CN104749143A - Detection method for sumoylated modification of proteins and application thereof - Google Patents

Abstract

The invention provides a detection method for sumoylated modification of proteins. The detection method comprises the following steps of: carrying out cotransfection on recombinant plasmids for expressing the proteins to be detected and recombinant plasmids for expressing the proteins with sumoylated modification of tetracysteine polypeptide tags on host cells to carry out the sumoylated modification of the proteins, then carrying out purification and double-arsenic dyestuff labeling on the proteins, detecting the sumoylated modification of the proteins to be detected, and carrying out quantitative analysis on the modification degree of the poly-sumoylated modification on the proteins to be detected. The detection method is high in sensitivity and is simple and easy to implement. In addition, the invention also provides a detection plasmid for sumoylated modification of the proteins and a preparation method thereof; and the invention also provides a detection kit for the sumoylated modification of the proteins.

Description

A kind of detection method of protein-based ubiquitination and application thereof

Technical field

The present invention relates to biological technical field, be specifically related to a kind of detection method of protein-based ubiquitination, detect plasmid and preparation method, detection kit.

Background technology

It is a kind of protein post-translational modification behavior mediated by ubiquitin-like modified protein that ubiquitin-likeization is modified, research shows that ubiquitin-like is modified in chromosome separation, DNA damage response, meiosis, protein ubiquitination degraded and multiple biological process such as chromatin Structure and function point analysis and plays a significant role, and abnormal ubiquitin-likeization modification is also considered to relevant to the generation of the various diseases such as tumour, angiocardiopathy, nerve degenerative diseases, diabetes.But only have in cell sub-fraction substrate protein can occur ubiquitin-likeization modify, ratio is lower, this low-abundance present situation strongly limit to ubiquitin-likeization modify quantitative analysis and biological function research.

At present, main western blotting method and the mass-spectrometry means of adopting carry out Analysis and Identification to ubiquitin-likeization modification.Western blotting method usually utilize immunosedimentation method come enrichment the target protein modified by ubiquitin-like modified protein, and then utilize polyacrylamide gel electrophoresis to be separated, then carry out transferring film, close, qualification that antibody incubation, the step such as development carry out ubiquitin-like modification; Mass-spectrometry means need to carry out proteinase enzyme to the target protein of purifying and cut, and by obtaining target peptide section mass-to-charge ratio and comparing with corresponding protein sequence databank, thus judge that target protein occurs whether to modify.

But immunoblotting needs to carry out series of experiments operation, and operation steps is many, and experimental period is long; Whether occur to analyze although mass-spectrometry detects to modify ubiquitin-likeization, need to carry out specific transformation to protein sequence database, and quantitative analysis cannot be carried out to the extent of polymerization of ubiquitin-like modified protein poly chain.

Therefore, be necessary to provide a kind of simple, highly sensitive, can detect protein-based ubiquitination, and the method for quantitative analysis is carried out to the degree of modification of the multi-cluster ubiquitination of protein.

Summary of the invention

For solving the problem, the invention provides a kind of detection method of protein-based ubiquitination, the ubiquitin-likeization that the recombinant plasmid of expressing testing protein and the recombinant plasmid cotransfection host cell of ubiquitin-like modified protein of expressing band four cysteine polypeptide label carry out protein is modified by the method, then carries out protein purification, two arsenic dye marker modifying the ubiquitin-likeization of testing protein detects and the degree of modification of multi-cluster ubiquitination of testing protein carries out quantitative analysis; The method is highly sensitive, simple.In addition, detection plasmid that present invention also offers a kind of protein-based ubiquitination and its preparation method and application; In addition, present invention also offers a kind of detection kit of protein-based ubiquitination.

First aspect, the invention provides a kind of detection method of protein-based ubiquitination, comprises the following steps:

(1) provide recombinant plasmid, comprise testing protein expression plasmid and detect plasmid,

Wherein, described testing protein expression plasmid has the encoding gene of testing protein, described detection plasmid contains the encoding gene of connected ubiquitin-like modified protein and the encoding gene of four cysteine polypeptide labels, the encoding gene of described four cysteine polypeptide labels is positioned at 5 ' end of the encoding gene of described ubiquitin-like modified protein, the encoding gene of described four cysteine polypeptide labels is 18bp ~ 36bp

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine,

Described testing protein is the substrate protein of ubiquitin-like modified protein effect;

(2) coexpression in cell by described testing protein expression plasmid and detection plasmid, obtains the testing protein modified through ubiquitin-like modified protein;

(3) testing protein modified through ubiquitin-like modified protein of purifying;

(4) two arsenic fluorescent dye is adopted to carry out fluorescence labeling to the testing protein through ubiquitin-likeization modification after purifying;

(5) the fluorescently-labeled testing protein modified through ubiquitin-likeization is detected and/or quantitative analysis.

Preferably, described testing protein expression plasmid is by the recombinant plasmid of gained after the multiple clone site of the encoding gene of testing protein insertion eukaryotic vector.

Further preferably, described eukaryotic vector is carrier for expression of eukaryon.

Still more preferably, described carrier for expression of eukaryon is pcDNA carrier.

Still more preferably, described pcDNA carrier is pcDNA ^tM3.1/His-A, pcDNA ^tM3.1/His-B, pcDNA ^tM3.1/His-C, pcDNA ^tM4/His-A, pcDNA ^tM4/His-B, pcDNA ^tM4/His-C, pcDNA ^tM3.1(-)/myc-His-A, pcDNA ^tM3.1(-)/myc-His-B, pcDNA ^tM3.1(-)/myc-His-C, pcDNA3.1 (+)/myc-His A, pcDNA3.1 (+)/myc-His B or pcDNA3.1 (+)/myc-His C.

Preferably, detecting plasmid is by the recombinant plasmid of gained after the encoding gene of described connected ubiquitin-like modified protein and the encoding gene insertion prokaryotic vector of four cysteine polypeptide labels or the multiple clone site of eukaryotic vector.

Further preferably, described prokaryotic vector or eukaryotic vector are prokaryotic expression carrier or carrier for expression of eukaryon.

Still more preferably, described prokaryotic expression carrier is pET carrier or pGEX expression vector.

Still more preferably, described carrier for expression of eukaryon is pcDNA carrier.

Still more preferably, described pcDNA carrier is pcDNA ^tM3.1 (+), pcDNA ^tM3.1 (-), pcDNA ^tM3.1/His-A, pcDNA ^tM3.1/His-B or pcDNA ^tM3.1/His-C carrier.

