CN104762319A - Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference - Google Patents
Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference Download PDFInfo
- Publication number
- CN104762319A CN104762319A CN201510116826.9A CN201510116826A CN104762319A CN 104762319 A CN104762319 A CN 104762319A CN 201510116826 A CN201510116826 A CN 201510116826A CN 104762319 A CN104762319 A CN 104762319A
- Authority
- CN
- China
- Prior art keywords
- mir
- cagg
- antisense sequences
- hepatic fibrosis
- sponges
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference and belong to the technical field of biology. In the invention, firstly a CAGG-Sponges-miR-483 plasmid is constructed and then fertilized eggs of transgenic mice with stable interference of miR-483 are established. In the invention, a genetic alteration mouse model based on micro RNA stable interference is established, wherein the model is achieved on the basis of integrating an exogenous nucleotide sequence into the genome of mouse. The method can be used as an in-vivo model for researching the mechanism of hepatic fibrosis, and provides a reliable platform for the researching of in-vivo functions of micro RNA in hepatic fibrosis.
Description
Technical field
The present invention is specifically related to the method for the Hepatic Fibrosis of Animal zygote that a kind of foundation is disturbed based on microRNA, belongs to biological technical field.
Background technology
Often there is liver failure and portal hypertension in patients with liver fibrosis late period, shows as the severe complications such as hepatogenic encephalopathy, Esophageal variceal bleeding, peritonitis, even can develop into liver cirrhosis, liver cancer, jeopardize the life security of patient.Early prevention and treatment and reverse hepatic fibrosis become study hotspot, and experimental animal model is the essential condition of carrying out liver fibrosis mechanism research and new drug development evaluation.For the animal model of hepatic fibrosis, mainly contain chemical process (tetracol phenixin etc.), alcohol induction etc. at present.
The human diseases overwhelming majority comes from the exception of genetic expression.In recent years, found that a class has the small molecules non-coding RNA of horizontal adjustment effect after gene expression transcription, be called " microRNA (microRNA, miRNA) ".Usually, miRNA, by combining with the 3' non-translational region (UTR) of specific mRNA, causes mRNA to degrade or is that the translation process of masterplate is suppressed with mRNA, thus reaches the effect of a certain genetic expression of negative regulation.The research of miRNA function is significant for the generation development disclosing disease further.
When studying a certain concrete miRNA and Relation of Hepatic Fibrosis, usually verify that miRNA is to Hepatic Stellate Cell Activation situation at cell levels, namely by making the specific miRNA content of hepatic stellate cell increase or reduce someway, then by the phenotype that observation of cell occurs, the function of this miRNA is analyzed; Or in hepatic fibrosis modeling process, inject specific miRNA stand-in or inhibitor in animal body.But these have obvious deficiency: injecting specific miRNA stand-in or inhibitor is all that transient expression increases, and well can not reflect the effect of miRNA to disease; Cost is higher, needs transfection repeatedly or injection, and all belongs to experiment in vitro, can not true operative condition in reactant very well.Wherein, comparatively outstanding is that action time is short and cannot go down to posterity.
We report in earlier stage, and miR-483 plays important provide protection in liver fibrosis process.We have developed the hereditary change mouse for miR-483 interference subsequently.This mouse can as a kind of model of new hepatic fibrosis research.
Summary of the invention
One is the object of the present invention is to provide to have Absorbable organic halogens interference micro-RNA expression, for the animal platform in body research hepatic fibrosis.
