CN104744592A - Anti-HER2-anti-CD3 scFv bispecific tetravalent antibody - Google Patents
Anti-HER2-anti-CD3 scFv bispecific tetravalent antibody Download PDFInfo
- Publication number
- CN104744592A CN104744592A CN201410820733.XA CN201410820733A CN104744592A CN 104744592 A CN104744592 A CN 104744592A CN 201410820733 A CN201410820733 A CN 201410820733A CN 104744592 A CN104744592 A CN 104744592A
- Authority
- CN
- China
- Prior art keywords
- her2
- special
- target
- tetravalent antibody
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention relates to an anti-HER2-anti-CD3 scFv bispecific tetravalent antibody. Specifically, the invention relates to the bispecific tetravalent antibody comprising anti-HER2 IgG, a junction fragment and anti-CD3 scFv. The anti-CD3 scFv is connected to the C terminal of the anti-HER2 IgG through the junction fragment. The bispecific tetravalent antibody provided by the invention has 2 zones combined with HER2 antigen, 2 zones combined with CD3 antigen, and a humanized Fc fragment. Therefore, immunogenicity is greatly reduced. The antibody can be produced with a simple eukaryotic cell expression system, and production is convenient.
Description
Technical field
The present invention relates to a kind of two special tetravalent antibody, specifically, the present invention relates to the antibody of target CD3 and HER2 simultaneously, more specifically, the present invention relates to the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv.
Background technology
Mammary cancer is all a kind of fatal disease all the time, transfers to corresponding survival time when Cumulative survival rate is 50% be only 17 to 20 months (Piccart M.Anticancer Drugs, 7:5-7,1996) from Late Cambrian.Some hormones, cytotoxin or other biological preparation is had to show certain effect in the expectant treatment of mammary cancer, but the mammary cancer standard regimens of not consistent accreditation up to now, and common treatment plan all can bring serious side reaction (Bernard Marty C, Deng people, Oncologist, 9:617-632,2004).
In twentieth century eighties, Denis Slamon finds HER2 (human epidermal growth factor receptor 2) gene excessive amplification in the case of 30% first in 189 primary breast cancer cases, and show closely related (the Salman DJ of HER2 and total survival rate and recurrence time, Deng people, Science, 235:177-182,1985).Current research shows, HER2 in the breast cancer patients of about 25 ~ 30% is process LAN (Revillion F, Deng people, Eur J Cancer, 34:791-808,1998), and it is relevant to the malignancy degree of tumour, and (Wright C, waits people, Cancer Res, 49:2087-2090,1989).
Herceptin (Trastuzumab) is the Humanized monoclonal antibodies (Carter P, waits people, PNAS, 89 (10): 4285-4289,1992) of an anti-HER2 extracellular region.But its antitumous effect in clinical application does not often have preclinical laboratory so good, so usually need and the drug combination (Slamon DJ, waits people, N Engl J Med, 344:783-792,2001) such as chemotherapeutic.
Designing a kind of bifunctional antibody can raising effector cell is the effective means improving antibody usefulness.So far, most study is the function utilizing CD3 molecule.By CD3 molecule, killer T cell is activated, effectively can remove object tumour (Haas C, waits people, Immunobiology, 214:441-453,2009).Wherein a kind of recombination double functions T cell agonistic antibodies of Micormet company exploitation is BiTE, have good prospect, but its maximum problem is that plasma half-life is very short, the human body transformation period is only 1 hour (Loffler A, Deng people, Blood, 95:2098-2103).This is caused by the structure of BiTE itself, and it is made up of two single chain antibody fragments, and molecular weight is 60kDa only, and lacked in antibody molecule the Fc fragment that prolong half-life plays an important role.
Blocking appropriate rope monoclonal antibody (Catumaxomab) is the promising multipurpose antibody of another kind of tool, it is the heterozygosis Ig molecule of a kind of target CD3 and EpCAM, this product has been approved for treatment (the Jager M of ascites carcinoma at present, Deng people, Cancer Res, 72:24-32,2012).The multipurpose antibody that another kind is in the clinical second phase is appropriate rope monoclonal antibody (Ertumaxomab) in distress, its target CD3 and HER2.A heavy chain of this hybrid antibody and light chain derive from the IgG of rat, target CD3; Another heavy chain and light chain derive from the IgG of mouse, target HER2.The problem brought therefrom is exactly that the production of this product is very difficult, because, in order to obtain the clone expressing the appropriate rope antibody of difunctional strategic point, first the diploid hybrid knurl that CD3 antibody is expressed in a strain will be obtained, and one strain express the diploid hybrid knurl of HER2 antibody, then again hybridized by two strain hybridomas, obtain Tetraploid knurl, it can express the bifunctional antibody of AntiCD3 McAb and HER2.And produce the antibody of common single target spot, only need acquisition one strain diploid hybrid knurl, in comparison, the production process of bifunctional antibody is more complicated, and the acquisition of Tetraploid knurl is more difficult, and due to the source in its mouse source, cause its immunogenicity very high.
Therefore, this area needs a kind of humanized and can high target specifically kill the tumour cell of expressing HER2, the bifunctional antibody of the tumour cell of especially low expression HER2.
Summary of the invention
Therefore, technical purpose of the present invention is to provide and utilizes CD3 molecule to raise the activity of effector cell thus the bifunctional antibody of enhancing HER2 specific killing activity of tumor cells.
Therefore, a first aspect of the present invention relates to a kind of two special tetravalent antibody, it comprises a kind of protein function district of target first antigen HER2 and the protein function district of a kind of target second antigens c D3, and wherein the protein function district of target second antigens c D3 is connected to the C end in the protein function district of target first antigen HER2.
In certain embodiments, the protein function district of described target second antigens c D3 is connected to the C end in the protein function district of target first antigen HER2 by junction fragment.
In certain embodiments, the protein function district of described target first antigen HER2 is immunoglobulin (Ig) or its modifier, function equivalent, function fragment or the variant of target HER2, in certain embodiments, the immunoglobulin (Ig) of target first antigen HER2 is IgG, IgA, IgD, IgE, IgM antibody or their heterozygote, in certain embodiments, the immunoglobulin (Ig) of target first antigen HER2 is IgG antibody.
In certain embodiments, described immunoglobulin (Ig) is immunoglobulin (Ig) that is chimeric, humanized or total man.
In certain embodiments, the protein function district of target second antigens c D3 is immunoglobulin (Ig) or its modifier, function equivalent, function fragment or the variant of target CD3, in certain embodiments, the protein function district of target second antigens c D3 is scFv or Fab of target CD3.
In certain embodiments, described scFv or Fab is scFv or Fab that be chimeric, humanized or total man.
In certain embodiments, described junction fragment length is 5-30 amino acid, and in certain embodiments, described junction fragment length is 15 amino acid, and in certain embodiments, the sequence of described junction fragment is GGGGSGGGGSGGGGS.
In certain embodiments, described two special tetravalent antibody is made up of anti-HER2 IgG-junction fragment-AntiCD3 McAb scFv, in certain embodiments, described two special tetravalent antibody is made up of two light chains comprising SEQ ID No:1 and two heavy chains comprising SEQ ID No:3.
