CN104762244A - Streptococcus suis SBP-bac-5 gene deletion strain and construction method and application thereof - Google Patents
Streptococcus suis SBP-bac-5 gene deletion strain and construction method and application thereof Download PDFInfo
- Publication number
- CN104762244A CN104762244A CN201510058245.4A CN201510058245A CN104762244A CN 104762244 A CN104762244 A CN 104762244A CN 201510058245 A CN201510058245 A CN 201510058245A CN 104762244 A CN104762244 A CN 104762244A
- Authority
- CN
- China
- Prior art keywords
- bac
- sbp
- gene
- strain
- swine streptococcus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention discloses a streptococcus suis SBP-bac-5 gene deletion strain and a construction method and application thereof, the streptococcus suis SBP-bac-5 gene deletion strain is SS delta SBP-bac-5 containing no resistance maker, and the preservation number is CGMCC No.10076. Rec A homologous recombination system is used, temperature-sensitive suicide plasmid pSET4s as a carrier is used for deletion of a gene coded by the streptococcus suis type 7 strain SBP-bac-5 to obtain the streptococcus suis SBP-bac-5 gene deletion strain, and SBP-bac-5 protein expression can be destroyed. Compared with a parent strain, the streptococcus suis type 7 SS delta SBP-bac-5 strain is weaker in toxicity and safe to animals. A vaccine is prepared by use of recombinant bacteria for immunization of CD1 mice, the experimental results show that: the streptococcus suis recombinant bacteria vaccine can effectively induce production of specific humoral immune response, so that the immunized mice can be protected against S.suis (streptococcus suis) attacks, and bacteria multiplication in the body can be effectively prevented. The engineering bacteria provides an important basis for the development of vaccine of streptococcus suis vaccines.
Description
Technical field
The invention belongs to bacterial gene field of engineering technology, relate to a kind of not containing the swine streptococcus serum 7-type SBP_bac_5 gene-deleted strain of resistance marker and construction process thereof and application.
Background technology
Swine streptococcus (Streptococcus suis, S.suis) is gram-positive cocci, is a kind of important zoonosis pathogenic bacteria.China had once broken out the event that twice fairly large pig and people infect S.suis disease in 1998 and 2005, accumulative speaker infects S.suis case and reaches 204 examples, and wherein dead 38 examples, have a strong impact on public health security.Up to now, effective vaccine is still lacked to the prevention of this disease.Current research shows that S.suis kantigen serotype has more than 35 kinds, and wherein serum 2 type is worldwide principal causative bacterial type.But, frequent report S.suis 7 type in the sick pig in the whole world detects in recent years, the ratio shared by it has and increases trend, has even exceeded 2 types in certain areas, particularly in recent years Hubei Province within the border just existing 7 types infect the report increased.According to the epidemiology survey result in this laboratory, now popular serotype is that diversity exists, and the ratio of serum 7-type has the trend increased, and based on above-mentioned phenomenon, also just seems very necessary to the research of S.suis 7 type each side characteristic.
Bibliographical information, SBP_bac_5 albumen has the activity of similar molecular chaperones, plays a significant role in virus infection.Promote that the correct function folding and gather occurs viral protein as molecular chaperone protein has, and to the growth of adenovirus, vaccinia virus and papilloma virus, there is vital role, existing research confirms that SBP_bac_5 is the virulence correlation factor of a supposition, there is the activity of similar molecular chaperones, play an important role in course of infection, and its effect in bacterium is so far still without report.We show the expression amount significant difference of SBP_bac_5 at S.suis 7 type highly-wetting liquid by comparative proteome and fluorescence quantitative PCR detection, and namely SBP_bac_5 albumen expression amount in S.suis 7 type virulent strain WC-ss7 is more than expression amount in low virulent strain M13.Analyzing SBP_bac_5 albumen by forecasting software has translocator active, and is supposition secretory protein, and its molecular function is that direct shipped material is as turnover cells such as macromole, small molecules, ions; This further points out the dependency of SBP_bac_5 gene and S.suis virulence.
Current commercial full bacterium inactivated vaccine and subunit vaccine can alleviate the microbial clinical symptom of homologous serotype and reduce mortality ratio, but can not stop lesion tissue, chronic infection, can not provide cross protection completely to the infection of heterogeneous serotypes bacterium.Therefore, adopt deactivation vaccine and subunit vaccine immunity not to be best selection, carry out the Occurrence & epidemic of this transmissible disease of prevention and corntrol in the urgent need to safer, more efficient new generation vaccine.And attenuated live vaccines has the advantage that can repeat to offer antigen and long stimulus immunne response compared with traditional vaccine.Therefore build by disappearance virulence factor the focus that attenuated live vaccines has become domestic and international vaccine research.
In view of above-mentioned background, for accurately illustrating the biological activity of SBP_bac_5 in bacterium and function, adopt RecA homologous recombination system, utilize temperature sensitive suicide plasmid pSET4s as the SBP_bac_5 gene-deleted strain of the popular S.suis 7 type bacterial strain of the vector construction China knocked out, study it to the pathogenic of animal and immunogenicity, for the control of S.suis and the development of S.suis vaccine lay the foundation.
