CN104745609A - Method for high-flux rapidly cloning of rape draught-resistant gene - Google Patents
Method for high-flux rapidly cloning of rape draught-resistant gene Download PDFInfo
- Publication number
- CN104745609A CN104745609A CN201510123578.0A CN201510123578A CN104745609A CN 104745609 A CN104745609 A CN 104745609A CN 201510123578 A CN201510123578 A CN 201510123578A CN 104745609 A CN104745609 A CN 104745609A
- Authority
- CN
- China
- Prior art keywords
- drought stress
- rape
- library
- drought
- cdna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates to a method for high-flux rapidly cloning of a rape draught-resistant gene. The method comprises the following steps: (1) performing drought stress treatment on a germinal rape seedling, and sampling the whole stalk to obtain a drought stress responded total RNA base; (2) obtaining mRNA and performing inverse transcription to synthesize the double chain cDNA, and constructing a drought stress transcriptome overall length cDNA homogenization library; (3) constructing a drought stress transcriptome overall length cDNA plant expression library; (4) constructing an over-expression rape drought stress transcriptome overall length cDNA arabidopsis mutant library; (5) screening the obtained arabidopsis mutant library by using a high-flux far-infrared thermal imagery technology, and performing drought stress phenotype identification to obtain an over-expression rape drought stress transcriptome arabidopsis transgenic plant; and (6) cloning a rape drought stress response key gene causing the drought stress phenotype from the obtained drought stress arabidopsis transgenic plant. The method is rapid and convenient and the cloning efficiency of the plant drought stress gene is increased.
Description
Technical field
The invention belongs to Cloning Plant Genes and functional study technical field, be specifically related to a kind of method of high-throughput quick clone rape drought-resistance gene.
Background technology
Arid is the most serious for wielding influence of crop yield potentiality.The loss that arid causes is almost the damnous summation of other natural disaster.Therefore, how to increase crop yield by the drought-resistance ability and water use efficiency improving crop, become the great demand of agriculture sustainable high-efficient development.
The susceptibility of staple crops to water stress is as follows: rape, potato > paddy rice > cotton, wheat, soybean > sweet potato > corn > Chinese sorghum, grain.As can be seen here, the drought tolerance of rape is poor in staple crops, very easily suffers arid injury.In recent years along with the climate change in the whole world, arid takes place frequently and degree of drought increases the weight of year by year, seriously governs the development of Rape-seed production.Therefore, the drought resistance using modern biotechnology to improve rape is the important topic in life science always.
The main task of the drought-enduring water saving breeding of crop is exactly be polymerized the beneficial gene be present in different Germplasms, for more improved seeds are cultivated in agriculture production.Research shows, in the Plant Under The Stress cells such as arid, have the expression of thousands of genes to there occurs change simultaneously.Due to the quantitative character that drought resistance in plants is complicated, how from huge genome, screening and cloning goes out the gene relevant to drought resisting, seems particularly important.Traditional gene clone is started with from single-gene, one by one clone and authentication function, and these class methods exist cycle long, the defect such as efficiency is low.
Summary of the invention
The object of the invention is to overcome prior art deficiency, provides a kind of method of high-throughput quick clone rape drought-resistance gene.
For achieving the above object, the present invention adopts following technical scheme:
A method for high-throughput quick clone rape drought-resistance gene, it comprises the steps:
1) carry out drought stress process to the Brassica Napus Seedling sprouted, whole strain sampling after process, CTAB method extracts RNA, obtains the total serum IgE storehouse of drought stress response;
2) purifying total serum IgE storehouse, obtains mRNA and reverse transcription synthetic double chain cDNA, the double-strand cDNA normalized rear clone of synthesis is entered Gateway compatible vector, builds drought stress transcript profile full-length cDNA homogenization library;
3) use high-throughout Gateway technology that above-mentioned cDNA homogenization library clone is entered the plant expression vector of Gateway compatibility, build drought stress transcript profile full-length cDNA expression of plants library;
4) by the electroporated Agrobacterium in cDNA expression of plants library, drought stress transcript profile full-length cDNA Agrobacterium library is obtained; With cDNA Agrobacterium library transformation Arabidopis thaliana, build the Arabidopsis Mutants storehouse of overexpression rape drought stress transcript profile full-length cDNA;
5) use high-throughout Far infra-red hot imaging technique to screen the Arabidopsis Mutants storehouse of aforementioned acquisition, carry out drought resisting coerce phenotypic evaluation to screening the arid related mutants that obtains, obtain the drought resisting Arabidopis thaliana transfer-gen plant of overexpression rape drought stress transcript profile;
6) from the drought resisting Arabidopis thaliana transfer-gen plant obtained, clone the rape responses of drought stress key gene causing drought resisting phenotype proceeded to.