In certain embodiments, described light chain and heavy chain are respectively and are substituted, lack or add one or more amino acid and derived by SEQ ID No:1 and SEQ ID No:3 and height target kill the sequence of malignant cell expressing HER2 specifically, or have at least about 70% identity with the sequence shown in SEQ ID No:1 and No:3 and high target specifically kill the aminoacid sequence of the malignant cell of expressing HER2.In certain embodiments, described light chain and heavy chain are respectively and have with the sequence shown in SEQ ID No:1 and No:3 at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6% identity and high target specifically kill the aminoacid sequence of the malignant cell of expressing HER2.
Second aspect present invention relates to the nucleic acid sequence encoding of two special tetravalent antibody as above.
In certain embodiments, described nucleic acid sequence encoding is for comprising the sequence of sequence shown in SEQ ID No:2 and No:4 respectively.
A third aspect of the present invention relates to a kind of carrier comprising effectively connection nucleic acid sequence encoding as above wherein.
In certain embodiments, the nucleotide sequence of light chain and heavy chain of encoding in described carrier is present in different expression cassettes.
In certain embodiments, described carrier is eukaryotic expression vector, and in certain embodiments, described carrier is the carrier Y0GC through transformation with two expression cassettes.
A fourth aspect of the present invention relates to a kind of to transform or transfection has the host cell of carrier as above.
A fifth aspect of the present invention relates to a kind of pharmaceutical composition, and it comprises two special tetravalent antibodies as above and pharmaceutically acceptable carrier.
A sixth aspect of the present invention relates to a kind of method of producing two special tetravalent antibody, and it cultivates host cell as above under being included in suitable expression of polypeptides condition, and the two special tetravalent antibody of separation from cell culture medium, purifying expression.
A seventh aspect of the present invention relates to the purposes of two special tetravalent antibody as above in the medicine of the disease expressed by HER2 for the preparation of prevention or treatment and cause, in certain embodiments, described disease is malignant tumour, in certain embodiments, described malignant tumour is selected from mammary cancer, cancer of the stomach, the rectum cancer, in certain embodiments, described malignant tumour is selected from mammary cancer.
A eighth aspect of the present invention relates to a kind of method suppressing or treat malignant tumour, comprise the pharmaceutical composition as above giving to treat effective dose, in certain embodiments, described malignant tumour is selected from mammary cancer, cancer of the stomach, the rectum cancer, in certain embodiments, described malignant tumour is selected from mammary cancer.
A ninth aspect of the present invention relates to two special tetravalent antibody as above, it is expressed by HER2 and the disease caused for preventing or treating, in certain embodiments, described disease is malignant tumour, in certain embodiments, described malignant tumour is selected from mammary cancer, cancer of the stomach, the rectum cancer, and in certain embodiments, described malignant tumour is selected from mammary cancer.
The present invention has following several respects advantage:
(1) structural representation of the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv of the present invention as shown in fig. 1.1. 2. the structure of this antibody has two regions be combined with HER2 antigen, and two regions be combined with CD3 antigen 3. 4.; And apply the structure of the appropriate rope monoclonal antibody of strategic point that Tetraploid knurl produces as shown in the B figure of Fig. 1,5. the antibody structure of this heterozygosis only has a region be combined with HER2 antigen, and a region be combined with CD3 antigen is 6..The antigen of antibody of the present invention combines and tires is 2 times of appropriate rope monoclonal antibody in distress.
(2) structure of antibody of the present invention comprises Fc fragment, is humanization product, and the Fc fragment of appropriate rope monoclonal antibody in distress is rat fragment and mouse fragment hybridizes and formed, and immunogenicity is high far away, and product of the present invention will reduce the immunogenicity of product widely.
(3) antibody of the present invention can adopt easy eukaryotic cell expression system to produce, and uses stable monoclonal cell system to express antibody, and production technique and product are stablized; The appropriate rope monoclonal antibody of strategic point uses Tetraploid knurl to produce, the acquisition difficulty of Tetraploid knurl, and can not stablize Secondary Culture, brings inconvenience to production.
(4) purifying process of antibody of the present invention is easy, and described antibody goes out the product of single structure at cells; And the product that the Tetraploid knurl that appropriate rope monoclonal antibody in distress adopts gives expression to, because it contains two kinds of heavy chains, two kinds of light chains, therefore form the product that required heavy and light chain correctly matches and only account for 1/10th of gross product, and downstream purification is very difficult, and low yield.
Accompanying drawing explanation
The structure iron of Fig. 1: A: anti-HER2-AntiCD3 McAb scFv two special tetravalent antibody, B: the structure of appropriate rope monoclonal antibody in distress.
Fig. 2: Y0GC-anti-HER2-AntiCD3 McAb scFv plasmid figure.
Fig. 3: anti-HER2-AntiCD3 McAb scFv two special tetravalent antibody purifying schema.
Elution profile during Fig. 4: anti-HER2-AntiCD3 McAb scFv two special tetravalent antibody rProtein A affinity chromatography purifying.
Elution profile during Fig. 5: anti-HER2-AntiCD3 McAb scFv two special tetravalent antibody anion-exchange chromatography purifying.
Elution profile during Fig. 6: anti-HER2-AntiCD3 McAb scFv two special tetravalent antibody gel exclusion chromatography chromatogram purification
The stability of Fig. 7: anti-HER2-AntiCD3 McAb scFv two special tetravalent antibody
Fig. 8: the FACS antigen-binding activity detecting the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv; Wherein scheme A, B and use SK-OV-3 cell and Jurkat cell respectively.
The cytotoxicity result of Fig. 9: anti-HER2-AntiCD3 McAb scFv two special tetravalent antibody; Wherein scheme A, B, C use SK-BR-3 cell (effector cell effector cell (E) respectively, tumour cell tumor cell (T), E/T=20:1), N87 cell (E/T=20:1), HCT-8 cell (E/T=5:1).
Figure 10: the anti-HER2-AntiCD3 McAb scFv two blood concentration-time curve of special tetravalent antibody in BALB/c mouse body.
Figure 11: the anti-HER2-AntiCD3 McAb scFv two anti-tumor activity of special tetravalent antibody on NOD/SCID mouse xenografts people cancer of the stomach NCl-N87 tumor model.
Embodiment
One object of the present invention is to provide a kind of two special tetravalent antibody, and it comprises a kind of protein function district of target first antigen HER2 and the protein function district of a kind of target second antigens c D3.The protein function district of target first antigen HER2 is effectively connected with the protein function district of target second antigens c D3, keeps its respective space structure and plays its respective physiologically active.The protein function district of described target first antigen HER2 and the protein function district of target second antigens c D3 can when do not affect its separately function directly merge, and the protein function district of target second antigens c D3 is connected to the C end in the protein function district of target first antigen HER2, also other intervening sequence can be added betwixt, as junction fragment.
Those skilled in the art know, although the present invention's qualifier used when limiting described two special tetravalent antibody is " comprising ", it does not also mean that and can add arbitrarily other sequences incoherent with its function in described two special tetravalent antibody.The fusion rotein preparing complicated composition as described in two special tetravalent antibody time, in order to ensure the space structure of each moiety of fusion rotein, biological activity, and in order to by suitable the merging of described various component, or in order to strengthen the resistant to hydrolysis ability of described fusion rotein, those skilled in the art are when preparing described fusion rotein, can as required between each component or the two ends of described fusion rotein add one or more extra amino-acid residue, therefore, if limit described two special tetravalent antibody with enclosed statement can not cover these situations truly.