Summary of the invention
One of the object of the invention is to provide a kind of not containing the swine streptococcus serum 7-type SBP_bac_5 gene-deleted strain of resistance marker, and this gene-deleted strain is the bacterial strain being carried out by the gene that pig streptococcus bacterial strain SBP_bac_5 encodes knocking out.
Swine streptococcus serum 7-type SBP_bac_5 gene-deleted strain of the present invention is derived from the S.suis serum 7-type WC-ss7 epidemic strain (preserving number is CGMCC No.3343) that this laboratory study personnel are separated, by the SBP_bac_5 genetically deficient on its genome, SBP_bac_5 albumen is not expressed, obtains not containing the SBP_bac_5 gene deletion mutants of resistance marker.
Swine streptococcus serum 7-type SBP_bac_5 gene-deleted strain of the present invention is not containing the SS Δ SBP_bac_5 of resistance marker, its Classification And Nomenclature is swine streptococcus Streptococcus suis, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, address is No. 3 China Microbiological institutes in Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, deposit number is: CGMCC No.10076, and preservation date is on November 28th, 2014.
Two of the object of the invention be to provide a kind of build described not containing the method for the swine streptococcus serum 7-type SBP_bac_5 gene-deleted strain of resistance marker, it is characterized in that the swine streptococcus serum 7-type bacterial strain described in being imported by the pSET4s plasmid of the upstream and downstream homology arm gene DNA fragment containing the goal gene needing to be knocked out, realize through homologous recombination.Wherein, described DNA segment is SBP_bac_5 upstream homology arm, SBP_bac_5 downstream homology arm successively from upstream to downstream, with upstream sequence and the downstream sequence generation homologous recombination of the SBP_bac_5 protein coding gene of described swine streptococcus 7 type bacterial strain, the SBP_bac_5 gene-deleted strain SS Δ SBP_bac_5 obtained.Concrete construction process is as follows:
1, with S.suis serum 7-type WC-ss7 pnca gene group for template, take SBP_bac_5KOP1/2 as primer amplification upstream homology arm, take SBP_bac_5KOP5/6 as primer amplification downstream homology arm, with 2 sections of PCR primer for template, take SBP_bac_5KOP1/6 as primer, by the fusion fragment of fusion DNA vaccine method amplification upstream and downstream homology arm.This fusion product of purifying, is cloned into PMD-18T carrier, Transformed E .coli DH5 α competent cell, cuts after qualification check order through PCR and enzyme.By object fragment correct for order-checking, be connected on pSET4s carrier, Transformed E .coli DH5 α competent cell, then cut qualification through PCR and enzyme, finally obtain knockout carrier.PSET4s Vector map as shown in Figure 1.
2, get 10 μ L gene knockout carrier electricity and transform 100 μ LWC-ss7 strain competent cells, through 30 DEG C, CO
240h is cultivated, at band Spectinomycin resistance Spc in incubator
rtHB flat board on grow tens bacterium colonies, select correct clone successively through 30 DEG C of double exchanges and 40 DEG C of plasmid loss, finally be coated on the plate screening mutant not having resistance He have Spc resistance simultaneously, as do not grown on the plate having resistance, at nonresistant grow on plates, picking mono-clonal on non-resistant flat board carries out PCR screening, obtains knock out mutants body.With the mutant strain genome extracted for template, carry out PCR qualification with different primers respectively, be defined as SS Δ SBP_bac_5 by correct for qualification.By SBP_bac_5 gene-deleted strain inoculation animal, according to clinical manifestation and the survival analysis of inoculation animal, the virulence of SS Δ SBP_bac_5 is weaker than parent plant WC-ss7.
In the specific embodiment of the present invention, the sequence of described SBP_bac_5 encoding gene is as shown in SEQNO.1, and the aminoacid sequence of SBP_bac_5 albumen is as shown in SEQ ID NO.2.
In the specific embodiment of the present invention, the primer of amplification upstream homology arm sequence 5 ' end introduces SalI restriction enzyme site, and italicized item is and downstream homology arm sequence fusion part mutually, and sequence is as follows:
SBP_bac_5KOP1：GCC
GTCGACAAAATGAGAAAATGATGA
SBP_bac_5KOP2：TACACCTTTATCTTTACCTTTCACATCA
In the specific embodiment of the present invention, the primer of amplification downstream homology arm sequence 5 ' end introduces BamH I restriction enzyme site, and italicized item is and upstream homology arm sequence fusion part mutually, and sequence is as follows:
SBP_bac_5KOP5：GTGAAAGGTAAAGATAAAGGTGTAGTGGCA
SBP_bac_5KOP6：TTA
GGATCCGATTCCCCTACAATTGCC
It is that researcher is in test as the application of the swine streptococcus 7 type bacterial strain of standard that three of object of the present invention is to provide described swine streptococcus serum 7-type SBP_bac_5 gene-deleted strain.