Concrete, the method for above-mentioned high-throughput quick clone rape drought-resistance gene comprises the steps:
1) the total serum IgE storehouse of rape drought stress response is obtained
Drought stress process is carried out to the Brassica Napus Seedling sprouted: after Semen Brassicae campestris sprouts 7 days in 1/2 Hoagland nutritive medium, the Hoagland nutritive medium be placed in containing 20% PEG-6000 processes 3h, 6h, 12h, 24h and 48h, and the gene making to respond drought stress in various degree is as far as possible all expressed.Whole strain sampling after process, CTAB method individual plant extracts RNA, waits a mole mixing, obtains the total serum IgE storehouse of drought stress response.
2) rape drought stress transcript profile full-length cDNA homogenization library is built
The above-mentioned total serum IgE storehouse of paramagnetic particle method purifying, obtains the mRNA that total amount is not less than 5 μ g, and reverse transcription synthetic double chain cDNA.Gateway compatible vector pDONR222 is cloned into by BP reaction after being normalized by the double-strand cDNA of synthesis
tM, be built into rape drought stress transcript profile full-length cDNA homogenization library.PCR and order-checking qualification Library Quality.
3) drought stress transcript profile full-length cDNA expression of plants library is built
The cDNA homogenization Library plasmid built is mixed with the plant expression vector pEarleyGate 100 of Gateway compatibility and carries out LR reaction, obtain the rape transcript profile full-length cDNA expression of plants library of drought stress induction.
4) the transgenic arabidopsis mutant library of overexpression rape drought stress transcript profile full-length cDNA is built
CDNA expression of plants Library plasmid electric shock is proceeded to Agrobacterium GV3101, after PCR qualification, obtains drought stress transcript profile full-length cDNA Agrobacterium library.
Bacterium is shaken at 28 DEG C in the Agrobacterium library of structure cultivate, after OD value reaches 1.8-2.0,4000 rpm normal temperature centrifugation collection bacterium, resuspended with the transfer buffer (MS minimum medium+6-BA 0.01ng/L+ sucrose 5%+Silwet L-77 0.05%, pH=5.8) of two volumes.Silwet L-77 adds mixing before immersion.Use plant original position Flower-dip method arabidopsis thaliana transformation, obtain the Arabidopsis Mutants storehouse of overexpression rape drought stress transcript profile full-length cDNA.
5) the drought resisting Arabidopsis Mutants of overexpression rape drought stress transcript profile is screened
Leaf surface of plant is dispersed with many pores, and the opening and closing of pore can regulate the evaporation of moisture, and the evaporation of moisture can take away heat and then reduce the temperature of blade surface.Far infra-red hot imager can detect this small temperature contrast of blade.Temperature sensitive Far infra-red hot imaging system is utilized to screen the transgenic arabidopsis mutant of drought resisting, and on the plate culture medium containing N.F,USP MANNITOL or ABA, carry out drought resisting phenotypic evaluation further, obtain the transgenic drought-resistant Arabidopsis plant (also referred to as " overexpression Arabidopsis Mutants ") of overexpression rape drought stress transcript profile.
6) separation and analysis of rape drought related gene
Use PCR method from the drought resisting Arabidopsis Mutants filtered out, clone the rape drought stress correlation candidate gene proceeded to, order-checking, and adopt the bioinformatics methods such as comparative genomics to carry out depth analysis and functional annotation, obtain the key function gene of rape drought-resistance.