In order to achieve the above object, the technique means that the present invention adopts is:
Set up a method for the Hepatic Fibrosis of Animal zygote based on microRNA interference, it is characterized in that: comprise the following steps:
(1) CAGG-Sponges-miR-483 plasmid is built: for choosing mouse miR-483 sequence on NCBI, the antisense sequences that design and synthesis six copies: the nucleotides sequence of the antisense sequences of six copies is classified as SEQ ID No.1, these antisense sequences two ends are introduced the restriction enzyme site of EcoR I, EcoR I is the single endonuclease digestion six miR-483 antisense sequences copied and the pCAGGs carrier containing promotor CAGG respectively, CIP is to carrier dephosphorylation, after purifying, through T4 ligase enzyme, the two is connected, competent cell DH5 α is transformed into after connecting product order-checking correctly, set up recombinant plasmid CAGG-Sponges-miR-483,
(2) zygote that miR-483 stablizes the transgenic mice of interference is set up: with Sal I and the above-mentioned recombinant plasmid of Hind III double digestion, running gel reclaims the microinjection transgenosis component obtaining purifying, this component comprises promotor CAGG, the miR-483 antisense sequences of six copies and transcription termination signal; The transgenosis component of acquisition purifying is imported through microinjection in the zygote survived.
In the present invention, preferably, the EcoR I miR-483 antisense sequences that copies of single endonuclease digestion six and the pCAGGs carrier 3h containing promotor CAGG respectively during described structure CAGG-Sponges-miR-483 plasmid, CIP, to carrier dephosphorylation 1h, obtains 5 μ g products after purifying, through T4 ligase enzyme, the two is connected, competent cell DH5 α 50 μ L is transformed into, coated plate, next day after connecting product order-checking correctly, picking 5 bacterium colonies carry out order-checking qualification, determine recombinant plasmid CAGG-Sponges-miR-483.
In the present invention, preferably, the concentration of the transgenosis component described in adjustment is used for microinjection to 1ng ~ 2ng/uL.
MicroRNA " sponge " (Sponges, SP, S) technology was proposed in 2007 by Nobel Laureate PhillipA.Sharp, and his team utilizes multiple copied, not exclusively complementary miRNA antisense sequences special " absorption " miRNA, to reduce ripe miRNA content.In the past few years, apply this target gene to intend striking like the mode of thing process LAN the report subtracting miRNA and increase year by year.Its simplicity of design, processing ease, be not only suitable for the transfection of cell, also can be used in the making of integral level transgenic animal, and it strikes, and to subtract efficiency also relevant to the integration site of exogenous sequences and integrate copy number.
Compared with prior art, beneficial effect of the present invention is embodied in:
The present invention mainly solves the deficiency existing for prior art, that is: action time short, cannot to go down to posterity and can not actual response animal body environment.The invention provides a kind of hereditary change mouse model can stablized interference miR-483 and express, this model is integrated into mouse genome based on exogenous nucleic acid sequences and realizes, for follow-up hepatic fibrosis research and drug screening provide animal model, this model has Absorbable organic halogens heredity, self having the characteristic of certain suppression hepatic fibrosis, is the animal model of a kind of new hepatic fibrosis research.This model be established as that microRNA acts in hepatic fibrosis provide reliable platform in body functional study.
In addition, at present for the strategy of gene " mistake function ", gene knockout is mainly, though through the development of embryonic stem cell and the technology such as homologous recombination, TALENs and CRISPR/Cas9, be all the editor based on chromatin dna, carry out genomic change.MicroRNA is as the important molecule of gene expression regulation, and the microRNAs of significant proportion is by multiple locus encodes (i.e. same ripe body miRNA, can be produced by different genes encodings).This, concerning to change gene knockout that genomic dna is major way, has challenge.The present invention utilizes process LAN antisense sequences, and in endochylema, " absorption " ripe miRNA, makes it lose function, reaches the object of inhibit feature, has theory significance.
Accompanying drawing explanation
Fig. 1 is that microinjection transgenosis builds schematic diagram;
Fig. 2 is integration and the effect schematic diagram of exogenous sequences; Wherein, A figure is the agarose gel electrophoresis figure that exogenous sequences is integrated into mouse genome, 72-77: the transgenic fragment of transgenic (TG) mouse, NC: negative control, PC: positive control, M:Marker; Bar graph in B figure represents the expression of foreign gene, WT: wild-type, and the point diagram in B figure is shown as the content of ripe body miR-483, WT: wild-type.