Four of object of the present invention is to provide the application of described swine streptococcus serum 7-type SBP_bac_5 gene-deleted strain in preparation prevention swine streptococcus vaccine.
Five of object of the present invention is to provide a kind of swine streptococcus vaccine, and its main active ingredient is that the present invention is not containing the swine streptococcus serum 7-type SBP_bac_5 gene-deleted strain of resistant gene.
The present invention adopts RecA homologous recombination system, utilizes temperature sensitive suicide plasmid pSET4s to knock out the gene that swine streptococcus 7 type bacterial strain SBP_bac_5 encodes as carrier and the bacterial strain that obtains, destroys the expression of SBP_bac_5 albumen.Major advantage of the present invention is:
1, the material that the present invention is used is S.suis serum 7-type WC-ss7 strain, it is the S.suis serum 7-type epidemic strain that this laboratory study personnel are separated to from morbidity porcine tissue, it is the representative of existing ground epidemic link, therefore, from now on the SBP_bac_5 gene-deleted strain of this strain construction for research object has more specific aim.
2, the swine streptococcus serum 7-type SBP_bac_5 gene-deleted strain that obtains of the present invention is more weak than the virulence of parent plant, more weak than the virulence of international standard 7 type and 2 type bacterial strains, can be used as the standard swine streptococcus 7 type test less-virulent strain that researcher uses.
3, the invention provides described genetically deficient recombinant bacterium, can be used for transformation and preparation prevention swine streptococcus vaccine.Because of not containing any resistance marker, meet China's production of vaccine safety completely.Vaccine is made with recombinant bacterium; immunity CD1 mouse; experimental result shows: this swine streptococcus recombinant bacterium vaccine can effectively induce body to produce specific humoral immunoresponse(HI), makes immune mouse obtain the protection of anti-S.suis attack, and effectively can stop bacterium increment in vivo.The engineering bacteria that the present invention obtains is that the development of swine streptococcus vaccine provides important evidence.
Preservation information:
One, SS Δ SBP_bac_5:
Classification And Nomenclature: swine streptococcus Streptococcus suis;
Depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center;
Preservation address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City China Microbiological institute;
Deposit number: CGMCC No.10076;
Preservation date: on November 28th, 2014.
Two, WC-ss7 strain:
Classification And Nomenclature: swine streptococcus Streptococcus suis;
Depositary institution: China Committee for Culture Collection of Microorganisms's common micro-organisms center;
Preservation address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City China Microbiological institute;
Deposit number: CGMCC No.3343;
Preservation date: on October 19th, 2009.
Accompanying drawing explanation
Fig. 1 is pSET4s Vector map;
Fig. 2 is SBP_bac_5 upstream and downstream homology arm, fusion DNA vaccine product, 1:SBP_bac_5 upstream homology arm in figure; 2:SBP_bac_5 downstream homology arm; 3: fusion DNA vaccine product; M:DL-2000DNA Maker;
Fig. 3 is structure and the qualification of recombinant plasmid pMD18T-SBP_bac_5, M:DL-2000DNAMaker in figure; ; 1:pMD18T-SBP_bac_5 double digestion is identified;
Fig. 4 is structure and the qualification of recombinant plasmid pSET4s-SBP_bac_5,1:DL-2000DNAMaker in figure; 2,3:pSET4s-SBP_bac_5 double digestion is identified; 4:DL-5000DNA Maker;
Fig. 5 is the PCR qualification result of mutant strain SS Δ SBP_bac_5, M:DL-2000DNAMaker in figure; 1: primer GDH-F/R primer qualification; 2:SBP_bac_5KOP1/6 primer is identified; 3:SPC1/2 primer is identified; 4:SBP_bac_5KOP3/4 primer is identified;
Fig. 6 is the S.suis 7 type qualification of WC-ss7 strain and SS Δ SBP_bac_5 strain, M:DL-2000DNA Maker in figure; 1: the S.suis 7 of parent plant identifies; 2:SS Δ SBP_bac_5 mutant strain S.suis 7 identifies;
Fig. 7 is the antibody test result after vaccine immunity.
Embodiment
Below in conjunction with accompanying drawing, technical scheme of the present invention is further described; but be not limited thereto; everyly technical solution of the present invention modified or equivalent to replace, and not departing from the spirit and scope of technical solution of the present invention, all should be encompassed in protection scope of the present invention.