Present method can be the carrier tool of gene functional research by the model plant Arabidopis thaliana of growth fast, utilize FOX hunting system technology, in conjunction with high-throughout Gateway technology and Far infra-red hot imaging technique, rape drought-resistance functional gene can be obtained from fast high-flux clone full-length genome level in short duration, and overcome the difficulty that traditional loss-of-function mode studies functional redundancy gene.
Compared to the prior art, the beneficial effect of the inventive method:
The inventive method clones the anti-drought gene of rape in full-length genome level, high-throughout Gateway technology is used to combine with FOX hunting system technology, simultaneously in conjunction with the high-throughout Far infra-red hot imaging technique of not damaged, Drought resistance mutant can be filtered out rapidly from FOX mutant library, the cloning efficiency of rape drought-resistance gene is improved greatly.The breeding cycle of rape is long, and only has 6-8 week the breeding time of Arabidopis thaliana.By the channel genes Arabidopis thaliana of rape, be that carrier carries out functional verification analysis with Arabidopis thaliana, greatly can shorten research cycle, accelerate flow of research.Be combined these high-throughout technology, substantially increase the cloning efficiency of Drought-resistant gene of plant, the clone for Drought-resistant gene of plant provides new thinking and countermeasure.
Accompanying drawing explanation
Fig. 1 is that the agarose gel electrophoresis in total serum IgE storehouse detects;
Fig. 2 is the bacterial plaque of coated plate growth after the dilution of homogenization library;
Fig. 3 is homogenization library colony PCR amplification electrophoresis detection figure;
Fig. 4 is that the qPCR of library homogenization degree detects;
Fig. 5 is expression of plants library inserts bacterium colony PCR random detection;
Fig. 6 is the bacterium colony PCR in Agrobacterium library;
Fig. 7 is that PPT (35 mg/L) screens transformation seedlings;
Fig. 8 is the PCR qualification of Arabidopis thaliana transfer-gen plant;
Fig. 9 is that Arabidopis thaliana transgenosis T1 is for plant grouting parameter;
Figure 10 is the drought resisting Arabidopis thaliana transfer-gen plant of Far infra-red hot imaging screening overexpression;
N.F,USP MANNITOL plate carries out drought resistance checking to the drought resisting Arabidopis thaliana transfer-gen plant that far infrared filters out to Figure 11;
ABA plate carries out ABA Resistance Identification to the drought resisting Arabidopis thaliana transfer-gen plant that far infrared filters out to Figure 12;
Figure 13 is the rape drought-resistance gene order comparison result of clone.
Embodiment
The present invention is described further by the following examples, but protection scope of the present invention is not limited thereto.
embodiment 1 obtains the total serum IgE storehouse of rape drought stress response
Drought stress process is carried out to Brassica Napus Seedling: the seed of drought resisting rape self-mating system 07Y17 is sprouted after 7 days in 1/2 Hoagland nutritive medium, the Hoagland nutritive medium be placed in containing 20% PEG-6000 processes 3h, 6h, 12h, 24h and 48h, and the gene making to respond drought stress in various degree is as far as possible all expressed.Whole strain sampling after process, be stored in after quick-frozen in liquid nitrogen-80 DEG C for subsequent use.CTAB method individual plant extracts RNA, the integrity (the results are shown in Figure 1) of electrophoresis detection RNA, and purity and the content of RNA is detected with Thermo nanodrop foranalysis of nucleic acids instrument, make the value of A260/A280 about 2.0, this value of testing the A260/A280 of 4 groups of samples is 2.17-2.18.To mole mixing such as the individual plant RNA of the process of drought stress in various degree obtained be extracted, obtain the total serum IgE storehouse of drought stress response.
embodiment 2 builds rape drought stress transcript profile full-length cDNA homogenization library
The above-mentioned total serum IgE storehouse of paramagnetic particle method purifying, obtains the mRNA that total amount is not less than 5 μ g, and reverse transcription synthetic double chain cDNA.The double-strand cDNA of synthesis is normalized rear clone and enters Gateway compatible vector, be built into rape drought stress transcript profile homogenization cDNA library.
The structure in cDNA homogenization library mainly comprises: the synthesis of cDNA first chain, the first chain cDNA of zone of enrichment 5 ' cap sequence, add the step such as synthesis, cDNA hybridization, homogenization process, BP restructuring, electroporated intestinal bacteria DH10B, Library Quality judgement of 5 ' joint, cDNA second chain, specifically can refer to Superscript Full length library construction kit II (Invitrogen) specification sheets and carries out.After building library, as follows judgement is detected to Library Quality.
1), library storage capacity qualification
Being calculated as follows of storage capacity:
Transform library bacterium liquid cumulative volume 3mL, wherein 1mL draws 50 μ L coated plates after diluting 100 times, and 37 DEG C of incubated overnight grow 67 bacterial plaque (see figure 2)s altogether, therefore:
The cfu/ml(plating dilutions degree 1:100 of transformation plate):
CFU/ml= 67/50uL ×100 × 1000uL=1.3×10
5cfu/mL
Total clone's number CFU=1.3 × 10
5cfu/mL × 3mL=4.0 × 10
5cfu.
2), recombination fraction and the qualification of Insert Fragment length
Above-mentioned bacterium colony is (primer: M13F:GTAAAACGACGGCCAG, M13R:CAGGAAACAGCTATGAC after pcr amplification object fragment; PCR; Amplification condition: 95 DEG C of 3min; 95 DEG C of 40s, 58 DEG C of 50s, 72 DEG C of 2min, 30 circulations; 72 DEG C of 10min), carry out electrophoresis detection, the results are shown in Figure 3 and table 1.The result of Fig. 3 and table 1 shows: minimum 0.9 kb of length of object fragment is inserted in library, maximum 3kb, average 1.4kb.Each bacterium colony amplifies object fragment, recombination fraction 100%.
3), the qPCR of library homogenization degree detects
The library built is next step arabidopsis thaliana transformation, and the transcript profile cDNA of rape is all expressed in Arabidopis thaliana, obtains the transgenic arabidopsis mutant library of the whole transcript profile cDNA of overexpression rape.If do not carry out homogenization process, so the ratio be cloned in library of high expression level is very large, and the ratio of gene in library that low abundance is expressed is less, makes the Arabidopsis Mutants storehouse of subsequent builds also unbalanced, so must carry out homogenization process.
After homogenization process, (the quantitative PCR kit SYBR Premix Ex TaqTM specification sheets that concrete grammar can refer to the precious biotech firm in Dalian carries out to use qPCR to detect homogenization degree, primer: Bn-actinF:GCTGACCGTATGAGCAAAGA, Bn-actin-R:CACGAACCAGAAGGCAGAAA.Pcr amplification condition: 95 DEG C of 1min; 95 DEG C of 15s, 63 DEG C of 20s, 72 DEG C of 1min, 23 circulations; 72 DEG C of 5min), find the gene (Gene Name: Brassica napus actin of constitutive expression, the GenBank number of including: KM881429) after homogenization process, reduce 64 times (see Fig. 4 and table 2) than before process, be enough to make in library, to reach equilibrium state with low abundance gene.
embodiment 3 builds drought stress transcript profile full-length cDNA expression of plants library
Use high-throughout Gateway technology that above-mentioned cDNA normalization method library clone is entered the plant expression vector pEarleyGate100 of Gateway compatibility, build the rape transcript profile full-length cDNA expression of plants library of drought stress induction, specific as follows:
Extract above-mentioned homogenization Library plasmid, LR reaction is carried out by the mol ratio of 1:1 and the plant expression vector pEarleyGate100 of Gateway compatibility, carry out with reference to Gateway LR Clonase enzyme mix kit (Invitrogen) specification sheets, rape cDNA target fragment in homogenization Library plasmid is transferred in plant expression vector pEarleyGate100, is built into the rape transcript profile full-length cDNA expression of plants library of drought stress induction.