Fig. 3 is that transgenic (TG) mouse after wild-type (WT) disturbs (knockdown) with miR-483 compares schematic diagram to the hepatic fibrosis severity that CCl4 induces; Wherein, the figure of a line represents transgenic (TG) the mouse hepatic fibrosis severity schematic diagram of inducing CCl4 after miR-483 interference (knockdown) above, below the figure of a line represent the hepatic fibrosis severity schematic diagram that wild-type (WT) mouse is induced CCl4.
Embodiment
Below by experiment, also the present invention will be further described in conjunction with the embodiments, it should be understood that these embodiments only for the object of illustration, never limit the scope of the invention.
Concrete technical scheme of the present invention is:
1, the structure of CAGG-sponges-miR-483 plasmid
Choose mouse miR-483 sequence (NC_000073.6:aagacgggagaagagaagggag) on NCBI, design its antisense sequences, first the antisense sequences of miR-483 sequence is designed, " CTTC " catenation sequence is added again between two antisense sequences, the antisense sequences that final formation six copies, the nucleotides sequence of the antisense sequences of six copies is classified as SEQ ID No.1, the antisense sequences of synthesis six copy, these antisense sequences two ends are introduced the restriction enzyme site of EcoR I, EcoR I is the single endonuclease digestion six miR-483 antisense sequences copied and the pCAGGs carrier 3h containing promotor CAGG respectively, CIP is to carrier dephosphorylation 1h, 5 μ g products are obtained after purifying, through T4 ligase enzyme, the two is connected, competent cell DH5 α 50 μ L is transformed into after connecting product order-checking correctly, coated plate, next day, picking 5 bacterium colonies carry out order-checking qualification, determine recombinant plasmid CAGG-Sponges-miR-483.
2, the foundation of miR-483 transgenosis interference mice
With the above-mentioned recombinant plasmid of Sal I/Hind III double digestion, running gel reclaims the microinjection transgenosis component obtaining purifying.This component comprises promotor CAGG, the miR-483 antisense sequences of six copies and transcription termination signal (Fig. 1).Adjust the concentration of this component to 1ng ~ 2ng/uL.
B6 female mice is chosen, injection 5IU PMSG when the first day 13; The next day 12 time injection 5IU HCG, and to mate with male B6 mouse.The ICR male mice of oestrus Female ICR mice and vasectomy is mated simultaneously.Within 4th, will see that bolt B6 mouse cervical vertebra is from disconnected execution, dorsal position opens abdomen, and clip uterine tube nearly ovary end 0.5cm is placed in physiological saline.The embryo medium that whole uterine tube is placed in successively containing Unidasa is separated zygote, carries out vitro culture.Microinjection is carried out when 13.
By the zygote transplation survived after microinjection in the ampulla of uterine tube of ICR seeing bolt, in art, note the soft and insulation of operation.After 3 weeks, ICR mouse is given a birth.After suckling mouse is raw, 3w ear tag is its numbering, and clip about 0.5cm tail point carries out the qualification of foreign gene at genome conformity.
3, the extraction of gDNA and screening
Mouse Tail-tip is placed in 0.5mL Digestive system, 55 DEG C of digestion 3h.Add equal-volume PCI, the centrifugal 10min of 1.5 × 104rpm, supernatant moves into new pipe, adds 0.4mL Virahol, upset, centrifugal 5min.Rinse precipitation with 70% ethanolic soln, dry after centrifugal.Add 170uL1 × TE, concussion mixing take gDNA as template, with screening primer amplification transgenic fragment.
Whether PCR primer carries out 0.8% agarose gel electrophoresis, observe foreign transgenes and be integrated in genome, the results are shown in Figure 2A.Result show, 72,73 and 76 display positive band, show foreign transgenes Successful integration enter genome.