1, involved in the present invention material:
1.1 bacterial strains and plasmid (table 1)
Table 1 bacterial strain uses therefor and plasmid
| Bacterial strain and plasmid | Correlated characteristic or function | Source or reference |
| E.coli DH5α | The Host Strains of recombinant plasmid clone | TAKARA |
| WC-SS7 | S.Suis wild strain | This testing laboratory is separated |
| SSΔSBP_bac_5 | SBP_bac_5 gene knockout mutant strain | Build herein |
| pMD18T | Cloning vector, Amp R | Breathe out beast and grind diagnositc center |
| pSET4s | Responsive to temperature type suicide vector, Spc R | Takamatsu et al.(2012) |
| pSET4s-SBP_bac_5 | SBP_bac_5 gene knockout plasmid Spc R | Build herein |
Note: Amp
r: ammonia benzyl resistance, Spc
r: Spectinomycin resistance,
1.2 experiments the primer (table 2)
Table 2 the primer
| Primer Sequence (5 '-3 ') | Fragment length/bp |
| SBP_bac_5KOP1：GCCGTCGACAAAATGAGAAAATGATGA | 477 |
| SBP_bac_5KOP2：TACACCTTTATCTTTACCTTTCACATCA | |
| SBP_bac_5KOP3：CTCGGATCCACAGGCAAGGATTACAAGTG | 699 |
| SBP_bac_5KOP4：CACGTCGACGGCAATTGCTTGACGAAGTT | |
| SBP_bac_5KOP5：GTGAAAGGTAAAGATAAAGGTGTAGTGGCA | 537 |
| SBP_bac_5KOP6：TTAGGATCCGATTCCCCTACAATTGCC | |
| SPC-F：GTGTTCGTGAATACATGTTATA | |
| SPC-R：GTTTTCTAAAATCTGATTACCA | |
| GDH-F：GCAGCGTATTCTGTCAAACG | 688 |
| GDH-R：CCATGGACAGATAAAGATGG | |
| cps7_U：AATGCCCTCGTGGAATACAG | 378 |
| cps7_L：TCCTGACACCAGGACACGTA |
Two pairs of primers treat each about 500bp sequence of the upstream and downstream of absent region for increasing, the sequence that its middle and upper reaches homology arm primer 3 ' end band has 20bp and downstream homology arm to merge, the sequence that downstream homology arm upstream primer 5 ' end band has 20bp and upstream homology arm to merge.Take wherein SBP_bac_5KOP1/2 as primer amplification upstream homology arm, take SBP_bac_5KOP5/6 as primer amplification downstream homology arm, SBP_bac_5KOP3/4 is inner primers designed, is positioned at goal gene inside; The Spc resistance box of SPC-F/R on the plasmid pSET4s that increases; The partial sequence of GDH-F/R amplification S.suis glutamate dehydrogenase, is used for identifying whether bacterial strain is S.suis.
1.3 laboratory animal
CD1 female mice, 8 week age, SPF level, body weight about 25 ± 2g,
2, method
The cultivation of 2.1 parent's wild mushrooms
Bacterium liquid is preserved at the flat lining out containing 5% sheep blood by the clinical S.suis7 type WC-ss7 be separated in laboratory, 37 DEG C of incubator overnight incubation.Mono-clonal on picking blood agar is placed in suis liquid nutrient medium, 37 DEG C, 160r/min overnight incubation, and the operation through repeating several times can obtain recovery WC-SS7 bacterium liquid, for subsequent experimental.
2.2 merge the amplification of fragment and merge the glue recovery of fragment
Extract the DNA of WC-ss7 as template using bacterial genomes DNA extraction kit, taking SBP_bac_5KOP1/2 as primer amplification upstream homology arm, take SBP_bac_5KOP5/6 as primer amplification downstream homology arm.Cut glue, reclaim 2 PCR fragment, and with 2 sections of PCR fragment for co-template, take SBP_bac_5KOPl/6 as primer, by the fusion fragment of fusion DNA vaccine method amplification upstream and downstream homology arm.
Amplification PCR50 μ L system is as follows:
Response procedures is: 95 DEG C of denaturation 5min; 94 DEG C of 1min, X DEG C of 1min, 72 DEG C of 1min; 30 circulations, extend 72 DEG C of 10min.Wherein the annealing temperature of amplification upstream homology arm is 55 DEG C, and the annealing temperature of amplification downstream homology arm is 56 DEG C, and the annealing temperature that fragment is merged in amplification is 62 DEG C.
Reclaim test kit fast with DNA and reclaim fusion fragment.Concrete operation method is as follows: be separated with 1% agarose gel electrophoresis and merge fragment, cut the sepharose (observing under long-wave ultra violet lamp) containing merging fragment, put into weighed 1.5mL EP pipe, add 100 μ L ratios according to 0.1g and add sol solutions, in 55 DEG C of water-bath effect 10min, period flicks EP pipe several times, and gel is dissolved completely.The liquid rotating dissolved is reclaimed post to glue, and room temperature leaves standstill 2min, 12000r/min, centrifugal 1min, outwells the waste liquid in collection tube, washes twice with washings, the centrifugal 1min of last 12000r/min, recovery post is gone in another aseptic 1.5mLEP pipe, adds 40 μ L EB room temperatures and place the centrifugal 1min wash-out of 2min, 12000r/min, it is namely the fusion fragment reclaimed in collection tube, can be directly used in next step be connected with carrier, also can be positioned over-20 DEG C of refrigerators, save backup.