LR reaction product transformation of E. coli, the upper 37 DEG C of incubated overnight screening of resistance solid medium (LB substratum+15g/L agar+50mg/L kantlex), random choose mono-clonal carries out bacterium colony PCR qualification (primer: PatF:GTAAAACGACGGCCAG, PatR:CAGGAAACAGCTATGAC; Pcr amplification condition: 95 DEG C of 3min; 95 DEG C of 40s, 58 DEG C of 50s, 72 DEG C of 2min, 30 circulations; 72 DEG C of 10min).In order to ensure that each object fragment can both be cloned into carrier, the bacterial plaque number after conversion at least should be more than 10 times of goal gene number, namely clones number and reaches 10
5above.PCR result shows, library inserts is randomly dispersed in (see figure 5) between 0.5kb to 3kb, and the cDNA of most gene comprises transcription factor gene length within the scope of this, shows that the structure of expression library is successful.
embodiment 4 builds the transgenic arabidopsis mutant library of overexpression rape drought stress transcript profile full-length cDNA
Above-mentioned LR reaction is transformed the E. coli clones grown afterwards all elute, in 37 DEG C, 220 rpm shaking culture (LB substratum+50mg/L kantlex), plasmid is extracted with reference to TaKaRa plasmid extraction kit specification sheets method, electroporated Agrobacterium GV3101(conversion condition: 2.5KV, 5ms), the upper 28 DEG C of incubated overnight screening of resistance YEP solid medium (YEP substratum+15g/L agar+50mg/L kantlex+50mg/L Rifampin).In order to the full gene enabling the Agrobacterium library of acquisition cover the structure in intestinal bacteria library, to ensure that the single colony count of Agrobacterium transformed is greater than 10 equally
5above.Each culture dish random choose 48 single bacterium colonies carry out PCR qualification (primer: attB1:GTAAAACGACGGCCAG, attB2:CAGGAAACAGCTATGAC; Pcr amplification condition: 95 DEG C of 3min; 95 DEG C of 40s, 58 DEG C of 50s, 72 DEG C of 2min, 30 circulations; 72 DEG C of 10min), electrophoresis result is single bright band, and the size of band is randomly distributed in (see figure 6) between 0.5-3kb.All Agrobacterium bacterium colonies are eluted, in 28 DEG C, 220 rpm shaking culture (YEP substratum+50mg/L kantlex+50mg/L Rifampin) are about 1.0 to OD value, form Agrobacterium library, save backup
.
Bacterium is shaken at 28 DEG C in the Agrobacterium library of preservation and cultivates (YEP substratum+50mg/L kantlex+50mg/L Rifampin), after OD value reaches 1.8-2.0, the centrifugal 10 min collection bacterium of 4000 rpm room temperatures, abandon supernatant, the transfer buffer (MS minimum medium+6-BA 0.01ng/L+ sucrose 5%, pH=5.8) of precipitation two volumes is resuspended.Add 0.05% Silwet L-77 mixing before using and be mixed with conversion fluid.
With wild-type Col-0 Arabidopis thaliana for material, use the above-mentioned conversion fluid arabidopsis thaliana transformation of Flower-dip method, after maturation, gather in the crops seed (T
0generation).T
0for seed drying and Aging storage, after 3 days in 4 DEG C of vernalization, be evenly sprinkled upon and fill in the pallet of Nutrition Soil.When seedling sprouts and grows two panels cotyledon, start spraying herbicide grass fourth phosphine (Phosphinothricin, PPT, 35 mg/L), sprayed 1 time every 1 day, spray 3 times continuously.Transform successful plant and there is PPT resistance energy normal growth, and unconverted plant leaf albefaction, cessation of growth cessation, until dead (see figure 7).Screen through PPT the plant extraction leaf DNA survived and carry out PCR qualification, to determine that rapeseed gene is transferred to (see figure 8) in arabidopsis gene group really further.More than 30 ten thousand strain transformed plants are obtained altogether, mixed sowing (T after ripe through above-mentioned screening
1in generation, see Fig. 9), namely form the transgenic arabidopsis mutant library of overexpression rape drought stress transcript profile full-length cDNA.
embodiment 5 screens the drought resisting Arabidopsis Mutants of overexpression rape drought stress transcript profile
The transgenic arabidopsis mutation library T1 of overexpression rape drought stress transcript profile full-length cDNA, for seed drying and Aging storage, after 4 DEG C of placements carry out vernalization treatment in 3 days, evenly sows in the pallet that Nutrition Soil is housed.Treat that seedling sprouts and grows to the 3-4 leaf phase to stop watering and carrying out drought stress process, when soil moisture content drops to below 8%, by Far infra-red hot imager monitoring seedling leaves temperature.The plant of blade face temperature high (see figure 10) shows that leaves water loss is slow, and blade water retention capacity is strong, i.e. drought resisting.The plant of the Ye Wengao filtered out is further containing N.F,USP MANNITOL (20%) or ABA(1 μm of ol/L) MS substratum on carry out physiological identification of drought resistance.The long-living length of root affects less by N.F,USP MANNITOL or ABA, and the plant that namely cotyledon keeps green, the long comparison illumination of root shows length is drought resisting plant (see Figure 11, Figure 12).
Through above-mentioned screening, blade face temperature obviously increases, in screening culture medium cotyledon keep green, root kept burning day and night aobvious be greater than adjoining tree be the drought resisting Arabidopsis plant turning rapeseed gene, the expression of this gene obviously can strengthen the drought resistance of plant.
the separation and analysis of embodiment 6 rape drought related gene
According to the recombination site primers (PatF:GTAAAACGACGGCCAG, PatR:CAGGAAACAGCTATGAC) at gene two ends during structure plant expression vector, pcr amplification (95 DEG C of 3min; 95 DEG C of 40s, 58 DEG C of 50s, 72 DEG C of 2min, 30 circulations; 72 DEG C of 10min) target gene that proceeds in the above-mentioned drought resisting plant screened checking order.Sequencing result, through information biology compare of analysis, annotates target gene in conjunction with above-mentioned drought resisting phenotype and physiologic result, obtains the anti-drought gene (Figure 13) of rape.Sequence alignment result shows, the application is cloned into wherein a sequence and Chinese cabbage peroxidase 12(Brassica rapa peroxidase 12) gene order similarity reaches 98%, and with Arabidopis thaliana peroxidase 12(Arabidopsis thaliana peroxidase 12) gene order similarity reaches 88%.Arabidopis thaliana peroxidase 12 gene participates in active oxygen (reactive oxygen species) metabolic process, and then affects the drought resistance of plant.
Claims (1)
1. a method for high-throughput quick clone rape drought-resistance gene, is characterized in that, comprise the steps:
1) carry out drought stress process to the Brassica Napus Seedling sprouted, whole strain sampling after process, CTAB method extracts RNA, obtains the total serum IgE storehouse of drought stress response;
2) purifying total serum IgE storehouse, obtains mRNA and reverse transcription synthetic double chain cDNA, the double-strand cDNA normalized rear clone of synthesis is entered Gateway compatible vector, builds drought stress transcript profile full-length cDNA homogenization library;
3) use high-throughout Gateway technology that above-mentioned cDNA homogenization library clone is entered the plant expression vector of Gateway compatibility, build drought stress transcript profile full-length cDNA expression of plants library;
4) by the electroporated Agrobacterium in cDNA expression of plants library, drought stress transcript profile full-length cDNA Agrobacterium library is obtained; With cDNA Agrobacterium library transformation Arabidopis thaliana, build the Arabidopsis Mutants storehouse of overexpression rape drought stress transcript profile full-length cDNA;