Still more preferably, described multiple clone site is pcDNA ^tMthe Hind III of 3.1/His-A and Xho I restriction enzyme site.

Under this optimum condition, the method that described step (3) purifying expresses the testing protein through ubiquitin-likeization modification of gained is:

A) collecting cell, resuspended by cell lysis buffer solution, ultrasonication;

B) centrifuging and taking supernatant, gained supernatant and nickel binding resin are hatched rear cleaning buffer solution and are cleaned resin 2 ~ 3 times;

C) with the isopyknic elution buffer of resin, the testing protein modified through ubiquitin-likeization is eluted from resin again, obtain the testing protein modified through ubiquitin-likeization of purifying.

Preferably, in described step a), the pH of described cell lysis buffer solution is 8.0, comprising: 100mMNaH ₂pO ₄, 10mM Tris-Cl, 8M urea, 1mM TCEP.

Preferably, in described step b), the pH of described cleaning buffer solution is 6.3, comprising: 100mM NaH ₂pO ₄, 10mM Tris-Cl, 4M urea, 1mM TCEP.

Preferably, in described step c), the pH of described elution buffer is 4.5, comprising: 100mM NaH ₂pO ₄, 10mM Tris-Cl, 2M urea, 1mM TCEP, pH=4.5.

Preferably, described ubiquitin-like modified protein is SUMO1, SUMO2, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12.

Preferably, described SUMO2 is people source SUMO2(h SUMO2), the encoding gene of described people source SUMO2 is as shown in SEQ ID NO:1.

Under this optimum condition, the Genebank accession number of described ubiquitin-like modified protein is as follows:

The Genebank accession number of described SUMO1, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12 is respectively BC006462.1, NM_001286416.1, AB205057.1, BC104201.1, AF123050.1, NM_001997.4, AF313915.1, NM_005101.3, BC005193.1, BC003581.1, AB017507.1;

Preferably, described testing protein is Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC γ 1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, CLK4 or Snu66.

Under this optimum condition, described Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC γ 1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, the Genebank accession number of CLK4 or Snu66 is respectively BC011562.1, BC003596.1, Y11416.1, BC041396.2, S50913.1, AF326592.1, BC068522.1, M34233.1, NM_001145339.2, BC136297.1, J04088.1, AF091214.1, M91463.1, NM_003211.4, NM_003592.2, AF126404.1, BC092409.1, AF077188.1, BC144136.1, NM_002227.2, GU211347.1, X60188.1, AF281255.1, U65410.1, AY441957.1, J04718.1, NM_020666.2, NM_005146.4.

Preferably, the CCXXCC that four cysteine polypeptide labels of the present invention comprise is the amino acid sequence shown in SEQ ID NO:2 in sequence table.

Particularly, described SEQ ID NO:2 is CCPGCC.

Preferably, the amino acid sequence of described four halfcystine tag polypeptide is as shown in SEQ ID NO:3 or SEQ IDNO:4.

Particularly, the sequence of described SEQ ID NO:3 is FLNCCPGCCMEP.

Particularly, the sequence of described SEQ ID NO:4 is HRWCCPGCCKTF.

Preferably, the cell of described testing protein expression plasmid and detection plasmid coexpression is nephrocyte, the OS-732 cells of HEKC, human cervical carcinoma cell, human breast cancer cell, cercopithecus aethiops SV40 conversion.

Preferably, described pair of arsenic fluorochrome label reagent comprises FlAsH-EDT ₂, F2FlAsH-EDT ₂, F4FlAsH-EDT ₂or ReAsH-EDT ₂.

Preferably, described step (4) adopts two arsenic fluorescent dye to carry out fluorescently-labeled method to the testing protein modified through ubiquitin-likeization after purifying to be:

The phosphate buffer that the decaploid of the testing protein modified through ubiquitin-likeization of first purifying with step (3) gained is long-pending carries out diluting and neutralizing, add again two arsenic fluorescent dye at room temperature lucifuge hatch 60 minutes, obtain the testing protein modified through ubiquitin-likeization of two arsenic fluorochrome label; Wherein, the pH of described phosphate buffer is 7.4, and the final concentration after described pair of arsenic fluorescent dye adds is 500nM.

Under this optimum condition, the long-pending phosphate buffer of described decaploid is ten times of the volume of eluent after the purifying of step (3) gained.

Preferably, described step (5) to the method that detects of testing protein of modifying through ubiquitin-likeization after fluorescence labeling is: utilize utilizing total internal reflection fluorescence microscope to carry out single molecular imaging to the testing protein modified through ubiquitin-likeization, observe testing protein and whether ubiquitin-likeization modification occurs.

Preferably, described step (5) to the method that the testing protein through ubiquitin-likeization modification after fluorescence labeling carries out quantitative analysis is:

Be that single ubiquitin-likeization is modified by being with the mean value definition of the fluorescence intensity of the ubiquitin-like modified protein of single four cysteine polypeptide labels, the fluorescence intensity level obtained by the testing protein modified through ubiquitin-likeization is again divided by mono-modified fluorescent value, thus calculate the degree of modification of the testing protein modified through ubiquitin-likeization, namely ubiquitin-likeization modifies the degree of polymerization of poly chain.

Preferably, described step (5) detects the testing protein through ubiquitin-likeization modification after fluorescence labeling and the method for quantitative analysis is: utilize utilizing total internal reflection fluorescence microscope to carry out single molecular imaging to the testing protein modified through ubiquitin-likeization, observe testing protein and whether ubiquitin-likeization modification occurs; Then will the mean value definition of the fluorescence intensity of the ubiquitin-like modified protein of single four cysteine polypeptide labels be with to be that single ubiquitin-likeization is modified, the fluorescence intensity level obtained by the testing protein modified through ubiquitin-likeization is again divided by mono-modified fluorescent value, thus calculate the degree of modification of the testing protein modified through ubiquitin-likeization, namely ubiquitin-likeization modifies the degree of polymerization of poly chain.

Preferably, in the ubiquitin-like modified protein of the single four cysteine polypeptide labels of described band, described list four cysteine polypeptide label is positioned at the N end of described ubiquitin-like modified protein.

The single ubiquitin-like modified protein of four cysteine polypeptide labels of band of the present invention and the fusion of single four cysteine polypeptide labels and ubiquitin-like sample modified protein.