The connection of 2.3 recombinant plasmid PMD18T-SBP_bac_5 and conversion and enzyme cut qualification
Fusion fragment is connected to PMD18T carrier, and linked system is carried out according to ratio below:
4h is connected through 16 DEG C, getting the recombinant plasmid 10 μ L connected joins in the E.coli DH5 α competent cell of 50 μ L, mix gently, after placing 30min on ice, rapidly centrifuge tube is put into 42 DEG C of water-bath heat shock 90s, again EP pipe is put into ice 2min afterwards, next in EP pipe, 900 μ LLB liquid nutrient mediums are added at aseptic operating platform, put into 37 DEG C of shaking table jog 60min, take out the centrifugal 5min of EP pipe 4000r/min, discard 600 μ L supernatant liquors, remainder is used for having hanged precipitation, the LB coated containing ammonia benzyl resistance is dull and stereotyped, and be inverted in 37 DEG C of incubators, overnight incubation.
The restructuring pMD18-SBP_bac_5 plasmid extracted need be identified, to be confirmed whether successful connection.First cut the recombinant plasmid pMD18-SBP_bac_5 of qualification containing restriction enzyme site with Sal I and BamH I enzyme, method for add successively in 1.5mL EP pipe:
After putting into 37 DEG C of water-bath 1h, electrophoresis on 1% sepharose, observations under ultraviolet lamp.
2.4 restructuring knock out structure and the qualification of plasmid pSET4s-SBP_bac_5
The recombinant plasmid pMD18-SBP_bac_5 of successful connection is cut in reference above method enzyme, glue reclaims the fusion fragment becoming cohesive end after enzyme is cut, it is connected with the pSET4s suicide vector through same double digestion, Transformed E .coli DH-5 α competent cell, extract plasmid and cut qualification through enzyme, final acquisition knockout carrier pSET4s-SBP_bac_5.And sent by recombinant plasmid pSET4s--SBP_bac_5 Beijing Hua Da Genetic Biotechnologies company limited to check order.
2.5 electricity knocking out plasmid transform
Fresh preparation or frozen swine streptococcus competent cell, in placing 5min on ice, treat that it dissolves completely.Get 5 μ L plasmids to add in swine streptococcus competent cell, slightly mix, continue on ice to place 5min, simultaneously by the electric revolving cup precooling on ice of diameter 2mm.Absorption plasmid and competence mixture note wall add in electric revolving cup, avoid producing bubble.At 2.5kV/Cm, 200 Ω, shock by electricity under the electric Transformation Parameters of 25 μ F, add rapidly the resuscitation fluid of 1mL 37 DEG C of preheatings after electric shock, are then transferred in aseptic 1.5mL EP pipe, 30 DEG C, 160r/min recovery 3-4h.By of short duration for the bacterium liquid of recovery centrifugal after coat Spc
rtHB is dull and stereotyped, at 30 DEG C, 5%CO
224-48h is cultivated, screening resistance clone in incubator.
2.6 screening and identifications knocking out mutant strain SS Δ SBP_bac_5
The single colony inoculation grown on THB SpcR monoclonal antibody flat board after being transformed by electricity is in THB Spc
rin liquid nutrient medium, at 30 DEG C, 5%CO
2leave standstill recovery in incubator, then transfer in the THB liquid nutrient medium of nonreactive in 1% ratio, 30 DEG C, 5%CO
2incubator cultivates 12h.Repeat switching twice by 1% more afterwards, be positioned over 30 DEG C, 5%CO
2after incubator cultivates 6h, put into 40 DEG C of shaking baths, 160r/min shaking culture 6h at once, continue after 1% switching to cultivate 12h at 40 DEG C of shaking bath 160r/min, 1% switching several generations like this, the bacterium liquid dilution 10 of every generation
3be coated with THB Spc
ranti-flat board and THB nonreactive flat board, be positioned over 37 DEG C, 5%CO
2cultivate in incubator.Find at THB plated growth THB Spc
rthe dull and stereotyped generation bacterium liquid do not grown, by the bacterium liquid conservation mark screened.The single bacterium colony simultaneously chosen on the nonreactive THB flat board corresponding with it connects
enterin THB liquid nutrient medium, 37 DEG C, 5%CO
2cultivate 8h in incubator, and again line THB Spc
rflat board and nonreactive THB flat board, several generations repeatedly, selective extraction is at THB Spc
rthe not long bacterium of anti-flat board, and at the bacterium colony DNA of the nonreactive THB plated growth corresponding with it, use primers designed to identify extracted genome, the mutant strain S.suis primers designed (GDH) of successful knockout is positive, Spc
rfeminine gender, SBP_bac_5KOP3/4 is negative, and SBP_bac_5KOP1/6 is positive.Successful for qualification mutant strain was passed for 10 generations continuously, identifies by PCR method, if pcr amplification result as described above mutant strain of the present invention be can genetic stability.