4, the extraction of total serum IgE and RT-PCR
Illustrate by Trizol reagent and carry out Total RNAs extraction, illustrate that carrying out reverse transcription obtains cDNA, analyzes to screen its expression of primer pair, the results are shown in Figure 2B by reverse transcription reagents.Result shows, and No. 76 is that expression is lower, and No. 67 is that expression is higher.
5, the special microRNA content of transgenic mice hepatic tissue is detected
Extract transgenic mice hepatic tissue total serum IgE, carry out reverse transcription through special reverse transcriptase primer, detect wherein miR-483 content, the results are shown in Figure 2B.Result shows, and No. 67 is strike to subtract effect better, and being better than other is respectively.
6, the hepatic fibrosis phenotype of miR-483 interference mice
Induce above-mentioned transgenic mice with tetracol phenixin (CCl4), find that this mouse hepatic fibrosis phenotype can occur well, its degree of hepatic fibrosis even more serious compared with wild-type (Fig. 3).Above-mentioned transgenic mice can enrich the material of liver fibrosis mechanism research and the animal platform of related drugs research and development.
The foregoing is only the preferred embodiments of the present invention, is only illustrative for the purpose of the present invention, and nonrestrictive; Those of ordinary skill in the art understand, and can carry out many changes in the spirit and scope that the claims in the present invention limit to it, amendment, and even equivalence is changed, but all will fall within the scope of protection of the present invention.
Claims (3)
1. set up a method for the Hepatic Fibrosis of Animal zygote based on microRNA interference, it is characterized in that: comprise the following steps:
(1) CAGG-Sponges-miR-483 plasmid is built: choose mouse miR-483 sequence on NCBI, the antisense sequences that design and synthesis six copies, the nucleotides sequence of the antisense sequences of six copies is classified as SEQ ID No.1, these antisense sequences two ends are introduced the restriction enzyme site of EcoR I, EcoR I is the single endonuclease digestion six miR-483 antisense sequences copied and the pCAGGs carrier containing promotor CAGG respectively, CIP is to carrier dephosphorylation, after purifying, through T4 ligase enzyme, the two is connected, competent cell DH5 α is transformed into after connecting product order-checking correctly, set up recombinant plasmid CAGG-Sponges-miR-483,
(2) zygote that miR-483 stablizes the transgenic mice of interference is set up: with Sal I and the above-mentioned recombinant plasmid of Hind III double digestion, running gel reclaims the microinjection transgenosis component obtaining purifying, this component comprises promotor CAGG, the miR-483 antisense sequences of six copies and transcription termination signal; The transgenosis component of acquisition purifying is imported through microinjection in the zygote survived.
2. method according to claim 1, it is characterized in that: the EcoR I miR-483 antisense sequences that copies of single endonuclease digestion six and the pCAGGs carrier 3h containing promotor CAGG respectively during described structure CAGG-Sponges-miR-483 plasmid, CIP is to carrier dephosphorylation 1h, 5 μ g products are obtained after purifying, through T4 ligase enzyme, the two is connected, competent cell DH5 α 50 μ L is transformed into after connecting product order-checking correctly, coated plate, next day, picking 5 bacterium colonies carry out order-checking qualification, determine recombinant plasmid CAGG-Sponges-miR-483.
3. method according to claim 1, is characterized in that: the concentration of the transgenosis component described in adjustment is used for microinjection to 1ng ~ 2ng/uL.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510116826.9A CN104762319A (en) | 2015-03-17 | 2015-03-17 | Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510116826.9A CN104762319A (en) | 2015-03-17 | 2015-03-17 | Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104762319A true CN104762319A (en) | 2015-07-08 |
Family
ID=53644410
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510116826.9A Pending CN104762319A (en) | 2015-03-17 | 2015-03-17 | Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104762319A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108342416A (en) * | 2018-02-08 | 2018-07-31 | 广州医科大学 | A kind of conditionity induction knocks out the construction method for the liver cancer cell lines for being overexpressed Chd1l genes |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101985628A (en) * | 2010-08-13 | 2011-03-16 | 哈尔滨医科大学 | Method for building special microRNA knock-down mouse model of heart |
| CN102051380A (en) * | 2009-10-29 | 2011-05-11 | 哈尔滨医科大学 | Method for establishing arrhythmia animal model |
-
2015
- 2015-03-17 CN CN201510116826.9A patent/CN104762319A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102051380A (en) * | 2009-10-29 | 2011-05-11 | 哈尔滨医科大学 | Method for establishing arrhythmia animal model |
| CN101985628A (en) * | 2010-08-13 | 2011-03-16 | 哈尔滨医科大学 | Method for building special microRNA knock-down mouse model of heart |
Non-Patent Citations (2)
| Title |
|---|
| FUYUAN LI.ET AL: "Overexpression of miR-483-5p/3p cooperate to inhibit mouse liver fibrosis by suppressing the TGF-b stimulated HSCs in transgenic mice", 《J. CELL. MOL. MED》 * |
| 马宁 等: "miRNA"海绵"重组质粒的构建及对miR-483-5p 的敲减", 《哈尔滨医科大学学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108342416A (en) * | 2018-02-08 | 2018-07-31 | 广州医科大学 | A kind of conditionity induction knocks out the construction method for the liver cancer cell lines for being overexpressed Chd1l genes |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220015342A1 (en) | Gene editing of reproductive hormones to reduce fertility in ictalurus punctatus | |
| CN106282231B (en) | Construction method and application of mucopolysaccharide storage disease type II animal model | |
| Yan et al. | Identification and profiling of microRNAs from skeletal muscle of the common carp | |
| Liu et al. | Inheritable and precise large genomic deletions of non-coding RNA genes in zebrafish using TALENs | |
| CN104531705A (en) | Method for knocking off animal myostatin gene by using CRISPR-Cas9 system | |
| CN104531704A (en) | Method for knocking off animal FGF5 gene by using CRISPR-Cas9 system | |
| CN106661593A (en) | Immunodeficient mice, manufacturing method thereof and application | |
| CN106119284A (en) | A kind of product for building immunodeficient animals model and application thereof | |
| CN101985628B (en) | Method for building special microRNA knock-down mouse model of heart | |
| CN111019971A (en) | Construction method of mouse model for conditionally overexpressing HPV E6 gene at ROSA26 site | |
| CN113088521A (en) | Construction method of Ahnak2 gene knockout animal model based on CRISPR/Cas9 technology | |
| CN113736787A (en) | gRNA of targeted mouse Atp7b gene and method for constructing Wilson disease mouse model | |
| CN105132424A (en) | MicroRNA inhibitor, microRNA inhibitor expression vector, building method of microRNA inhibitor expression vector and application of microRNA inhibitor expression vector | |
| CN110066805A (en) | The method of gene knockout breeding adgrf3b Gene Deletion zebra fish | |
| CN113234756A (en) | Construction method of LAMA3 gene knockout animal model based on CRISPR/Cas9 technology | |
| CN104762319A (en) | Method of establishing hepatic fibrosis animal fertilized eggs based on micro RNA interference | |
| CN104232643B (en) | RNAi interference fragments, interference carrier, preparation method and applications | |
| CN109068620A (en) | The pig of gene editing | |
| CN105440111B (en) | Pair of transcription activator-like effector nucleases (CTFs), coding sequences and application thereof | |
| CN108048463B (en) | Base sequence, vector, method and application for constructing RIP3 gene knockout mouse | |
| CN111778288A (en) | Method, composition and application for constructing HBV transgenic mouse model | |
| CN115058456B (en) | Construction method and application of animal model with HPRT gene knocked out | |
| CN104694569A (en) | Method for building animal fertilized eggs for milk micro-RNA function study | |
| CN114763557A (en) | Application of DDX5 in resisting virus and regulating immune response | |
| CN104762320A (en) | A method of constructing a zygote of a microRNA-overexpression-based animal with liver cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150708 |
|
| RJ01 | Rejection of invention patent application after publication |