The detection method of protein-based ubiquitination provided by the invention, by by ubiquitin-like modified protein and four cysteine polypeptide tag fusion, by reaction Non-specific between four cysteine polypeptide labels and two arsenic fluorescent dye, i.e. two arsenic fluorescent dye covalent bond four cysteine polypeptide label and send fluorescence, thus change ubiquitin-like modification and/or this biological event of multi-cluster ubiquitination into visible fluorescence signal, and realize the Sensitive Detection of ubiquitin-likeization modification and the quantitative analysis of multi-cluster ubiquitination in conjunction with the Single Molecule Detection ability of utilizing total internal reflection fluorescence microscope.

Second aspect, the invention provides a kind of detection plasmid of protein-based ubiquitination, containing the encoding gene of ubiquitin-like modified protein be connected and the encoding gene of four cysteine polypeptide labels, the encoding gene of described four cysteine polypeptide labels is positioned at 5 ' end of the encoding gene of described ubiquitin-like modified protein, and the encoding gene of described four cysteine polypeptide labels is 18bp ~ 36bp;

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine.

Preferably, detecting plasmid is by the recombinant plasmid of gained after the encoding gene of described connected ubiquitin-like modified protein and the encoding gene insertion prokaryotic vector of four cysteine polypeptide labels or the multiple clone site of eukaryotic vector.

Further preferably, described prokaryotic vector or eukaryotic vector are prokaryotic expression carrier or carrier for expression of eukaryon.

Still more preferably, described prokaryotic expression carrier is pET carrier or pGEX carrier.

Still more preferably, described carrier for expression of eukaryon is pcDNA carrier.

Still more preferably, described pcDNA carrier is pcDNA ^tM3.1 (+), pcDNA ^tM3.1 (-), pcDNA ^tM3.1/His-A, pcDNA ^tM3.1/His-B or pcDNA ^tM3.1/His-C carrier.

Still more preferably, described multiple clone site is pcDNA ^tMthe Hind III of 3.1/His-A and Xho I restriction enzyme site.

Preferably, described ubiquitin-like modified protein is SUMO1, SUMO2, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12.

Preferably, described SUMO2 is people source SUMO2(h SUMO2), described people source SUMO2(hSUMO2) encoding gene as shown in SEQ ID NO:1.

Under this optimum condition, the Genebank accession number of described ubiquitin-like modified protein is as follows:

The Genebank accession number of described SUMO1, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12 is respectively BC006462.1, NM_001286416.1, AB205057.1, BC104201.1, AF123050.1, NM_001997.4, AF313915.1, NM_005101.3, BC005193.1, BC003581.1, AB017507.1;

Preferably, described testing protein is Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC _γ1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, CLK4 or Snu66.

Under this optimum condition, described Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC _γ1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, the Genebank accession number of CLK4 or Snu66 is respectively BC011562.1, BC003596.1, Y11416.1, BC041396.2, S50913.1, AF326592.1, BC068522.1, M34233.1, NM_001145339.2, BC136297.1, J04088.1, AF091214.1, M91463.1, NM_003211.4, NM_003592.2, AF126404.1, BC092409.1, AF077188.1, BC144136.1, NM_002227.2, GU211347.1, X60188.1, AF281255.1, U65410.1, AY441957.1, J04718.1, NM_020666.2, NM_005146.4.

Preferably, the present invention adopt four cysteine polypeptide labels to comprise CCXXCC be the amino acid sequence shown in SEQ ID NO:2 in sequence table.

Preferably, described CCXXCC is CCPGCC.

Preferably, the amino acid sequence of described four halfcystine tag polypeptide is as shown in SEQ ID NO:3 or SEQ IDNO:4.

Particularly, the sequence of described SEQ ID NO:3 is FLNCCPGCCMEP.

Particularly, the sequence of described SEQ ID NO:4 is HRWCCPGCCKTF.

The third aspect, the invention provides a kind of preparation method of detection plasmid of protein-based ubiquitination, comprises the steps:

(1), the pcr amplification template of ubiquitin-like modified protein encoding gene is provided;

(2), the pcr amplification primer of ubiquitin-like modified protein encoding gene is provided, comprise upstream primer and downstream primer, wherein, described upstream primer has the coding gene sequence of four cysteine polypeptide labels, and the coding gene sequence of described four cysteine polypeptide labels is 18bp ~ 36bp;

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine;

(3), the gene template that adopts step (2) the pcr amplification primer that provides and step (1) to provide carries out PCR, increases and obtains the fusion of the ubiquitin-like modified protein of coding-belt four cysteine polypeptide label;

(4), the fusion of gained after amplification is inserted into the multiple clone site of carrier, obtain detecting plasmid, described detection plasmid contains the encoding gene of connected ubiquitin-like modified protein and the encoding gene of four cysteine polypeptide labels, the encoding gene of described four cysteine polypeptide labels is positioned at 5 ' end of the encoding gene of described ubiquitin-like modified protein, the encoding gene of described four cysteine polypeptide labels is 18bp ~ 36bp

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine.

Preferably, in described step (2), the sequence of described upstream primer and downstream primer is respectively as shown in SEQ IDNO:5 and SEQ ID NO:6.

Particularly, the sequence shown in SEQ ID NO:5 is (5 '-3 '):

GC AAGCTTACCATGGGA ATGGCCGACGAAAAGCCCAAGGAAGG；

Particularly, the sequence shown in SEQ ID NO:6 is (5 '-3 '):

CG CTCGAGTCAACCTCCCGTCTGCTGTT。

In SEQ ID NO:5 and SEQ ID NO:6, single underscore identification division is restriction enzyme site, and double underline identification division is the encoding gene of four cysteine polypeptide labels.

Preferably, in described step (4), described carrier is prokaryotic expression carrier or carrier for expression of eukaryon.

Further preferably, described prokaryotic expression carrier is pET carrier or pGEX carrier.

Further preferably, described carrier for expression of eukaryon is pcDNA carrier.

Further preferably, described pcDNA carrier is pcDNA ^tM3.1 (+), pcDNA ^tM3.1 (-), pcDNA ^tM3.1/His-A, pcDNA ^tM3.1/His-B or pcDNA ^tM3.1/His-C carrier.

Under this optimum condition, described multiple clone site is preferably pcDNA ^tMthe Hind III of 3.1/His-A and Xho I restriction enzyme site.

Preferably, described ubiquitin-like modified protein is SUMO1, SUMO2, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12.

Preferably, described SUMO2 is people source SUMO2(h SUMO2), the encoding gene of described people source SUMO2 is as shown in SEQ ID NO:1.