3, the contrast experiment of mutant strain and parent plant
3.1 wild strains and mutant strain are to CD1 mouse medium lethal dose (LD
50) mensuration
By the CD1 female mice random packet in 8 week age of same batch, wherein one group is injection WC-ss7 bacterial strain group, one group is injection SS Δ SBP_bac_5 bacterial strain group, be diluted to concentration listed by table 4, everyone extent of dilution 10 mouse, observe a dead mouse situation every 6h, the bacterium number corresponding to extent of dilution group that the death of mouse half occurs is medium lethal dose.
3.2 recombinant bacterium immunoprotection experiments
The preparation of recombinant antigen vaccine: recombinant bacterium PBS is dissolved into 1.0 × 10
7with equal-volume French adjuvant (ISA50V2) emulsification.Mouse is divided into 3 groups at random, often organizes 10.Specifically be grouped as follows:
First group: the recombinant antigen vaccine that immune emulsification is good: often only inject 0.5ML, include bacterium 1.0 × 10
7.
First group: the swine streptococcus WC-ss7 of inoculation deactivation, often only inject 0.5ML, include bacterium 1.0 × 10
7.
3rd group: immune THB: often only inject 0.5ML.
After each group of immunity, blood sampling in 7,14,21 days, detects antibody by ELISA method.Indirect ELISA schedule of operation is conveniently carried out, and after recombinant bacterium presses finite concentration dilution proportion, every hole 100 μ L joins in micro reaction plate, and 4 DEG C of bags are spent the night, wash 4 times, each 3min, button is dry, with confining liquid every hole 200 μ L in 37 DEG C of closed 2h, wash 4 times, each 3min, button is dry, serum to be checked 37 DEG C effect 1h, washing, button is dry, adds enzyme labelled antibody 37 DEG C effect 1h, washing, button is dry, adds nitrite ion (TMB) room temperature black out and places 10min, add 2MH
2sO
4termination reaction.Microplate reader measures OD
450value.And by following formulae discovery P/N value: P/N value=Positive control wells OD
450average/negative control hole OD
450average.
Immunity is after 3 weeks, and injection swine streptococcus 7 type bacterial strain WC-SS7 bacterium liquid 0.5ML, containing bacterial count 2.0 × 10 of living
7, poison is attacked to mouse.Attack malicious cuing open for latter 7 days and kill mouse, detect each internal organs bacteria content.
4. result
4.1 restructuring knock out the structure of plasmid pSET4s-SBP_bac_5
The upstream homology arm (477bp) of SBP_bac_5 gene, downstream homology arm (537bp), fusion DNA vaccine product are as shown in Figure 2, fusion DNA vaccine product is connected PMD18T carrier, connect correct plasmid to identify through BamH I and SalI, as shown in Figure 3.Fragment will be merged be connected with pSET4s, and knock out plasmid and cut qualification through enzyme, as shown in Figure 4.
The screening of 4.2 swine streptococcus 7 type SBP_bac_5 gene deletion mutants and sequencing result
Extract after also passing for 10 generations continuously by the gene knockout mutant strain of PCR method screening acquisition, use primer GDHF/R respectively, SBP_bac_5KOP1/6, SPC1/2, SBP_bac_5KOP3/4 carry out PCR qualification, and qualification result as shown in Figure 5.7 type serotype specific primer qualification results as shown in Figure 6, illustrate that this mutant strain is can genetic stability.
4.3 swine streptococcus biochemical identification and grouping result
Through the biochemical test of 3 times, repeatability is good, and qualification result is in table 3, and mutant strain is consistent with the biochemical reaction of wild strain.Through the suis latex agglutination test kit qualification that French Mei Liai company provides, mutant strain and wild strain are suis D group.
The biochemical results of table 3 wild strain and mutant strain
| Biochemical reaction project | Strain isolated | Mutant strain |
| 6.5% high salt meat soup | + | + |
| Raffinose | + | + |
| Lactose | + | + |
| Sorbose | - | - |
| Seminose | + | + |
| Salicin | + | + |
| Serum synanthrin | - | - |
| Hippurate | - | - |
| Vitamin C2 | + | + |
| Gill fungus sugar | + | + |
Note :+be positive reaction ,-be negative reaction.
4.4 medium lethal dose
Attack poison with WC-ss7 and the SS Δ SBP_bac_5 of same dose to CD1 mouse, statistics dead mouse situation, calculates medium lethal dose (table 4) respectively, the LD of result display WC-ss7
50be 2.5 × 10
6cFU, and the LD50 of SS Δ SBP_bac_5 is 1 × 10
7cFU, after SBP_bac_5 genetically deficient is described, the virulence of SS Δ SBP_bac_5 bacterial strain obviously declines.
Table 4
Antibody test after 4.5 immunity
Detect antibody by ELISA method after immunity, respectively after immunity 7,14,21d carries out tail vein blood to mouse, detects antibody.Within after vaccine immunity 7 days, can antibody be detected, immunity latter 14 days antibody titers increase, and reach climax, as shown in Figure 7 to immunity latter 21 days antibody titerss.