" two special " in term used herein " two special tetravalent antibody " refers to simultaneously selectively targeted two kinds of different antigens, described two kinds of different antigens are HER2 and CD3 respectively in the present invention, in certain embodiments, described HER2 and CD3 refers to HER2 and CD3 of Mammals as primate, in certain embodiments, described HER2 and CD3 refers to people HER2 and CD3; " tetravalence " refer to described antibody have four from the binding ability of described two kinds of different antigens, in certain embodiments, described antibody have respectively two with the binding ability of described HER2 and two binding ability with described CD3.
Term used herein " the protein function district of target first antigen HER2 " refers to the protein fragments with HER2 specific binding, as the immunoglobulin (Ig) of target HER2 or the native ligand of target HER2, in certain embodiments, the protein function district of described target first antigen HER2 is immunoglobulin (Ig) or its modifier, function equivalent, function fragment or the variant of target HER2.In certain embodiments, the immunoglobulin (Ig) of target first antigen HER2 is IgG, IgA, IgD, IgE, IgM antibody or their heterozygote, and in certain embodiments, the immunoglobulin (Ig) of target first antigen HER2 is IgG antibody.In certain embodiments, described immunoglobulin (Ig) is immunoglobulin (Ig) that is chimeric, humanized or total man.In certain embodiments, described modifier can be chemical modification object, as acylations, alkylation, PEGization product, as long as these modifiers remain the ability of target HER2.In certain embodiments, described function equivalent refers to and can realize described immunoglobulin (Ig) target other polypeptide fragments in conjunction with HER2 ability.In certain embodiments, described function fragment refers to the protein fragments of the ability remaining target HER2, as single structure domain antibodies, single-chain antibody, single chain variable fragment (scFv), Fab fragment or F (ab ') 2 fragments.In certain embodiments, described variant refers to by the one or more changes in one or more (several) position, the polypeptide namely replacing, insert and/or lack and derive from Parent Protease.
In certain embodiments, term used herein " the protein function district of target second antigens c D3 " refers to immunoglobulin (Ig) or its modifier, function equivalent, function fragment or the variant of target CD3.In certain embodiments, the protein function district of target second antigens c D3 is scFv or Fab of target CD3.In certain embodiments, described scFv or Fab is scFv or Fab that be chimeric, humanized or total man.In certain embodiments, described modifier can be chemical modification object, as acylations, alkylation, PEGization product, as long as these modifiers remain the ability of target CD3.In certain embodiments, described function equivalent refers to and can realize described immunoglobulin (Ig) target other polypeptide fragments in conjunction with CD3 ability.In certain embodiments, described function fragment refers to the protein fragments of the ability remaining target CD3, as single structure domain antibodies, single-chain antibody, single chain variable fragment (scFv), Fab fragment or F (ab ') 2 fragments.In certain embodiments, described variant refers to by the one or more changes in one or more (several) position, the polypeptide namely replacing, insert and/or lack and derive from Parent Protease.
In certain embodiments, described junction fragment length is 5-30 amino acid, and in certain embodiments, described junction fragment length is 15 amino acid, and in certain embodiments, the sequence of described junction fragment is GGGGSGGGGSGGGGS.The present invention's junction fragment used there is no particular restriction, as long as it plays two components of interval fusion rotein, makes each component correctly can form its respective space structure, play its biological activity.
In certain embodiments, described two special tetravalent antibody is made up of anti-HER2 IgG-junction fragment-AntiCD3 McAb scFv, in certain embodiments, described two special tetravalent antibody is made up of two light chains comprising SEQ ID No:1 and two heavy chains comprising SEQ ID No:3.In certain embodiments, described light chain and heavy chain are respectively and are substituted, lack or add one or more amino acid and derived by SEQ ID No:1 and SEQ ID No:3 and height target kill the sequence of malignant cell expressing HER2 specifically, as 1,2,3,4,5,6,8,9,10,15,20,30,40,50 amino-acid residue, or have at least about 70% identity with the sequence shown in SEQ ID No:1 and No:3 and high target specifically kill the aminoacid sequence of the malignant cell of expressing HER2.In certain embodiments, described light chain and heavy chain are respectively and have with the sequence shown in SEQ ID No:1 and No:3 at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6% identity and high target specifically kill the aminoacid sequence of the malignant cell of expressing HER2.Such as, the one or more amino-acid residues in described aminoacid sequence can carry out the replacement of conserved amino acid, as one or several amino-acid residue, as 1,2,3,4,5,6,8,9,10,15,20,30,40,50 amino-acid residue.Amino acid whose conserved amino acid is well known in the art.
The term " identity " that the present invention uses has the usually known implication in this area, and those skilled in the art also know the rule, the standard that measure different identity between sequences.The present invention also must have high target specifically by the sequence that identity limits in various degree simultaneously and kill the activity of the malignant cell of expressing HER2.As well known to those skilled in the artly how to utilize this height target kill the ways and means of screening active ingredients variant sequence thereof of the malignant cell of expressing HER2 specifically.Those skilled in the art can easily obtain such variant sequence thereof under the instruction of the application's disclosure.
The term " high target specifically also kills the malignant cell of expressing HER2 " that the present invention uses refers to only target kill the malignant cell of expressing HER2, or kill when expressing the malignant cell of HER2 at target, even although also other cells of not expressing HER2 may be killed by target, experimenter can't be caused to produce severe side effect even this target kills other cells of not expressing HER2.
In one embodiment, the present invention relates to a kind of polynucleotide, it comprises the nucleotide sequence of coding two special tetravalent antibody as above.
Those skilled in the art know, although the present invention's qualifier used when limiting described polynucleotide is " comprising ", it does not also mean that and can add arbitrarily other sequences incoherent with its function at described polynucleotide two ends.Those skilled in the art know, in order to meet the requirement of reorganization operation, need the restriction enzyme site adding suitable restriction enzyme at the two ends of described polynucleotide, or extra increase setting up password, terminator codon etc., therefore, if limit described two special tetravalent antibody with enclosed statement can not cover these situations truly.
As well known to those skilled in the art, do not changing in coded amino acid whose situation, one or more codons in described nucleotide sequence can carry out justice such as grade and replace, as one or several codon, as 1,2,3,4,5,6,8,9,10,15,20,30,40,50 codon.Codon use table is well known in the art.
In one embodiment, the present invention relates to a kind of recombinant vectors, it comprises the polynucleotide as above effectively connected wherein.Described recombinant vectors is recombinant expression vector, can be prokaryotic expression carrier also can be carrier for expression of eukaryon, but preferred carrier for expression of eukaryon, more preferably for the recombinant expression vector of Mammals eukaryotic expression.
Term used herein " effectively connection " refers to such mode of connection, and wherein said polynucleotide are placed in the appropriate location of carrier, make described polynucleotide correctly, successfully copy, transcribe or express.