Under this optimum condition, the Genebank accession number of described ubiquitin-like modified protein is as follows:

The Genebank accession number of described SUMO1, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12 is respectively BC006462.1, NM_001286416.1, AB205057.1, BC104201.1, AF123050.1, NM_001997.4, AF313915.1, NM_005101.3, BC005193.1, BC003581.1, AB017507.1;

Preferably, described testing protein is Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC _γ1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, CLK4 or Snu66.

Under this optimum condition, described Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC _γ1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, the Genebank accession number of CLK4 or Snu66 is respectively BC011562.1, BC003596.1, Y11416.1, BC041396.2, S50913.1, AF326592.1, BC068522.1, M34233.1, NM_001145339.2, BC136297.1, J04088.1, AF091214.1, M91463.1, NM_003211.4, NM_003592.2, AF126404.1, BC092409.1, AF077188.1, BC144136.1, NM_002227.2, GU211347.1, X60188.1, AF281255.1, U65410.1, AY441957.1, J04718.1, NM_020666.2, NM_005146.4.

Preferably, the present invention adopt four cysteine polypeptide labels to comprise CCXXCC be the amino acid sequence shown in SEQ ID NO:2 in sequence table.

Preferably, described CCXXCC is CCPGCC.

Preferably, the amino acid sequence of described four cysteine polypeptide labels is as shown in SEQ ID NO:3 or SEQ IDNO:4.

Particularly, the sequence of described SEQ ID NO:3 is FLNCCPGCCMEP.

Particularly, the sequence of described SEQ ID NO:4 is HRWCCPGCCKTF.

Fourth aspect, the invention provides a kind of host cell containing, for example the recombinant expression plasmid described in second aspect.

Preferably, described host cell is Top10, DH5 α, BL21, BL21 (DE3), HEK293T or COS7.

5th aspect, the invention provides a kind of detection kit of protein-based ubiquitination, comprise detection plasmid, testing protein expression plasmid, protein purification reagent, two arsenic fluorochrome label reagent and poly chain polymerization metrization analyze internal reference reagent, wherein, described detection plasmid contains the encoding gene of connected ubiquitin-like modified protein and the encoding gene of four cysteine polypeptide labels, the encoding gene of described four cysteine polypeptide labels is positioned at 5 ' end of the encoding gene of described ubiquitin-like modified protein, the encoding gene of described four cysteine polypeptide labels is 18bp ~ 36bp,

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine.

Preferably, detecting plasmid is the recombinant plasmid encoding gene of the encoding gene of described connected ubiquitin-like modified protein and four cysteine polypeptide labels being inserted gained after the multiple clone site of eukaryotic vector.

Further preferably, described eukaryotic vector is carrier for expression of eukaryon.

Still more preferably, described carrier for expression of eukaryon is pcDNA carrier.

Still more preferably, described pcDNA carrier is pcDNA ^tM3.1 (+), pcDNA ^tM3.1 (-), pcDNA ^tM3.1/His-A, pcDNA ^tM3.1/His-B or pcDNA ^tM3.1/His-C carrier.

Still more preferably, described multiple clone site is pcDNA ^tMthe Hind III of 3.1/His-A and Xho I restriction enzyme site.

Preferably, described SUMO2 is people source SUMO2(h SUMO2), the encoding gene of described people source SUMO2 is as shown in SEQ ID NO:1.

Preferably, described ubiquitin-like modified protein is SUMO1, SUMO2, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12.

Under this optimum condition, the Genebank accession number of described ubiquitin-like modified protein is as follows:

The Genebank accession number of described SUMO1, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12 is respectively BC006462.1, NM_001286416.1, AB205057.1, BC104201.1, AF123050.1, NM_001997.4, AF313915.1, NM_005101.3, BC005193.1, BC003581.1, AB017507.1;

Preferably, described testing protein is Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC _γ1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, CLK4 or Snu66.

Under this optimum condition, described Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC _γ1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, the Genebank accession number of CLK4 or Snu66 is respectively BC011562.1, BC003596.1, Y11416.1, BC041396.2, S50913.1, AF326592.1, BC068522.1, M34233.1, NM_001145339.2, BC136297.1, J04088.1, AF091214.1, M91463.1, NM_003211.4, NM_003592.2, AF126404.1, BC092409.1, AF077188.1, BC144136.1, NM_002227.2, GU211347.1, X60188.1, AF281255.1, U65410.1, AY441957.1, J04718.1, NM_020666.2, NM_005146.4.

Preferably, the present invention adopt four cysteine polypeptide labels to comprise CCXXCC be the amino acid sequence shown in SEQ ID NO:2 in sequence table.

Preferably, described CCXXCC is CCPGCC.

Preferably, the amino acid sequence of described four halfcystine tag polypeptide is as shown in SEQ ID NO:3 or SEQ IDNO:4.

Particularly, the sequence of described SEQ ID NO:3 is FLNCCPGCCMEP.

Particularly, the sequence of described SEQ ID NO:4 is HRWCCPGCCKTF.

Preferably, described testing protein expression plasmid is by the recombinant plasmid of gained after the multiple clone site of the encoding gene of testing protein insertion eukaryotic vector.

Further preferably, described eukaryotic vector is carrier for expression of eukaryon.

Still more preferably, described carrier for expression of eukaryon is pcDNA carrier.

Still more preferably, described pcDNA carrier is pcDNA ^tM3.1/His-A, pcDNA ^tM3.1/His-B, pcDNA ^tM3.1/His-C, pcDNA ^tM4/His-A, pcDNA ^tM4/His-B, pcDNA ^tM4/His-C, pcDNA ^tM3.1(-)/myc-His-A, pcDNA ^tM3.1(-)/myc-His-B, pcDNA ^tM3.1(-)/myc-His-C, pcDNA3.1 (+)/myc-His A, pcDNA3.1 (+)/myc-His B or pcDNA3.1 (+)/myc-His C.

Preferably, described protein purification reagent comprises cell lysis buffer solution, cleaning buffer solution and elution buffer.

Further preferably, the pH of described cell lysis buffer solution is 8.0, comprising: 100mM NaH ₂pO ₄, 10mM Tris-Cl, 8M urea, 1mM TCEP.

Further preferably, the pH of described cleaning buffer solution is 6.3, comprising: 100mM NaH ₂pO ₄, 10mMTris-Cl, 4M urea, 1mM TCEP.