4.6 recombinant bacterium vaccine immunity Protections
Latter 3 weeks of immunity, with swine streptococcus 7 type bacterial strain WC-SS7 bacterium liquid 0.5ML (containing bacterial count 2.0 × 10 of living
7), attack poison to mouse, mouse survival number is in table 5.
Table 5
| Test strain | Mouse survival number | Protection ratio |
| 1st group | SSΔSBP_bac_5 | 10/10 | 100％ |
| 2nd group | WC-ss7 | 7/10 | 70％ |
| 3rd group | THB | 0/10 | 0 |
4.7 each internal organs Bacteria Detection results
Attack malicious cuing open for latter 7 days and kill mouse, SS Δ SBP_bac_5 immune group has one bacterium to be detected, and 7 of WC-ss7 immune group all detect bacterium.Test-results shows that this recombiant vaccine can effectively induce body to produce specific humoral immunoresponse(HI), makes immune mouse obtain the protection of anti-streptococcus suis attack.And can effectively stop bacterium to breed in vivo.
Claims (8)
1. a swine streptococcus SBP_bac_5 gene-deleted strain, it is characterized in that described gene-deleted strain is not containing the SS △ SBP_bac_5 of resistance marker, be preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center, deposit number is: CGMCC No.10076.
2. a construction process for swine streptococcus SBP_bac_5 gene-deleted strain according to claim 1, is characterized in that described method steps is as follows:
Swine streptococcus serum 7-type bacterial strain described in being imported by the pSET4s plasmid of the upstream and downstream homology arm gene DNA fragment containing the goal gene needing to be knocked out, realizes through homologous recombination; Described DNA segment is SBP_bac_5 upstream homology arm, SBP_bac_5 downstream homology arm successively from upstream to downstream, with upstream sequence and the downstream sequence generation homologous recombination of the SBP_bac_5 protein coding gene of described swine streptococcus 7 type bacterial strain, the SBP_bac_5 gene-deleted strain SS △ SBP_bac_5 obtained.
3. the construction process of swine streptococcus SBP_bac_5 gene-deleted strain according to claim 2, is characterized in that the sequence of described SBP_bac_5 protein coding gene is as shown in SEQNO.1.
4. the construction process of swine streptococcus SBP_bac_5 gene-deleted strain according to claim 2, is characterized in that the primer sequence of described amplification upstream homology arm sequence is as follows:
SBP_bac_5KOP1：GCC
GTCGACAAAATGAGAAAATGATGA；
SBP_bac_5KOP2:TACACCTTTATCTTTACCTTTCACATCA。
5. the construction process of swine streptococcus SBP_bac_5 gene-deleted strain according to claim 2, is characterized in that the primer sequence of described amplification downstream homology arm sequence is as follows:
SBP_bac_5KOP5:GTGAAAGGTAAAGATAAAGGTGTAGTGGCA；
SBP_bac_5KOP6：TTA
GGATCCGATTCCCCTACAATTGCC。
6. a swine streptococcus SBP_bac_5 gene-deleted strain according to claim 1 is in test as the application of the swine streptococcus 7 type bacterial strain of standard.
7. the application of swine streptococcus SBP_bac_5 gene-deleted strain according to claim 1 in preparation prevention swine streptococcus vaccine.
8. a swine streptococcus vaccine, is characterized in that the main active ingredient of described vaccine is for swine streptococcus SBP_bac_5 gene-deleted strain described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510058245.4A CN104762244B (en) | 2015-02-04 | 2015-02-04 | Streptococcus suis SBP_bac_5 gene-deleted strains and its construction method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510058245.4A CN104762244B (en) | 2015-02-04 | 2015-02-04 | Streptococcus suis SBP_bac_5 gene-deleted strains and its construction method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104762244A true CN104762244A (en) | 2015-07-08 |
| CN104762244B CN104762244B (en) | 2017-09-15 |
Family
ID=53644339
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510058245.4A Active CN104762244B (en) | 2015-02-04 | 2015-02-04 | Streptococcus suis SBP_bac_5 gene-deleted strains and its construction method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104762244B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861407A (en) * | 2016-05-16 | 2016-08-17 | 华中农业大学 | Streptococcus suis type-2 hemolysin hemolytic activity genetic mutant strain, and preparation and application for vaccine thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1992016630A1 (en) * | 1991-03-21 | 1992-10-01 | Centraal Diergeneeskundig Instituut | Dna sequences which code for virulence characteristics of streptococcus suis and parts thereof, polypeptides and antibodies derived therefrom and the use thereof for the diagnosis of and protection against infection by s. suis in mammals, including man |
| CN101805723A (en) * | 2009-10-20 | 2010-08-18 | 中国农业科学院哈尔滨兽医研究所 | Anti-glutamate dehydrogenase protein monoclonal antibody, preparation method thereof and use thereof |