5) use high-throughout Far infra-red hot imaging technique to screen the Arabidopsis Mutants storehouse of aforementioned acquisition, carry out drought resisting coerce phenotypic evaluation to screening the arid related mutants that obtains, obtain the drought resisting Arabidopis thaliana transfer-gen plant of overexpression rape drought stress transcript profile;
6) from the drought resisting Arabidopis thaliana transfer-gen plant obtained, clone the rape responses of drought stress key gene causing drought resisting phenotype proceeded to.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510123578.0A CN104745609A (en) | 2015-03-20 | 2015-03-20 | Method for high-flux rapidly cloning of rape draught-resistant gene |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201510123578.0A CN104745609A (en) | 2015-03-20 | 2015-03-20 | Method for high-flux rapidly cloning of rape draught-resistant gene |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104745609A true CN104745609A (en) | 2015-07-01 |
Family
ID=53585866
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201510123578.0A Pending CN104745609A (en) | 2015-03-20 | 2015-03-20 | Method for high-flux rapidly cloning of rape draught-resistant gene |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104745609A (en) |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106226349A (en) * | 2016-07-08 | 2016-12-14 | 上海大学 | Continuous component many screening plants of bulk high flux based on infrared thermal imaging and method |
CN106546569A (en) * | 2016-10-31 | 2017-03-29 | 浙江大学 | A kind of screening technique and device of high-throughout plant drought resistance mutant |
CN110387377A (en) * | 2019-09-10 | 2019-10-29 | 河南大学 | Rape Drought-tolerant gene BnNAC129 and its application for being used to prepare drought-enduring genetically modified plants |
CN111781150A (en) * | 2020-06-10 | 2020-10-16 | 华中农业大学 | Method for identifying corn drought-resistant gene by hyperspectral technology |
CN114807222A (en) * | 2022-06-16 | 2022-07-29 | 郑州大学 | Application of Bra040707 gene of brassica campestris in drought stress |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008020645A1 (en) * | 2006-08-14 | 2008-02-21 | Riken | Early-maturing transformed plant |
WO2011018662A1 (en) * | 2009-08-11 | 2011-02-17 | Plant Bioscience Limited | Stress tolerant plants |
CN103849638A (en) * | 2014-02-21 | 2014-06-11 | 江苏省农业科学院 | Plasmid vector for constructing and screening cDNA (complementary deoxyribonucleic acid) library and construction method and application of plasmid vector |
-
2015
- 2015-03-20 CN CN201510123578.0A patent/CN104745609A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2008020645A1 (en) * | 2006-08-14 | 2008-02-21 | Riken | Early-maturing transformed plant |
WO2011018662A1 (en) * | 2009-08-11 | 2011-02-17 | Plant Bioscience Limited | Stress tolerant plants |
CN103849638A (en) * | 2014-02-21 | 2014-06-11 | 江苏省农业科学院 | Plasmid vector for constructing and screening cDNA (complementary deoxyribonucleic acid) library and construction method and application of plasmid vector |
Non-Patent Citations (5)
Title |
---|
HIGASHI Y等: "HsfA1d, a protein identified via FOX hunting using Thellungiella salsuginea cDNAs improves heat tolerance by regulating heat-stress-responsive gene expression", 《MOL PLANT》 * |
MIKI FUJITA等: "Identification of stress-tolerance-related transcription-factor genes via mini-scale Full-length cDNA Over-eXpressor (FOX) gene hunting system", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
TAKANARI ICHIKAWA等: "The FOX hunting system: an alternative gain-of-function gene hunting technique", 《THE PLANT JOURNAL》 * |
刘亚: "远红外成像技术在植物干旱响应机制研究中的应用", 《中国农学通报》 * |
刘亚运: "转小麦转录因子基因水稻的获得及其抗逆性筛选分析", 《中国优秀硕士学位论文全文数据库》 * |
Cited By (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106226349A (en) * | 2016-07-08 | 2016-12-14 | 上海大学 | Continuous component many screening plants of bulk high flux based on infrared thermal imaging and method |
CN106226349B (en) * | 2016-07-08 | 2020-04-03 | 上海大学 | Continuous component block high-flux multi-field screening device and method based on infrared thermal imaging |
CN106546569A (en) * | 2016-10-31 | 2017-03-29 | 浙江大学 | A kind of screening technique and device of high-throughout plant drought resistance mutant |
CN106546569B (en) * | 2016-10-31 | 2019-10-15 | 浙江大学 | A kind of screening technique and device of the plant drought resistance mutant of high throughput |
CN110387377A (en) * | 2019-09-10 | 2019-10-29 | 河南大学 | Rape Drought-tolerant gene BnNAC129 and its application for being used to prepare drought-enduring genetically modified plants |
CN110387377B (en) * | 2019-09-10 | 2020-07-10 | 河南大学 | Rape drought-tolerant gene BnNAC129 and application thereof in preparing drought-tolerant transgenic plants |
CN111781150A (en) * | 2020-06-10 | 2020-10-16 | 华中农业大学 | Method for identifying corn drought-resistant gene by hyperspectral technology |
CN111781150B (en) * | 2020-06-10 | 2021-12-10 | 华中农业大学 | Method for identifying corn drought-resistant gene by hyperspectral technology |
CN114807222A (en) * | 2022-06-16 | 2022-07-29 | 郑州大学 | Application of Bra040707 gene of brassica campestris in drought stress |
CN114807222B (en) * | 2022-06-16 | 2023-08-22 | 郑州大学 | Application of cabbage type rape Bra040707 gene in drought stress |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Liu et al. | High-efficiency thermal asymmetric interlaced PCR for amplification of unknown flanking sequences | |
CN104745609A (en) | Method for high-flux rapidly cloning of rape draught-resistant gene | |
CN108368515A (en) | Drought tolerant corn | |
CN108660140B (en) | Application of SlSL4 gene in regulation and control of tomato fruit ripening | |
Chai et al. | FaABI4 is involved in strawberry fruit ripening | |
CN109609527A (en) | CDPK18L gene is improving the application in tomato bacterial leaf spot resistance and high temperature resistance as negative regulatory factor | |
CN110468150B (en) | Application of RGS1 gene as negative regulatory factor in improving tomato bacterial leaf spot resistance in low-irradiation environment | |
Kuczyński et al. | Chilling stress tolerance of two soya bean cultivars: Phenotypic and molecular responses | |
CN101974550B (en) | RNA (Ribonucleic Acid) interference carriers of RSV (Rice Stripe Virus) and RBSDV (Rice Black-Streaked Dwarf Virus) as well as construction method and application thereof | |
CN102358904B (en) | Arabidopsis thaliana WRKY57 gene and preparation method and application in improving crop drought resistance thereof | |
CN103194449A (en) | Soybean micro RNA (ribonucleic acid) gene gma-miR169d and application thereof in drought control | |
CN110904106B (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
AU2018242633A1 (en) | Methods for improving traits in plants | |
CN102618556B (en) | Pepper CaCOI1.2 gene, recombinant expression vector and application thereof | |
CN110607307A (en) | Sedum lineare salt-tolerant gene SlNAC and application thereof | |
CN109867716A (en) | Wax plum CpVIN3 gene and its application | |
CN108795927A (en) | The clone of common wheat gene TaSPX3 coded sequences and its application | |
CN103320450A (en) | Blade ageing and stress resistance related gene and application thereof | |
CN104630237B (en) | A kind of appropriateness delays plant senescence and the fusion for improving stress resistance and its application | |
CN104059931A (en) | RNA interference vector of bactrocera dorsalis cytochrome P450 genes and construction method and application thereof | |
CN104498512A (en) | Application of arabidopsis calcium ion-dependent protein kinase gene AtGPK1 in regulation and control of stomatal movement and plant drought resistance | |
CN115894643B (en) | Sorghum salt and alkali tolerance related gene AT1 and application thereof in crop salt and alkali tolerance | |
CN104059938A (en) | RNA interference vector of bactrocera dorsalis sodium ion channel genes and construction method and application thereof | |
CN116121298B (en) | Application of inhibiting expression of HSRP1 gene in improving heat resistance of plants | |
CN110964724B (en) | Application of cymbidium goeringii miR390c in enhancing cold resistance of plants |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150701 |
|
RJ01 | Rejection of invention patent application after publication |