Further preferably, the pH of described elution buffer is 4.5, comprising: 100mM NaH ₂pO ₄, 10mMTris-Cl, 2M urea, 1mM TCEP.

Under this optimum condition, the method for described protein purification reagent purification marking protein is adopted to be:

A) collecting cell, resuspended by cell lysis buffer solution, ultrasonication;

B) centrifuging and taking supernatant, gained supernatant and nickel binding resin are hatched rear cleaning buffer solution and are cleaned resin 2 ~ 3 times;

C) with resin isopyknic elution buffer, protein is eluted from resin again, obtain the protein of purifying.

Adopt protein purification reagent provided by the invention can carry out purifying to the testing protein modified through ubiquitin-likeization.

Preferably, described pair of arsenic fluorochrome label reagent comprises FlAsH-EDT ₂, F2FlAsH-EDT ₂, F4FlAsH-EDT ₂or ReAsH-EDT ₂.

Under this optimum condition, adopt provided by the invention pair of arsenic fluorochrome label reagent to carry out fluorescently-labeled method to the testing protein modified through ubiquitin-likeization to be:

The phosphate buffer that the decaploid of the testing protein modified through ubiquitin-likeization of first purifying with gained is long-pending carries out diluting and neutralizing, add again two arsenic fluorescent dye at room temperature lucifuge hatch 60 minutes, obtain the testing protein modified through ubiquitin-likeization of two arsenic fluorochrome label; Wherein, the pH of described phosphate buffer is 7.4, and the final concentration after described pair of arsenic fluorescent dye adds is 500nM.

Preferably, the phosphate buffer that described decaploid is amassed is ten times that contain the effluent volume of the testing protein that ubiquitin-likeization is modified after purifying.

Preferably, described poly chain polymerization metrization analyzes the ubiquitin-like modified protein that internal reference reagent comprises the single four cysteine polypeptide labels of band.

Under this optimum condition, described poly chain polymerization degree-quantitative analysis internal reference reagent is adopted to detect the testing protein modified through ubiquitin-likeization and/or the method for quantitative analysis is:

Utilize utilizing total internal reflection fluorescence microscope to carry out single molecular imaging to the testing protein that the ubiquitin-likeization through two arsenic fluorochrome label is modified, observe testing protein and whether ubiquitin-likeization modification occurs; And/or

Be that single ubiquitin-likeization is modified by being with the mean value definition of the fluorescence intensity of the ubiquitin-like modified protein of single four cysteine polypeptide labels, the fluorescence intensity level obtained by the testing protein modified through ubiquitin-likeization is again divided by mono-modified fluorescent value, thus calculate the degree of modification of the testing protein modified through ubiquitin-likeization, namely ubiquitin-likeization modifies the degree of polymerization of poly chain.

Preferably, the preparation method of the ubiquitin-like modified protein of the single four cysteine polypeptide labels of described band is as follows:

1) provide four cysteine polypeptide labels and ubiquitin-like modified protein fusion as the gene template of pcr amplification,

2) the pcr amplification primer of four cysteine polypeptide labels and ubiquitin-like modified protein fusion is provided, comprises upstream primer and downstream primer,

3) gene template that the pcr amplification primer adopting step (2) to provide and step (1) provide carries out PCR, and amplification obtains the fusion of the ubiquitin-like modified protein of coding-belt four cysteine polypeptide label;

4) fusion of gained after amplification is inserted into the multiple clone site of prokaryotic expression carrier, obtain the encoding gene prokaryotic expression plasmid of the ubiquitin-like modified protein of band four cysteine polypeptide label, gained prokaryotic expression plasmid contains the encoding gene of connected ubiquitin-like modified protein and the encoding gene of single four cysteine polypeptide labels

5) in prokaryotic expression system, express the ubiquitin-like modified protein of the also single four cysteine polypeptide labels of purifying band, obtain the ubiquitin-like modified protein of the single four cysteine polypeptide labels of described band.

Preferably, the nucleotide sequence of described four cysteine polypeptide labels and ubiquitin-like modified protein fusion is as shown in SEQ ID NO:7.

Preferably, described prokaryotic expression carrier is pET-28a.

Preferably, described step 2) in, the sequence of described upstream primer and downstream primer is respectively as shown in SEQ IDNO:8 and SEQ ID NO:6.

Particularly, the sequence shown in SEQ ID NO:8 is (5 '-3 '):

GCCATGGGCCATCATCATCATCATCACGGCTTCTTGAAC

TGTTGCCCGGGCTGCTG；

Particularly, the sequence shown in SEQ ID NO:6 is (5 '-3 '):

CG CTCGAGTCAACCTCCCGTCTGCTGTT。

Preferably, the amino acid sequence of the ubiquitin-like modified protein of the single four cysteine polypeptide labels of described band is as shown in SEQ ID NO:9.

The detection method of the protein-based ubiquitination that the invention provides, detect plasmid and preparation method, detection kit has following beneficial effect:

(1) detection method of protein-based ubiquitination provided by the invention, by by ubiquitin-like modified protein and four cysteine polypeptide tag fusion, by reaction Non-specific between four cysteine polypeptide labels and two arsenic fluorescent dye, whether there is ubiquitin-likeization modification to testing protein to detect, and quantitative analysis is carried out to the degree of modification of multi-cluster ubiquitination;

(2) detection method of protein-based ubiquitination provided by the invention is highly sensitive, simple to operate;

(3) in addition, detection plasmid, the detection kit preparation of the protein-based ubiquitination that the invention provides are simple, and cost is lower.

Accompanying drawing explanation

Fig. 1 is the recombinant expression plasmid pcDNA that the embodiment of the present invention 1 obtains ^tM3.1-4Cys-hSUMO2 carries out the agarose gel electrophoresis figure after double digestion;

Fig. 2 is the coomassie brilliant blue staining result of the 4Cys-hSUMO2 fusion after the embodiment of the present invention 2 purifying;

Fig. 3 is the single molecular imaging result of the 4Cys-hSUMO2 fusion that the embodiment of the present invention 2 obtains;

Fig. 4 is the single molecular imaging result that the obtained Sp100 albumen of the embodiment of the present invention 3 little ubiquitin sample occurs under normal physiological condition in HEK293T cell is modified;

Fig. 5 is the obtained Sp100 albumen of the embodiment of the present invention 3 by the single molecular imaging result little ubiquitin sample occurs under hydrogen peroxide disposition in HEK293T cell modifying;

Fig. 6 is the quantitative analysis result that Sp100 albumen that the embodiment of the present invention 3 and 4 calculates the little ubiquitin sample of poly occurs under normal physiological conditions in HEK293T cell is modified;

Fig. 7 is the Sp100 albumen that calculates of the embodiment of the present invention 3 and 4 by quantitative analysis result poly little ubiquitin sample occurs under hydrogen peroxide disposition in HEK293T cell modifying.