| CN102876620A (en) * | 2012-10-26 | 2013-01-16 | 江苏省农业科学院 | Nontoxic ST28 streptococcus suis and application thereof |
-
2015
- 2015-02-04 CN CN201510058245.4A patent/CN104762244B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1992016630A1 (en) * | 1991-03-21 | 1992-10-01 | Centraal Diergeneeskundig Instituut | Dna sequences which code for virulence characteristics of streptococcus suis and parts thereof, polypeptides and antibodies derived therefrom and the use thereof for the diagnosis of and protection against infection by s. suis in mammals, including man |
| CN101805723A (en) * | 2009-10-20 | 2010-08-18 | 中国农业科学院哈尔滨兽医研究所 | Anti-glutamate dehydrogenase protein monoclonal antibody, preparation method thereof and use thereof |
| CN102876620A (en) * | 2012-10-26 | 2013-01-16 | 江苏省农业科学院 | Nontoxic ST28 streptococcus suis and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| WHA JA CHO，ET AL.: "Molecular Cloning of a Novel Chaperone-like Protein Induced by Rhabdovirus Infection with Sequence Similarity to the Bacterial Extracellular Solute-binding Protein Family 5", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| 王淑杰，等: "一株血清7型致病性猪链球菌的分离鉴定", 《中国预防兽医学报》 * |
| 王淑杰: "东北三省猪场S suis感染状况调查及S.suis7比较蛋白组学研究", 《中国博士学位论文全文数据库 农业科技辑》 * |
| 金家民，等: "猪链球菌7型强弱毒株SBP_bac_5差异表达蛋白的鉴定", 《中国预防兽医学报》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861407A (en) * | 2016-05-16 | 2016-08-17 | 华中农业大学 | Streptococcus suis type-2 hemolysin hemolytic activity genetic mutant strain, and preparation and application for vaccine thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104762244B (en) | 2017-09-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106190903B (en) | Riemerlla anatipestifer Cas9 gene deletion mutants and its application | |
| CN102994458B (en) | Porcine pseudorabies virus virulent strain, and gene deletion vaccine strain thereof and applications thereof | |
| CN104805060B (en) | A kind of pseudorabies virus and its application | |
| CN103725651B (en) | One plant of Porcine epidemic diarrhea virus and its application | |
| CN104498441B (en) | Duck hepatitis A virus (HAV) type III low virulent strain and live vaccine prepared therefrom and application | |
| CN102851249B (en) | Haemophilus parasuis LZ-20100109 strain and application thereof | |
| CN107384874A (en) | Pseudorabies virus epidemic strain gI/gE gene deletion mutants and structure and application | |
| CN102399724A (en) | Haemophilus parasuis LC strain and application thereof | |
| CN105462936A (en) | Porcine epidemic diarrhea virus strain MY01 and application thereof | |
| WO2021217959A1 (en) | Recombinant vector containing african swine fever virus immunogenic protein, recombinant bacteria, and application thereof | |
| CN105385663A (en) | Establishment of duck enteritis virus gE and gI double gene deletion virus strain and application of establishment | |
| CN102776220B (en) | Construction of brucellosis A19 molecular marker vaccine strain and determination of virulence and immunogenicity | |
| CN106929451A (en) | One plant of Streptococcus suis and its application | |
| CN105039233B (en) | A kind of B. abortus molecular marker vaccine strain and its application | |
| CN110201153A (en) | A kind of rabbit hemorrhagic disease, pasteurellosis, Disease Caused By Bordetella Avium triple inactivated vaccine and preparation method thereof | |
| CN104004697B (en) | The production method of a kind of single-gene disappearance Rough Anti-Brucella and vaccine thereof | |
| CN109810933A (en) | 2 type Streptococcus suis apuA gene knockout mutant strains of one kind and its application | |
| CN106085936B (en) | A kind of 10 gene-deleted strain of streptococcus suis 2-type and application | |
| CN104894045A (en) | Recombinant lactobacillus for coexpression of foot and mouth disease virus VP1 gene and immunoadjuvant cattle IL-6 gene, and preparation method and application of recombinant lactobacillus | |
| CN102776134B (en) | Streptococcus suis Serotype 2 (SS2 for short) double-gene deleted live vaccine and its application | |
| CN101979503B (en) | Recombinant brucella for expressing Asia type-I foot and mouth disease virus VP1 genes and method for producing vaccines thereof | |
| CN104498417A (en) | Streptococcus suis chorismate-synthase gene deletion strain, and construction method and application thereof | |
| CN102676421B (en) | Bordetella bronchiseptica gene deletion strain, vaccine prepared from Bordetella bronchiseptica gene deletion strain and application | |
| CN104762244A (en) | Streptococcus suis SBP-bac-5 gene deletion strain and construction method and application thereof | |
| CN105154377A (en) | Recombinant Salmonella enteria serovar Pullorum, (S. Pullorum), as well as preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| EXSB | Decision made by sipo to initiate substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |