present invention is inserted into the corresponding restriction site of expression vector, its nucleotide sequence is connected with expression regulation sequence, as a most preferably experimental program of the present invention, preferred fructo glycosyltransferase gene is inserted into plasmid pPIC9K, make this nucleotide sequence be positioned at the downstream of AOX1 promotor and regulate and control by it, obtain restructured Pichia pastoris in expression plasmid pPIC9K-fts-8.
Present invention also offers the recombinant bacterial strain comprising above-mentioned fructosyl transferase gene fts-8, preferred described bacterial strain is P.pastoris GS115, is preferably recombinant bacterial strain P.pastoris GS115/fts-8.
Present invention also offers a kind of method preparing fructosyl transferase FTS-8, comprise the following steps:
1) with above-mentioned recombinant vectors transformed host cell, recombinant bacterial strain is obtained.
2) recombinant bacterial strain is cultivated, induction, overexpression restructuring fructosyl transferase.
3) the fructosyl transferase FTS-8 also expressed by purifying is reclaimed.
Preferred described host cell is Pichia pastoris, preferably by expression of recombinant yeast Plastid transformation P.pastoris GS115, obtains recombinant bacterial strain P.pastoris GS115/fts-8.
Technical problem to be solved by this invention overcomes the deficiencies in the prior art, provide a kind of have advantageous property, can the fructosyl transferase of efficient catalytic sugar industry high-purity fructo oligosaccharides and aminoacid sequence, gene order.
Accompanying drawing explanation
Fig. 1 is fructosyl transferase recombinant plasmid pPIC9K-fts-8 collection of illustrative plates.
Fig. 2 is that pH is to fructosyltransferaseactivity activity and stability influence curve.
Fig. 3 is fructosyl transferase Lineweaver – Burk curve.
Embodiment
Embodiment 1: the clone of aspergillus niger A.niger fructosyl transferase gene fts-8
Obtain the cDNA sequence of fructosyl transferase FTS-8 based on RT-PCR, mellow fruit glycosyltransferase gene fragment be connected with Expression vector pPIC9K, obtain recombinant plasmid pPIC9K-fts-8 (Fig. 1), electricity transforms P.pastoris GS115.By recombinant bacterial strain, inoculation BMMY substratum, after induction 72h, collected by centrifugation supernatant, measure fructosyl transferase vigor, enzyme activity can reach 39.9U/mL.
Embodiment 2: fructosyl transferase FTS-8 optimal pH and pH Stability Determination
The restructuring fructosyl transferase of embodiment 4 is carried out under different pH conditions enzymatic reaction to measure its optimal pH.Substrate carries out fructosyl transferase enzyme activity determination with in the phosphoric acid-citrate buffer solution of the 0.1mol/L of different pH 45 DEG C.Result shows, enzyme activity the highest (Fig. 2 A) when recombinase FTS-8 optimal pH is 5.5.Fructosyl transferase is 25 DEG C of process 24h in the damping fluid of above-mentioned various different pH, with the pH stability of studying enzyme.Result shows, fructosyl transferase has higher stability between pH 4.0 ~ 8.0, and after process 24h, enzyme activity remains more than 80% (Fig. 2 B).This illustrates, this fructosyl transferase has wider pH stable range.
Embodiment 3: fructosyl transferase Determination of Kinetic Parameters
Be substrate with the sucrose of different concns, in 0.1M Citrate trianion pH 5.5 buffer solution system, under 50 DEG C of conditions, measure enzymic activity, calculate its kinetic parameter (Fig. 3) under 50 DEG C of conditions.After measured, when taking sucrose as substrate, K
m, k
catbe respectively 145.3g/L and 3.8 × 10
3min
-1.
Embodiment 4: fructosyl transferase catalysing sucrose produces oligofructose
Adopt above-mentioned fructosyl transferase catalytic substrate sucrose (700g/L), 40 DEG C of condition catalytic treatment 12h, adopt the concentration of oligofructose in HPLC assaying reaction system.Calculated by determination and analysis, determine that the content of oligofructose can reach 60% (w/w).
Claims (7)
1. a fructosyl transferase FTS-8, is characterized in that:
1) protein be made up of aminoacid sequence shown in sequence 1;
2) aminoacid sequence of sequence in sequence table 1 is replaced and/or disappearance and/or add and the protein that is greater than 90% of the sequence similarity derived by sequence 1 with fructosyl transferase function through one or several amino-acid residue.
2. a fructosyl transferase gene fts-8, is characterized in that, encode fructosyl transferase FTS-8 according to claim 1.
3. fructosyl transferase gene fts-8 according to claim 2, is characterized in that:
1) its DNA sequence dna is as shown in sequence 2;
2) under strict conditions with 1) DNA sequence dna that limits hybridizes and encodes and have the DNA molecular of fructosyltransferaseactivity activity albumen;
3) with 1) or 2) DNA sequence dna that limits has more than 90% homology and encode and have the DNA molecular of fructosyltransferaseactivity activity albumen.
4. comprise the recombinant vectors of the fructosyl transferase gene fts-8 described in Claims 2 or 3.
5. recombinant vectors according to claim 4, is characterized in that, described carrier is pPIC9K-fts-8 (Fig. 1).
6. prepare a method of fructosyl transferase FTS, it is characterized in that, comprise the following steps:
1) with recombinant vectors transformed host cell pichia spp (Pichia pastoris) GS 115 of claim 4, recombinant bacterial strain is obtained.
2) cultivate recombinant bacterial strain, induction restructuring fructosyl transferase is expressed.
3) the fructosyl transferase FTS-8 also expressed by purifying is reclaimed.
7. the application of fructosyl transferase described in claim 1, it is mainly used in catalysing sucrose and produces oligofructose, and wherein sucrose concentration is 5-850g/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510179652.0A CN104774818A (en) | 2015-04-15 | 2015-04-15 | Fructosyl transferase as well as gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510179652.0A CN104774818A (en) | 2015-04-15 | 2015-04-15 | Fructosyl transferase as well as gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104774818A true CN104774818A (en) | 2015-07-15 |
Family
ID=53616591
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510179652.0A Pending CN104774818A (en) | 2015-04-15 | 2015-04-15 | Fructosyl transferase as well as gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104774818A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106467899A (en) * | 2015-08-17 | 2017-03-01 | 中国科学院天津工业生物技术研究所 | A kind of Aspergillus niger strain of high yield fructose-transferring enzyme and its application |
| CN108486076A (en) * | 2017-01-05 | 2018-09-04 | 郑州轻工业学院 | A kind of aspergillus oryzae transfructosylase and its method for being used to prepare four ester of sucrose |
-
2015
- 2015-04-15 CN CN201510179652.0A patent/CN104774818A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| 无: "登录号：AHC54319.1", 《GENBANK》 * |
| 无: "登录号：XP_001393209.2", 《GENBANK》 * |
| 毛多斌等: "果糖基转移酶及低聚果糖生产研究进展", 《广东化工》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106467899A (en) * | 2015-08-17 | 2017-03-01 | 中国科学院天津工业生物技术研究所 | A kind of Aspergillus niger strain of high yield fructose-transferring enzyme and its application |
| CN106467899B (en) * | 2015-08-17 | 2020-05-05 | 中国科学院天津工业生物技术研究所 | Aspergillus niger strain capable of producing fructose transferase in high yield and application thereof |
| CN108486076A (en) * | 2017-01-05 | 2018-09-04 | 郑州轻工业学院 | A kind of aspergillus oryzae transfructosylase and its method for being used to prepare four ester of sucrose |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104774817A (en) | Fructosyl transferase and coding gene and application thereof | |
| Ji et al. | Enhanced production of polysaccharide through the overexpression of homologous uridine diphosphate glucose pyrophosphorylase gene in a submerged culture of lingzhi or reishi medicinal mushroom, Ganoderma lucidum (higher basidiomycetes) | |
| ATE496138T1 (en) | PRODUCTION OF LOW MOLECULAR WEIGHT HYALURONIC ACID | |
| CN105164255A (en) | Psicose epimerase mutant and method for preparing psicose by using same | |
| CN105441415B (en) | A kind of preparation method and applications of Pullulan enzymatic mutant PulB-d99-D436H | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN102286448B (en) | Preparation method of flavobacterium heparinum heparinases I, II and III | |
| CN109971696A (en) | A kind of recombinant bacterium of resting cell method high yield N-acetyl-neuraminate and application | |
| CN110564710A (en) | Xylanase mutant with high catalytic efficiency and construction method and application thereof | |
| Wang et al. | Homologous overexpression of genes in Cordyceps militaris improves the production of polysaccharides | |
| CN104774818A (en) | Fructosyl transferase as well as gene and application thereof | |
| CN101886067B (en) | Method for preparing flavobacterium heparinum heparinase I | |
| CN105219746B (en) | A kind of yclodextrin glycosyltransferase mutant for being inhibited to weaken by beta-cyclodextrin | |
| KR100771260B1 (en) | Novel inulin synthase and process for producing inulin by using the same | |
| CN102392037A (en) | Cloning and expression of beta-1, 4-endo-mannanase (An Man5A) gene | |
| WO2023124062A1 (en) | METHOD FOR PREPARING γ-PGA COUPLED WITH ATP REGENERATION ENZYME AND POLY(GLUTAMIC ACID) SYNTHETASE | |
| CN113355305B (en) | Exoinulase Inu-2 capable of degrading inulin fructan and application thereof | |
| CN103484482B (en) | Bacillus subtilis levan sucrase mutant T305A and application thereof | |
| CN111411066A (en) | Double-way composite neuraminic acid-producing bacillus subtilis and construction method thereof | |
| CN104561194A (en) | Application of N-acetylneuraminic acid aldolase in catalytic synthesis of N-acetylneuraminic acid | |
| CN115747236A (en) | Alpha-glucosidase, coding gene, vector, host and application thereof | |
| CN110184259A (en) | A kind of anaerobic spore-bearing bacilli source Pullulan enzymatic mutant and its application | |
| CN104293811A (en) | Helianthus tuberosus fructan 1-exo-hydrolase gene Ht1-FEH II and application thereof | |
| CN105734034B (en) | The method for improving Pullulanase catalytic performance using flexible residue is truncated | |
| CN103966180A (en) | Method for improving cyclization activity of cyclodextrin glucosyltransferase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20150715 |