Embodiment

The following stated is the preferred embodiment of the present invention; it should be pointed out that for those skilled in the art, under the premise without departing from the principles of the invention; can also make some improvements and modifications, these improvements and modifications are also considered as protection scope of the present invention.

Method used in following embodiment is conventional method if no special instructions, and concrete steps can be see: " Molecular Cloning:A Laboratory Manual " (Sambrook, J., Russell, David W., Molecular Cloning:A Laboratory Manual, 3 ^rdedition, 2001, NY, Cold SpringHarbor).The primer is synthesized by precious bioengineering (Dalian) company limited.

The carrier pcDNA that the embodiment of the present invention uses ^tM3.1/His A, bacterial strain DH5 α and BL21 (DE3) that use are purchased from invitrogen company, and cell line HEK293T is purchased from ATCC, and the reagent used is commercial goods.

The present invention is preferably modified to example with the little ubiquitin sample of protein, provides following embodiment 1 ~ 4:

Embodiment 1

A kind of little ubiquitin sample modified protein-2(small ubiquitin-like modifier2, SUMO2) with the construction method of four cysteine polypeptide label (4Cys) fusion gene expression plasmids, comprise the following steps:

(1) to increase four cysteine polypeptide labels-people source little ubiquitin sample modified protein-2 fusion (4Cys-hSUMO2)

With SEQ ID NO:1 for template, SEQ ID NO:5 and the primer shown in SEQ ID NO:6 is adopted to carry out the encoding gene (hSUMO2 of pcr amplification people source little ubiquitin sample modified protein-2, the encoding gene of described hSUMO2 is as shown in SEQ ID NO:1), amplification condition is:

PCR reaction system is (100 μ l): 10 ╳ Buffer10 μ l, dNTP mix8 μ l, DNA profiling 1 μ l, Taq enzyme 1 μ l, primer mixture 2 μ l, distilled water 78 μ l;

Response parameter is: 95 DEG C of 3min, 95 DEG C of 30s, 58 DEG C of 30s, 72 DEG C of 30s totally 30 circulations, finally again 72 DEG C extend 5min.

Then adopt agarose gel electrophoresis to reclaim PCR primer, reclaim product and deliver to the order-checking of precious bioengineering (Dalian) company limited.

(2) containing the recombinant expression plasmid pcDNA of 4Cys-hSUMO2 ^tMthe structure of 3.1-4Cys-hSUMO2

1.4Cys-hSUMO2 fusion and pcDNA ^tMthe double digestion of 3.1/His A carrier;

Get pcDNA ^tM3.1/His A carrier, increase step (1) the 4Cys-hSUMO2 fusion and pcDNA obtained ^tM3.1/His A carrier utilizes identical enzyme to carry out endonuclease reaction respectively, and enzyme is cut system and distinguished as follows:

2.4Cys-hSUMO2 fusion and pcDNA ^tMthe connection of 3.1/His A carrier;

After step 1 gained double digestion product is carried out 1% agarose gel electrophoresis, reclaim object fragment, the same pcDNA of 4Cys-hSUMO2 fusion after being cut by enzyme ^tM3.1/His A carrier connects, and 22 DEG C connect 2h, and coupled reaction system is as follows:

3. enzyme is cut and checks order qualification

5 μ L are connected the DH5 α competent cell of product conversion 100 μ L, coat the LB solid plate nutrient culture media containing ammonia benzyl (100 mcg/ml), 37 DEG C of overnight incubation, picking list bacterium colony extracts plasmid after cultivating and adopts bacterium liquid PCR to identify, adopt double digestion to identify again clone positive for qualification, it is as follows that enzyme cuts system:

37 DEG C of enzymes cut 1 hour, and 2% agarose gel electrophoresis is identified, enzyme cut after agarose gel electrophoresis figure as shown in Figure 1, in FIG, swimming lane 1 is DNA molecular amount marker(pUC19DNA/MspIMarker), swimming lane 2 be build expression plasmid pcDNA ^tM3.1-4Cys-hSUMO2 carries out double digestion (XhoI and Hind III) result, and wherein, swimming lane 2 has obvious band at about 340bp, this stripe size and 4Cys-hSUMO2 fusion in the same size, shows that 4Cys-hSUMO2 is successfully building up on carrier;

Checked order by the positive colony of qualification, the clone that sequencing result is consistent with the complete comparison of 4Cys-hSUMO2 sequence saves backup.

In addition, with reference to common molecular cloning process, the recombinant expression plasmid pcDNA of construction expression testing protein Sp100 ^tM3.1/His A-Sp100, the genebank accession number of described Sp100 encoding gene is BC011562.1, and the encoding gene of described Sp100 inserts pcDNA ^tMthe Kpn I of 3.1/His A carrier and EcoR I site, the encoding gene of described Sp100 inserts pcDNA ^tMduring 3.1/His A carrier, the primer sequence that amplification Sp100 gene uses is 5 '-TAAGGTACCTATGGCAGGTGGGGGCGGCG-3 ' (SEQ ID NO:10) and 5 '-GCGAATTC CTAATCTTCTTTACCTGACCCTC-3 ' (SEQ ID NO:11).

Embodiment 2

A kind of little ubiquitin sample modified protein-2(i.e. fusion of single four cysteine polypeptide labels and little ubiquitin sample modified protein-2 with single four cysteine polypeptide labels) expression, SDS-PAGE electrophoretic analysis and Single Molecule Detection

(1) primer of nucleotide sequence as shown in SEQ ID NO:6 and SEQ ID NO:8 is provided, and the gene template of nucleotide sequence as shown in SEQ ID NO:7, amplification 4Cys-hSUMO2 fusion;

(2) by the multiple clone site of gained 4Cys-hSUMO2 fusion gene cloning to pET-28a carrier, adopt prokaryotic expression 4Cys-hSUMO2 fusion, after purifying, obtain the i.e. single 4Cys-hSUMO2 fusion of little ubiquitin sample modified protein-2(being with single four cysteine polypeptide labels);