In one embodiment, the present invention relates to a kind of host cell, it transforms or transfection has recombinant vectors as above, and described host cell comprises mammalian cell, bacterial cell, yeast cell, insect cell and vegetable cell.
In a preferred embodiment, described host cell comprises Chinese hamster ovary celI, HEK293 cell, NSO cell and SP 2/0 cell.
In one embodiment, the present invention relates to a kind of method of producing described two special tetravalent antibody, it cultivates above-mentioned host cell under being included in suitable expression of polypeptides condition, and the polypeptide of separation from cell culture medium, purifying expression.Preferably, the purity of the polypeptide after described purifying is for being greater than 50%, more preferably, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8% or 99.9% is greater than.
In one embodiment, the present invention relates to a kind of pharmaceutical composition, it comprises two special tetravalent antibody as above and the pharmaceutically acceptable carrier of one.Described two special tetravalent antibody can be the sole active agent of described pharmaceutical composition, also can be one of described pharmaceutical composition activeconstituents, and other activeconstituentss are the other treatment agent that can combinationally use with described two special tetravalent antibody.
In a preferred embodiment, pharmaceutical composition of the present invention comprises the formulation of single-dose, the formulation of topical and Parenteral.
In one embodiment, the present invention relates to the method for the disease expressed by HER2 with described two special tetravalent antibody prevention or treatment and cause, comprise the as above two special tetravalent antibody or pharmaceutical composition that give to treat effective dose.In certain embodiments, the tumour of described treatment is selected from mammary cancer, cancer of the stomach, head and neck cancer, the rectum cancer, and in certain embodiments, the tumour of described treatment is selected from mammary cancer.
Term used herein " treatment effective dose " refers to when administration, can play the dosage of pharmacological action in subject." treatment effective dose " can by those skilled in the art according to the situation of patient as age, body weight, morbid state etc. are easily determined.
In one embodiment, the present invention relates to two special tetravalent antibody as above or pharmaceutical composition, it is used for the treatment of tumor disease.Preferably, the tumour of described treatment is selected from mammary cancer, cancer of the stomach, head and neck cancer, the rectum cancer, and in certain embodiments, the tumour of described treatment is selected from mammary cancer.
In one embodiment, the present invention relates to the purposes of two special tetravalent antibodies as above in the medicine for the preparation for the treatment of tumor disease.Preferably, the tumour of described treatment is selected from mammary cancer, cancer of the stomach, head and neck cancer, the rectum cancer, and in certain embodiments, the tumour of described treatment is selected from mammary cancer.
To further illustrate the present invention by following non-limiting example below, as well known to those skilled in the art, without departing from the spirit of the invention, can make many amendments to the present invention, such amendment also falls into scope of the present invention.
Following experimental technique if no special instructions, is ordinary method, and the experiment material used if no special instructions, all can easily obtain from commercial company.The various antibody used in the following embodiment of the present invention all derive from the standard antibody of commercial sources.
Embodiment
The structure of the two special tetravalent antibody expression vector of embodiment 1. anti-HER2-AntiCD3 McAb scFv
1, the aminoacid sequence of the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv and corresponding nucleotide sequence
The aminoacid sequence of anti-HER2 light chain as shown in SEQ ID NO:1, according to mammalian cell codon preference optimize nucleotide coding sequence as shown in SEQ ID NO:2.
The aminoacid sequence of anti-HER2 heavy chain-AntiCD3 McAb scFv as shown in SEQ ID NO:3, according to mammalian cell codon preference optimize nucleotide coding sequence as shown in SEQ ID NO:4.Wherein, 1-19 position is signal peptide sequence, and 20-470 position is the sequence of heavy chain of anti-HER 2, and 471-485 position is connection peptides (G
4s)
3sequence, 486-728 position is AntiCD3 McAb scFv sequence.
The structural representation of the two special tetravalent antibody of final anti-HER2-AntiCD3 McAb scFv as shown in Figure 1.
The above-mentioned nucleotide sequence optimized is synthesized by Nanjing Genscript Biotechnology Co., Ltd. and connects and enters pUC57 carrier.
2, the preparation of expression vector
Expression vector Y0GC transforms acquisition on mammalian cell expression vector X0GC (U.S. Patent application US20100120089) basis of our company.Particularly, with X0GC plasmid for template, use ATAACGCGTTGACATTGATTATTGACTAG (SEQ ID NO:5) and ATAAGATCTGGGTCTCCCTATAGTGAGT (SEQ ID NO:6) to be primer amplification CMV promoter, use ATAAGATCTTGTGCCTTCTAGTTGCCAGC (SEQ ID NO:7) and ATAACGCGTCTCAGAAGCCATAGAGCCCA (SEQ ID NO:8) to be primer amplification BGH terminator.In the application, all PCR reactions all use the Phusion of NEB company to surpass fidelity dna polysaccharase (F-530L).Reaction system is: H
2o 8.9 μ l, 5 × Phusion surpass fidelity dna polysaccharase buffer 4 μ l, 1mM dNTP 4 μ l, upstream primer 1 μ l, and downstream primer 1 μ l, Phusion surpass fidelity dna polysaccharase 0.1 μ l, template 1 μ l.Amplification CMV promoter and the reaction conditions of BGH terminator are: 94 DEG C 2 minutes; 94 DEG C 30 seconds, 55 DEG C 45 seconds, 72 DEG C 45 seconds, totally 35 circulations; 72 DEG C 5 minutes.The sequence obtained increasing reclaims test kit (Promega, A9282, lower same) with DNA and reclaims respective segments after 1.5% agarose gel electrophoresis.Cut by BglII (R0144L) enzyme of gene fragment NEB company, endonuclease reaction system is: 10 × damping fluid 32 μ l, BglII 0.5 μ l, and glue reclaims the gene fragment 3 μ l obtained, H
2o 14.5 μ l.Enzyme is cut system and is reacted 3 hours under 37 DEG C of conditions.The digestion products T4DNA ligase enzyme (M0202V) of NEB company is connected (lower same), reaction system is: 10 × ligase enzyme damping fluid 2 μ l, ligase enzyme 0.5 μ l, and glue reclaims the CMV promoter 3 μ l obtained, glue reclaims the BGH terminator 3 μ l obtained, H
2o 11.5 μ l.Be connected to room temperature reaction 12 hours.Obtain a CMV promoter-BGH terminator expression cassette, be mixed with BglII restriction enzyme site in centre.Cut CMV promoter-BGH terminator expression cassette and X0GC carrier with MluI (R0198V) enzyme of NEB company, endonuclease reaction system is: 10 × damping fluid 32 μ l, MluI 0.5 μ l, gene fragment or X0GC carrier 3 μ l, H
2o 14.5 μ l.Enzyme is cut system and is reacted 3 hours under 37 DEG C of conditions.Connected by digestion products, reaction system is: 10 × ligase enzyme damping fluid 2 μ l, ligase enzyme 0.5 μ l, CMV promoter-BGH terminator expression cassette 5 μ l, X0GC carrier 1 μ l, H
2o 11.5 μ l.Be connected to room temperature reaction 12 hours.To connect product conversion competent escherichia coli cell DH5 α (sky root, CB104, lower with).Obtain the Y0GC expression vector of two expression cassette series connection.Two expression cassettes of Y0GC carrier are used for the anti-HER2 light chain and the anti-HER2 heavy chain-AntiCD3 McAb scFv that express antibody respectively.