(3) detection of single 4Cys-hSUMO2 fusion

Adopt the single 4Cys-hSUMO2 fusion after SDS-PAGE electroresis appraisal purifying, SDS-PAGE electrophoresis carries out with reference to Molecular Cloning: A Laboratory guide, and concentrated gum concentration is 5%, and resolving gel concentration is 15%, concentrated glue 100V constant voltage, separation gel 120V constant voltage is run about 2 hours.The Coomassie brilliant blue testing result of the 4Cys-hSUMO2 fusion after separation is shown in Fig. 2.In fig. 2, swimming lane 1 and swimming lane 2 are respectively protein molecule Marker(Fermentas company, and production number is SM0431) and purifying after protein band, described protein band size is 17kD, in the same size with the theoretical value of single 4Cys-hSUMO2 fusion;

In order to absolutely prove beneficial effect of the present invention, the present embodiment additionally provides this single 4Cys-hSUMO2 fusion through FIAsH-EDT ₂the Single Molecule Detection result figure of imaging is carried out with utilizing total internal reflection fluorescence microscope, as shown in Figure 3 after mark; From Fig. 2 and Fig. 3, the single 4Cys-hSUMO2 fusion of the present embodiment successful expression and purifying.For the extent of polymerization of further quantitative analysis little ubiquitin sample modified protein poly chain, measure through FIAsH-EDT ₂the fluorescence intensity of the little ubiquitin sample modified protein-2 of the single four cysteine polypeptide labels of band of mark, and be mono-modified by the mean value definition of little ubiquitin sample modified protein-2 fluorescence intensity of single for band four cysteine polypeptide labels.

Embodiment 3

Present embodiments provide a kind of method of recombinant modified albumen 4Cys-hSUMO2 and the expression and purification of testing protein in eukaryotic, comprise the steps:

(1) fusion 4Cys-hSUMO2 and the expression of testing protein Sp100 in eukaryotic

By pcDNA ^tM3.1-4Cys-hSUMO2 plasmid and pcDNA ^tM3.1/His A-Sp100 plasmid is transfected in HEKC jointly, is abandoned by nutrient solution old in HEKC, and add fresh medium before transfection; Concrete grammar is: utilize lipofection or calcium phosphate transfection method by 2.5 microgram pcDNA ^tM3.1-4Cys-hSUMO2 plasmid and 2.5 microgram pcDNA ^tM3.1/His A-Sp100 proceeds in cell jointly.After transfection 24 hours, suck the nutrient culture media comprising transfection liquid, be replaced by fresh culture, and continue cultivation 12 to 24 hours.

(2) the Sp100 albumen modified through little ubiquitin sample of purifying

The HEKC of transfection is blown off from double dish, then within centrifugal 5 minutes, collects with the rotating speed of 1000 rpms, and clean cell twice with cold trishydroxymethylaminomethane-hydrochloride buffer saline solution (hereinafter referred to as Tris-HCl); Collecting cell is also with 0.5 ml cells lysis buffer (100mM NaH ₂pO ₄, 10mMTris-Cl, 8M urea, 1mM TCEP, pH=8.0) and resuspended, recycling cell Ultrasonic Cell Disruptor is broken further; Cell after fragmentation removes cell fragments in centrifugal 10 minutes with 12000 rpms, and the supernatant of acquisition and nickel binding resin were incubated at room 1 hour; Hatch complete, with cleaning buffer solution (100mM NaH ₂pO ₄, 10mM Tris-Cl, 4M urea, 1mM TCEP, pH=6.3) clean resin twice, finally with the isopyknic elution buffer of resin (100mM NaH ₂pO ₄, 10mM Tris-Cl, 2M urea, 1mM TCEP, pH=4.5) target protein is eluted from resin, the phosphate buffer (pH=7.4) that the product decaploid eluted is amassed dilutes.

Embodiment 4

Present embodiments provide a kind of method of the little ubiquitin sample modification of poly being carried out to Single Molecule Detection and quantitative analysis, comprise the steps:

1) fluorescence labeling of little ubiquitin sample modified protein poly chain

By purifying protein diluted for phosphate buffer in embodiment 3 step (2) and two arsenic fluorescent dye FIAsH-EDT ₂(final concentration is 500nM) hatches 60 minutes in room temperature lucifuge, can carry out fluorescence labeling to the little ubiquitin sample modification covalently bind on Sp100 albumen and poly chain;

2) the little Single Molecule Detection of ubiquitin sample modification and the quantitative analysis of poly chain

Little ubiquitin sample after mark is modified and can be directly used in single molecular imaging, during observation, by on the slide of 10 Al of Solution instillation thickness between 0.13 millimeter to 0.16 mm of thickness, 5-10 minute is left standstill in room temperature, carry out exciting and imaging with the laser that wavelength is 488 nanometers again, gained imaging results as shown in Figure 4 and Figure 5, illustrates that labeling method provided by the invention is effective;

For the extent of polymerization of quantitative analysis little ubiquitin sample modified protein poly chain, will through FIAsH-EDT ₂the mean value definition of the fluorescence intensity of the little ubiquitin sample modified protein-2 of the band list four cysteine polypeptide label of mark is mono-modified, again little for poly ubiquitin sample is modified and occur that the brightness of different phosphor dot is divided by mono-modified fluorescent value, thus calculate the extent of polymerization of poly chain.

Wherein, the little ubiquitin sample modified protein-2 of the single four halfcystine labels of band that the little ubiquitin sample modified protein-2 of the single four halfcystine labels of described band provides for the embodiment of the present invention 2, its single molecular imaging result as shown in Figure 3.

For absolutely proving beneficial effect of the present invention, under the present embodiment additionally provides different condition, the little ubiquitin sample of Sp100 albumen generation poly modifies single molecular imaging and quantitative analysis result.As also shown in e.g. figs. 4-7, wherein, Fig. 4 is the single molecular imaging result that the modification of little ubiquitin sample occurs Sp100 albumen under normal physiological condition to result; The single molecular imaging result of little ubiquitin sample modification is being there is in Fig. 5 with Sp100 albumen under hydrogen peroxide disposition; Fig. 6 is the poly chain polymerization degree quantitative analysis results that under normal physiological condition, the little ubiquitin sample of Sp100 albumen generation poly is modified; Fig. 7 is in the poly chain polymerization degree quantitative analysis results of modifying with the little ubiquitin sample of Sp100 albumen generation poly under hydrogen peroxide disposition; In figure 6 and figure 7, ordinate represents the ratio shared by different extent of polymerization (little ubiquitin sample is modified chain polymerization degree and is respectively 2,3,4,5), and the degree of polymerization represents the number of the little ubiquitin sample modified protein-2 that poly chain contains.

From Fig. 4 ~ 5, with under hydrogen peroxide disposition, there is more Sp100 albumen that little ubiquitin sample occurs in cell and modify; From Fig. 6 ~ 7, with under hydrogen peroxide disposition and under normal physiological condition, Sp100 albumen all can modify by 2 poly-, 3 poly-and 4 poly-little ubiquitin sample modified protein chains, and under hydrogen peroxide disposition, Sp100 albumen also can modify by 5 poly-little ubiquitin sample modified protein chains; In addition, after hydrogen peroxide process, declined by the Sp100 protein ratio that 2 poly-little ubiquitin sample modified proteins are modified, by 4 poly-little ubiquitin sample modified protein chains the ratio of modifying then raise; From Fig. 4 ~ 7, the detection method of protein-based ubiquitination provided by the invention can carry out Single Molecule Detection and quantitative analysis to multi-cluster ubiquitination.

Monomolecular detection method provided by the invention directly can be observed out testing protein and whether ubiquitin-likeization modification occurs, and quantitative analysis can obtain degree of modification information ubiquitin-likeization occurring and modifies, the i.e. extent of polymerization of the poly chain of testing protein generation multi-cluster ubiquitination.

The foregoing is only preferred embodiment of the present invention, not in order to limit the present invention, all any amendments done within the spirit and principles in the present invention, equivalent replacement and improvement etc., all should be included within protection scope of the present invention.

Claims (10)

1. a detection method for protein-based ubiquitination, is characterized in that, comprises the following steps:

(1) provide recombinant plasmid, comprise testing protein expression plasmid and detect plasmid,

Wherein, described testing protein expression plasmid has the encoding gene of testing protein, described detection plasmid contains the encoding gene of connected ubiquitin-like modified protein and the encoding gene of four cysteine polypeptide labels, the encoding gene of described four cysteine polypeptide labels is positioned at 5 ' end of the encoding gene of ubiquitin-like modified protein, the encoding gene of described four cysteine polypeptide labels is 18bp ~ 36bp

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine,

Described testing protein is the substrate protein of ubiquitin-like modified protein effect;

(2) coexpression in cell by described testing protein expression plasmid and detection plasmid, obtains the testing protein modified through ubiquitin-likeization;

(3) testing protein modified through ubiquitin-like modified protein of purifying;

(4) two arsenic fluorescent dye is adopted to carry out fluorescence labeling to the testing protein through ubiquitin-likeization modification after purifying;

(5) the fluorescently-labeled testing protein modified through ubiquitin-likeization is detected and/or quantitative analysis.

2. the detection method of protein-based ubiquitination as claimed in claim 1, it is characterized in that, described ubiquitin-like modified protein is SUMO1, SUMO2, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12.

3. the detection method of protein-based ubiquitination as claimed in claim 1, it is characterized in that, described testing protein is Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC _γ1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, CLK4 or Snu66.

4. the detection plasmid of a protein-based ubiquitination, it is characterized in that, containing the encoding gene of ubiquitin-like modified protein be connected and the encoding gene of four cysteine polypeptide labels, the encoding gene of described four cysteine polypeptide labels is positioned at 5 ' end of the encoding gene of described ubiquitin-like modified protein, and the encoding gene of described four cysteine polypeptide labels is 18bp ~ 36bp;

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine.

5. the detection plasmid of protein-based ubiquitination as claimed in claim 4, it is characterized in that, described ubiquitin-like modified protein is SUMO1, SUMO2, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12.

6. the detection plasmid of protein-based ubiquitination as claimed in claim 4, it is characterized in that, described testing protein is Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC _γ1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, CLK4 or Snu66.

7. protein-based ubiquitination detects a preparation method for plasmid, it is characterized in that, comprises the steps:

(1), the pcr amplification template of ubiquitin-like modified protein encoding gene is provided;

(2), the pcr amplification primer of ubiquitin-like modified protein encoding gene is provided, comprise upstream primer and downstream primer, wherein, described upstream primer has the coding gene sequence of four cysteine polypeptide labels, and the coding gene sequence of described four cysteine polypeptide labels is 18bp ~ 36bp;

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine;

(3), the gene template that adopts step (2) the pcr amplification primer that provides and step (1) to provide carries out PCR, increases and obtains the fusion of the ubiquitin-like modified protein of coding-belt four cysteine polypeptide label;

(4), the fusion of gained after amplification is inserted into the multiple clone site of carrier, obtain detecting plasmid, described detection plasmid contains the encoding gene of connected ubiquitin-like modified protein and the encoding gene of four cysteine polypeptide labels, the encoding gene of described four cysteine polypeptide labels is positioned at 5 ' end of described ubiquitin-like modified protein encoding gene, the encoding gene of described four cysteine polypeptide labels is 18bp ~ 36bp

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine.

8. the preparation method of the detection plasmid of protein-based ubiquitination as claimed in claim 7, it is characterized in that, described ubiquitin-like modified protein is SUMO1, SUMO2, SUMO3, SUMO4, NEDD8, FAT10, FUB1, UBL5, ISG15, UFM1, Urm1 or Apg12.

9. the preparation method of the detection plasmid of protein-based ubiquitination as claimed in claim 7, it is characterized in that, described testing protein is Sp100, p53, p73, RanGAP1, PML, HIPK2, c-Jun, Androgen receptor, Mdm2, Topo I, Topo II, WRN, glut4, TDG, Cul-1, Cul-2, Cul-3, Cul-4A, PLC _γ1, JAK1, STAT-1, ERK1, Bcl-G, Mad2, Sp3, PCNA, CLK4 or Snu66.

10. a detection kit for protein-based ubiquitination, is characterized in that, comprises and detects plasmid, testing protein expression plasmid, protein purification reagent, two arsenic fluorochrome label reagent and poly chain polymerization metrization analysis internal reference reagent,

Wherein, described detection plasmid contains the encoding gene of connected ubiquitin-like modified protein and the encoding gene of four cysteine polypeptide labels, the encoding gene of described four cysteine polypeptide labels is positioned at 5 ' end of the encoding gene of described ubiquitin-like modified protein, and the encoding gene of described four cysteine polypeptide labels is 18bp ~ 36bp;

The amino acid sequence of described four cysteine polypeptide labels comprises CCXXCC, and wherein, described C is halfcystine, and described X is the arbitrary amino acid except halfcystine.