3, the structure of the two special tetravalent antibody expression vector of anti-HER2-AntiCD3 McAb scFv
The two special tetravalent antibody expression vector of anti-HER2-AntiCD3 McAb scFv as shown in Figure 2.With the anti-HER2LC of pUC57-with anti-HER2 light chain encoding sequences, (Nanjing Genscript Biotechnology Co., Ltd. synthesizes anti-HER2 light chain gene, this gene is included in pUC57 carrier, sequence is as shown in SEQ ID NO:2) be template, by the encoding sequence of the anti-HER2 light chain of standard PCR amplification.Upstream primer used is with HindIII restriction enzyme site, and sequence is: CACAAGCTTGCCACCATGGGTTGGT CCTGCATTATCCT (SEQ ID NO:9).Downstream primer is with EcoRI restriction enzyme site, and sequence is: CCGGAATTCTCAGCATTCGCCACGATTGAAG (SEQ ID NO:10).Reaction conditions is: 94 DEG C 2 minutes; 94 DEG C 30 seconds, 55 DEG C 45 seconds, 72 DEG C 1 minute, totally 35 circulations; 72 DEG C 5 minutes.The sequence obtained reclaims respective segments after 1% agarose gel electrophoresis.The HindIII (R0104L) of this sequence and carrier for expression of eukaryon Y0GC NEB company and EcoRI (R0101L) enzyme are cut, endonuclease reaction system is: 10 × EcoRI damping fluid 2 μ l, HindIII 0.5 μ l, EcoRI 0.5 μ l, gene fragment or Y0GC carrier 3 μ l, H
2o 14 μ l.Enzyme is cut system and is reacted 3 hours under 37 DEG C of conditions.Connected by digestion products, reaction system is: 10 × ligase enzyme damping fluid 2 μ l, ligase enzyme 0.5 μ l, gene fragment 5 μ l, Y0GC carrier 1 μ l, H
2o 11.5 μ l.Be connected to room temperature reaction 12 hours.Product conversion bacillus coli DH 5 alpha will be connected.PCR screens the anti-HER2LC of positive plasmid Y0GC-and carries out DNA sequencing, and checking construction of recombinant plasmid is correct.
With the pUC57-anti-HER2HC-AntiCD3 McAb scFv with anti-HER2 heavy chain-AntiCD3 McAb scFv encoding sequence, (Nanjing Genscript Biotechnology Co., Ltd. synthesizes anti-HER2 heavy chain-AntiCD3 McAb scFv gene, this gene is included in pUC57 carrier, sequence is as shown in SEQ ID NO:4) be template, by the encoding sequence of the anti-HER2 heavy chain-AntiCD3 McAb scFv of standard PCR amplification.Upstream primer used is with BglII restriction enzyme site, and sequence is: GAAGATCTGCCACCATGGGGTGGTCCTGTATCATC (SEQ ID NO:11).Downstream primer is with BglII restriction enzyme site, and sequence is: GAAGATCTTCACTTCAGTTCCAGTTTAGTC (SEQ ID NO:12).Reaction conditions is: 94 DEG C 2 minutes; 94 DEG C 30 seconds, 55 DEG C 45 seconds, 72 DEG C 2 minutes, totally 35 circulations; 72 DEG C 5 minutes.
By increasing, the sequence obtained reclaims respective segments after 1.5% agarose gel electrophoresis.BglII (R0144L) enzyme of this sequence with the Y0GC-anti-HER2 LC plasmid NEB company with anti-HER2 light chain successfully constructed is cut, endonuclease reaction system is: 10 × damping fluid 32 μ l, BglII 0.5 μ l, gene fragment or Y0GC-anti-HER2 LC plasmid 3 μ l, H
2o14.5 μ l.Enzyme is cut system and is reacted 3 hours under 37 DEG C of conditions.Connected by digestion products, reaction system is: 10 × ligase enzyme damping fluid 2 μ l, ligase enzyme 0.5 μ l, anti-HER2 heavy chain-AntiCD3 McAb scFv 5 μ l, Y0GC-anti-HER2 LC plasmid 1 μ l, H
2o 11.5 μ l.Be connected to room temperature reaction 12 hours.Product conversion bacillus coli DH 5 alpha will be connected.PCR screens positive plasmid Y0GC-anti-HER2-AntiCD3 McAb scFv and carries out digestion verification, DNA sequencing, and checking construction of recombinant plasmid is correct.
Positive DH5 α/Y0GC-anti-HER2-AntiCD3 McAb scFv is seeded to 1L LB/Amp liquid nutrient medium, LB/Amp liquid nutrient medium consists of 1% peptone (BD company), 0.5% yeast extract (BD company), 1%NaCl (Chemical Reagent Co., Ltd., Sinopharm Group), in 37 DEG C, shaking culture is spent the night under 180rpm condition.Within second day, extract the transfection of plasmid for 293T cell according to sky root DP117 without the large extraction reagent kit operation instructions of intracellular toxin plasmid.
Embodiment 2. is recombinated the expression of the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv
1, HEK293-T cell cultures
HEK293-T is adherent culture cell, in 37 DEG C, 5%CO after cell recovery
2went down to posterity once every 48 hours in incubator (using the DMEM substratum (purchased from Corning company) containing 10% foetal calf serum (purchased from Gibco company)), go down to posterity after 2-3 time, cell growth state is good, vigor (viable cell ratio, also can be write as " motility rate ") reach more than 95% just can inoculate ten layer cell factory (purchased from NUNC company, production number: 140400).
2, HEK293-T cell inoculating cell factory
By HEK293-T cell with 18 X 10
7individual inoculum size is inoculated in ten layer cell factory, and cultivate with the DMEM substratum (purchased from Corning company) containing 10% foetal calf serum (purchased from Gibco company), cell factory is repeatedly put upside down mixing and is placed on 37 DEG C, 5%CO
2incubator in cultivate 48 hours, cell attachment is complete, and density reaches 80%, namely can be used for transient transfection studies.
3, HEK293-T cell transient transfection
By the plasmid (Y0GC-anti-HER2-AntiCD3 McAb scFv) of wanted transfection with after 0.22 μm of membrane filtration, draw 1330 μ g in 66mL plasma-free DMEM medium, the transfection reagent PEI (available from Sigma) got after 2660 μ g filtrations mixes with the DMEM substratum of 66mL, afterwards the mixture of PEI and DMEM is poured in the plasmid after dilution, in clean bench, leave standstill 15 minutes.Then plasmid and PEI mixture are joined in the plasma-free DMEM medium of 1.3L, fully slowly add in cell factory after mixing, cell factory is placed in 37 DEG C, 5%CO afterwards
2cultivate in incubator.After 4 hours, in clean bench, add 266mL Cell Boost 5 (purchased from Thermo Fisher company), put upside down after mixing in 34 DEG C, 5%CO
23-4 days is cultivated under condition.
4, the expression level of ELISA method testing goal albumen
In clean bench, gather in the crops cell culture fluid, the fresh 1.3L DMEM substratum after mixing and 266mL Cell boost 5 are joined in cell factory, 34 DEG C, 5%CO simultaneously
2continue in incubator to cultivate 3-4 days.Poured into by the cell culture fluid gathered in the crops before in clean Centrifuge Cup, centrifugal 20 minutes of 7000rpm, leaves and takes supernatant liquor for subsequent use in-80 DEG C of refrigerators.Repeat same operation after 3-4 days, detect the expression level often criticizing target protein simultaneously by ELISA method.Each batch of expressing quantity is 2 ~ 3mg/L.
Embodiment 3. is recombinated the purifying of the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv
The purifying flow process of the two special tetravalent antibody of the anti-HER2-AntiCD3 McAb scFv that recombinates as shown in Figure 3.
1, the pre-treatment of cell expressing fermented liquid
Centrifugal for the cell culture supernatant 7000rpm of results 20min is removed precipitation.Cell fermentation liquid supernatant liquor is after 0.2 μm of membrane filtration, and 10K film bag ultrafiltration and concentration is also replaced as 20mM PB damping fluid and adds 150mM sodium-chlor, pH 7.4.Application column chromatography before with 0.2 μm of membrane filtration to remove throw out.This step is carried out at operating in 4 DEG C.
2, rProtein A affinity chromatography purifying
AKTA explorer 100 type protein purification system (GE Healthcare) and affinity chromatographic column rProtein A Sepharose Fast Flow (16mm I.D., 15ml, GE Healthcare) is adopted to carry out purifying at 4 DEG C.First 150mM sodium-chlor is added with mobile phase A and 20mM PB damping fluid, pH7.4 solution equilibria chromatographic column, after baseline stability, pretreated cell fermentation liquid supernatant liquor is carried out loading, flow velocity is 5ml/min, and rinse with mobile phase A after introduction of the sample, then carry out wash-out with different damping fluid.First 5 column volumes are rinsed with Mobile phase B 1; Then 5 column volumes are rinsed with Mobile phase B 2; Then with Mobile phase B 3 wash-out 5 column volumes, collect elution peak and be target protein peak; Finally rinse 5 column volumes with Mobile phase B 4.Above elution step flow velocity is all 5ml/min.Mobile phase B 1 forms for adding 0.5M arginine in mobile phase A; Mobile phase B 2 is 20mM NaAc, pH4.5; Mobile phase B 3 is 100mM citric acid, pH3.0; Mobile phase B 4 is 100mM citric acid, pH 2.2.Collect the elution peak indicated and also by dripping 1M NaAc, pH is adjusted to 5.0.Color atlas as shown in Figure 4.
3, the ion-exchange chromatogram purification of albumen
AKTA explorer 100 type protein purification system (GE Healthcare) and strong anion exchange chromatographic post HiTrap Q Sepharose FF (5ml, GE Healthcare) is adopted to carry out purifying at 4 DEG C.First with mobile phase A and 20mM NaAc (pH 5.0) solution equilibria chromatographic column, collect and adjust the elutriant after pH in previous step being tested after baseline stability and carry out loading, flow velocity is 5ml/min, and collection stream is worn peak and is target protein peak.Apply 100% Mobile phase B after loading and carry out isocratic elution, flow velocity is 5ml/min.Mobile phase B forms for adding 1M sodium-chlor in mobile phase A.Color atlas as shown in Figure 5.Collect stream and wear peak, and concentrate, for the purifying of gel exclusion chromatography chromatogram with the super filter tube that aperture is 10K.
4, the gel exclusion chromatography chromatogram purification of albumen
Adopt AKTA explorer 100 type protein purification system (GE Healthcare) and gel exclusion chromatography filler Superdex
tM200 (105ml, 16/60, GE Healthcare) carry out purifying at 4 DEG C.Loading volume is less than 1% of chromatographic column volume, and moving phase is PBS, and flow velocity is 1ml/min.Color atlas as shown in Figure 6.Collect and indicate component, concentrate with the super filter tube of 10K, in Bechtop 0.2 μm of filter membrane sterile filtration, then use ultraviolet spectrophotometer (280nm) to carry out quantitatively, and carry out purity check with SEC-HPLC.Result shows that the purity of the two special tetravalent antibody of this restructuring anti-HER2-AntiCD3 McAb scFv is at least 95%.
The stability study of the two special tetravalent antibody of embodiment 4. anti-HER2-AntiCD3 McAb scFv
Repeat frozen process experiment operation as follows: be sub-packed in 3 tubules by two for HER2-AntiCD3 McAb scFv anti-described in 1mg/mL special tetravalent antibody, often pipe is no less than 20 μ g (namely at every turn analyzing consumption), is placed in-80 DEG C of refrigerators more than 3 hours.After taking-up, normal temperature melts.2nd time, the 3rd time is carried out successively to corresponding tubule and repeats freeze thawing.Get 20 μ g samples and carry out efficient discharge resistance liquid chromatography (SEC-HPLC) separation.
Differing temps experimental implementation is as follows: the sample fully sealed (1mg/mL) is positioned over 4 DEG C (± 2 DEG C), 25 DEG C (± 2 DEG C) and 40 DEG C of thermostat containers (BINDER KBF240), gets 20 μ g samples carry out efficient discharge resistance liquid chromatography (SEC-HPLC) and be separated at corresponding time point (baseline (the 0th day), the 3rd day, the 7th day, the 14th day).
Above-mentioned SEC-HPLC condition is as follows: (1) exclusion chromatography post: TSKgel G3000SWxl (Tosoh Bioscience), 5 μm, 7.8mm × 30cm; (2) moving phase: 5mM PBS, 150mM NaCl, pH 6.7; (3) flow velocity: 0.6mL/min; (4) ultraviolet detection wavelength: 280nm; (5) acquisition time: 30min.Instrument is Agilent 1200 Infinity chromatographic instrument, utilizes Agilent ChemStation to record collection of illustrative plates and calculates the ratio (Fig. 7) of residual monomer.
As shown in Figure 7, under the experiment condition of circulating freezing resistance, 4 degree and 25 degree, can not there is obvious gathering in described antibody; Under 40 DEG C of experiment conditions, the polymer ratio that observed described antibody extends in time and slightly increases (monomer minimizing), therefore thinks that the two special tetravalent antibody of described anti-HER2-AntiCD3 McAb scFv possesses good thermostability.
Embodiment 5.FACS detects the antigen-binding activity of the two special tetravalent antibody of anti-Her2-AntiCD3 McAb scFv
FACS is utilized to detect the antigen-binding activity of anti-HER2 and anti-human CD3 in two special tetravalent antibody.Get cell 100 μ L (about 1X10 to be checked
6individual cell), add the two special tetravalent antibody sample of 1 μ g, with containing 2% foetal calf serum (Gibco, article No.: DPBS (Gibco 10099), article No.: 14190) detect damping fluid polishing and make cumulative volume be 200 μ L, hatch 30 minutes for 4 DEG C.Centrifugal 5 minutes of 800rpm, abandons supernatant, and ((PBS damping fluid+2% foetal calf serum composition) washes cell twice to detect damping fluid with 1mL.Cell is resuspended in 100 μ L to detect in damping fluid, adds 1 μ g FITC mark goat anti-human igg two and resist, make cumulative volume be 200 μ L with detection damping fluid polishing, hatch 30 minutes for 4 DEG C.Centrifugal 5 minutes of 800rpm, abandons supernatant, detects damping fluid wash cell twice with 1mL.Cell being resuspended in 1mL detects in damping fluid, uses stream type cell analyzer to detect.
Result such as Fig. 8 shows, and two special tetravalent antibody and HER2 high-expression cell line SK-OV-3 cell have remarkable combination, and this illustrates that the function of anti-HER2 component in two special tetravalent antibody is complete.Also have combination with the Jurkat cell of CD3 high expression level, this illustrates that the function of AntiCD3 McAb component in two special tetravalent antibody is also complete.
The growth of tumour cell inhibit activities experiment of the two special tetravalent antibody of embodiment 6. anti-HER2-AntiCD3 McAb scFv
Breast cancer lines SK-BR-3, human stomach cancer cell line NCl-N87, human colon cancer cell strain HCT-8 obtains from ATCC.All cells is all at the foetal calf serum (Gibco, the article No.: RPMI-1640 substratum (Gibco, article No.: cultivate 22400), be placed in 37 DEG C, in the cell incubator of 5%CO2, go down to posterity weekly twice 10099) that are added with 10%.
Target cell SK-BR-3 or NCl-N87 or HCT-8 is inoculated in 96 orifice plates (Costar), every hole 50 μ L (about 1X10
4individual cell), add the two special tetravalent antibody sample of anti-HER2-AntiCD3 McAb scFv that 100 μ L perfect mediums carry out 10 times of gradient dilutions.Suitable effector cell's (human PBMC's cell) is added, every hole 50 μ L according to different effect target ratios (E/T).96 orifice plates are placed in 37 DEG C, 5%CO
24 days are hatched in incubator.Liquid in sucking-off hole, with 200 μ L DPBS (Gibco, article No.: 14190) clean cell twice.Add 100 μ L perfect mediums and 20 μ L MTS (CellTiter96 Aqueous One Solution, Promega, article No.: G358B), and hatch 3 hours in 37 DEG C of lucifuges.Microplate reader is at 490nm place reading.Control group experiment only adds target cell, effector cell and substratum in 96 orifice plates.Kill rate calculation formula is as follows:
As shown in Figure 9, after adding the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv, effector cell improves the kill rate of target cell, and also improves along with the increase kill rate of this pair of special tetravalent antibody amount, illustrates that this pair of special tetravalent antibody can the orientation of guiding effect cell to target cell kill and wound.In the SK-BR-3 cell of HER2 high expression level, this pair of special tetravalent antibody and HER2 monoclonal antibody Trastuzumab (Herceptin) all can mediate and kill and wound the orientation of target cell, and wherein this pair of special tetravalent antibody fragmentation effect is much better than HER2 monoclonal antibody.And in the HCT-8 cell of the low expression of NCl-N87 and HER2 of HER2 high expression level, the fragmentation effect of effector cell to target cell of HER2 monoclonal antibody Trastuzumab mediation is not obvious.In contrast, this pair of special tetravalent antibody can well mediate the lethal effect of effector cell to target cell.
Therefore, no matter when the low expression of HER2 or high expression level, the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv of the present invention all can mediate the good fragmentation effect of effector cell to target cell, thus serves active effect in oncotherapy.
Simultaneously, document is had to show, the appropriate rope monoclonal antibody (Catumaxomab) of card that application Tetraploid knurl is produced is nmole (nM) order of magnitude (P Ruf etc. to the minimum concentration of Tumor growth inhibition, British Journal of Cancer, (2007) 97,315-321), and bifunctional antibody of the present invention is 10pM to the minimum concentration of Tumor growth inhibition, and this illustrates that the present invention can more effective Tumor suppression growth.
The two pharmacokinetic of special tetravalent antibody in Mice Body of embodiment 7. anti-HER2-AntiCD3 McAb scFv
The present embodiment have detected the two pharmacokinetic situations of special tetravalent antibody in Mice Body of anti-HER2-AntiCD3 McAb scFv.
Experiment material selects female BAl BIc/c mouse, and 8 week age, purchased from Beijing HFK Bio-Technology Co., Ltd..After mouse conforms one week, give the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv, dosage is 7.5nmol/kg, intravenous injection, single-dose.At 0 point, 5 minutes, 15 minutes, 30 minutes, 1 hour, 3 hours, 6 hours, 10 hours, 24 hours, 48 hours, 72 hours, 96 hours, 120 hours, 168 hours, 216 hours, 288 hours eye sockets blood sampling (the blood sampling point of every mouse is 2 times) after administration, refuse anti-freezing, room temperature places blood sample 30 minutes, after blood coagulation, centrifugal 5 minutes of 3000rpm, the serum sample obtained is frozen in-80 DEG C of preservations, to be measured.
ELISA measures the concentration of the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv in serum.Briefly, recombinated HER2 albumen (Sino Biological, article No.: 10004-H08H) with the carbonate buffer solution bag of pH=9.6 on high adsorptive enzyme target by people, PBST (Sigma, article No.: P-3563) washs.In order to prevent non-specific binding, close this plate with the PBST containing 5% skim-milk, PBST washs.Then add the test serum sample incubation with the PBST dilution containing 10% mixing mice serum, 1%BSA, 25 DEG C, 1 hour, PBST washed this plate.Add the anti-human IgG antibodies's (Abcam, article No.: Ab7153) be diluted in containing the horseradish peroxidase-labeled in the PBST of 5% skim-milk, 25 DEG C, 1 hour, PBST washed this plate.Finally use colorimetric substrates TMB (BD OptEIA, article No.: 555214) develop the color, color development at room temperature 10 minutes.Add 1M H2SO4, color development stopping.Microplate reader reads the absorbancy at 450nm place.
As shown in Figure 10, under 7.5nmol/kg dosage, the transformation period T1/2 of the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv is 95.81 hours to result; Area under the drug-time curve AUC is 13803.82nM.hr; Peak time Tmax is 5 minutes; Reaching peak concentration Cmax is 170.47nM; Apparent volume of distribution Vd is 0.08L/Kg; Clearance rate CL is 0.0005L/hr/kg; Average residence time MRT is 130.43 hours.
The anti-tumor in vivo activity research of the two special tetravalent antibody of embodiment 8. anti-HER2-AntiCD3 McAb scFv
The two anti-tumor activity of special tetravalent antibody on NOD/SCID mouse xenografts people cancer of the stomach NCl-N87 tumor model of the anti-HER2-AntiCD3 McAb scFv of the present embodiment Preliminary detection.
Experiment material selects female NOD/SCID mouse, 6-8 week age, purchased from Beijing HFK Bio-Technology Co., Ltd..After mouse conforms one week, every mouse inoculates 5 x 10 in right shoulder dorsal sc
6individual NCl-N87 gastric carcinoma cells.Treat that gross tumor volume grows to about 150mm
3time, by 5 mouse often group carry out random packet, be set as negative control group and administration group respectively.Negative control group and administration group homogeneous all intravenous injections human PBMC's cell, every injected in mice 5 x 10 at every turn
6individual, continuous injection 3 weeks.Negative control group and administration group give carrier (PBS) and the two special tetravalent antibody treatment of anti-HER2-AntiCD3 McAb scFv respectively, Per-Hop behavior 2 times, successive administration 3 weeks, administering mode is intravenous injection, and the dosage of the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv is 5mg/kg.From self administration of medication, measure 2 gross tumor volumes weekly, measure its major diameter a, minor axis b, gross tumor volume calculation formula is: gross tumor volume (mm
3)=(a x b
2)/2, gross tumor volume change calculations formula is: gross tumor volume changes the gross tumor volume x 100 of the day of the gross tumor volume/administration on (%)=same day.It is 4 weeks that gross tumor volume measures the time length, namely measures one week again after drug withdrawal.
As shown in figure 11, the two special tetravalent antibody of anti-HER2-AntiCD3 McAb scFv shows strong anti-tumor activity to result, significantly suppress the growth of the people cancer of the stomach NCl-N87 transplantation tumor in NOD/SCID Mice Body.
Claims (18)
1. a two special tetravalent antibody, it comprises a kind of protein function district of target first antigen HER2 and the protein function district of a kind of target second antigens c D3, and wherein the protein function district of target second antigens c D3 is connected to the C end in the protein function district of target first antigen HER2.
2. two special tetravalent antibody according to claim 1, is characterized in that the protein function district of described target second antigens c D3 is connected to the C end in the protein function district of target first antigen HER2 by junction fragment.
3. two special tetravalent antibody according to claim 1 and 2, it is characterized in that the protein function district of described target first antigen HER2 is immunoglobulin (Ig) or its modifier, function equivalent, function fragment or the variant of target HER2, preferably, the immunoglobulin (Ig) of target first antigen HER2 is IgG, IgA, IgD, IgE, IgM antibody or their heterozygote, more preferably, the immunoglobulin (Ig) of target first antigen HER2 is IgG antibody.
4. two special tetravalent antibody according to claim 3, is characterized in that described immunoglobulin (Ig) is immunoglobulin (Ig) that is chimeric, humanized or total man.
5. the two special tetravalent antibody according to any one of claim 1-4, it is characterized in that the protein function district of target second antigens c D3 is immunoglobulin (Ig) or its modifier, function equivalent, function fragment or the variant of target CD3, preferably, the protein function district of target second antigens c D3 is scFv or Fab of target CD3.
6. two special tetravalent antibody according to claim 5, is characterized in that described scFv or Fab is scFv or Fab that be chimeric, humanized or total man.
7. the two special tetravalent antibody according to any one of claim 2-6, is characterized in that described junction fragment length is 5-30 amino acid, be preferably 15 amino acid, and more preferably its sequence is GGGGSGGGGSGGGGS.
8. the two special tetravalent antibody according to any one of claim 1-7, it is characterized in that described two special tetravalent antibody is made up of anti-HER2IgG-junction fragment-AntiCD3 McAb scFv, preferably, described two special tetravalent antibody is made up of two light chains comprising SEQID No:1 and two heavy chains comprising SEQ ID No:3.
9. two special tetravalent antibody according to claim 8, wherein said light chain and heavy chain are respectively and are substituted, lack or add one or more amino acid and derived by SEQ ID No:1 and SEQ ID No:3 and height target kill the sequence of malignant cell expressing HER2 specifically, or have at least about 70% identity with the sequence shown in SEQ ID No:1 and No:3 and high target specifically kill the aminoacid sequence of the malignant cell of expressing HER2.
10. the nucleic acid sequence encoding of the two special tetravalent antibody according to any one of claim 1 to 9.
11. nucleic acid sequence encodings according to claim 10, it is for comprising the sequence of sequence shown in SEQ ID No:2 and No:4 respectively.
12. 1 kinds comprise the carrier effectively connecting the nucleic acid sequence encoding described in claim 10 or 11 wherein.
13. carriers according to claim 12, the nucleotide sequence of wherein encode light chain and heavy chain is present in different expression cassettes.
14. carriers according to claim 12 or 13, it is eukaryotic expression vector, preferably has the carrier Y0GC of two expression cassettes through transformation.
15. 1 kinds transform or transfection is had the right the host cell of the carrier according to any one of requirement 12-14.
16. 1 kinds of pharmaceutical compositions, it comprises two special tetravalent antibody according to any one of claim 1 to 9 and pharmaceutically acceptable carrier.
17. 1 kinds of methods of producing two special tetravalent antibody, it cultivates host cell according to claim 15 under being included in suitable expression of polypeptides condition, and be separated from cell culture medium, two special tetravalent antibody that purifying is expressed.
The purposes of two special tetravalent antibody according to any one of 18. claims 1 to 9 in the medicine of the disease expressed by HER2 for the preparation of prevention or treatment and cause, preferably, described disease is malignant tumour, more preferably, described malignant tumour is selected from mammary cancer, cancer of the stomach, the rectum cancer, more preferably, described malignant tumour is selected from mammary cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410820733.XA CN104744592B (en) | 2013-12-27 | 2014-12-24 | The anti-bis- special tetravalent antibodies of HER2- AntiCD3 McAb scFv |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013107417675 | 2013-12-27 | ||
| CN201310741767 | 2013-12-27 | ||
| CN201410820733.XA CN104744592B (en) | 2013-12-27 | 2014-12-24 | The anti-bis- special tetravalent antibodies of HER2- AntiCD3 McAb scFv |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104744592A true CN104744592A (en) | 2015-07-01 |
| CN104744592B CN104744592B (en) | 2019-08-06 |
Family
ID=53584912
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410820733.XA Active CN104744592B (en) | 2013-12-27 | 2014-12-24 | The anti-bis- special tetravalent antibodies of HER2- AntiCD3 McAb scFv |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104744592B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107602702A (en) * | 2017-09-22 | 2018-01-19 | 生标（上海）医疗器械科技有限公司 | Antibody that is a kind of while targetting people p185 and VEGF and its application |
| WO2020088365A1 (en) * | 2018-10-30 | 2020-05-07 | 深圳新诺微环生物科技有限公司 | Minicircle dna expressing bridging molecule linking her2-positive cell and effector cell and application thereof |
| WO2020088403A1 (en) * | 2018-11-01 | 2020-05-07 | 安源医药科技（上海）有限公司 | Homodimer-type bispecific antibody against her2 and cd3 and use thereof |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113861296A (en) * | 2020-06-30 | 2021-12-31 | 广州凌腾生物医药有限公司 | Method for preparing bispecific antibody by using circular rail shaking type bioreactor |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102219856A (en) * | 2011-05-18 | 2011-10-19 | 哈尔滨医科大学 | Vascular Endothelial Growth Factor (VEGF) acceptor 2/CD3 bispecific single-chain antibody |
-
2014
- 2014-12-24 CN CN201410820733.XA patent/CN104744592B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102219856A (en) * | 2011-05-18 | 2011-10-19 | 哈尔滨医科大学 | Vascular Endothelial Growth Factor (VEGF) acceptor 2/CD3 bispecific single-chain antibody |
Non-Patent Citations (2)
| Title |
|---|
| KELLY DAVIS ORCUTT ET AL.: "A modular IgG-scFv bispecific antibody topology", 《PROTEIN ENGINEERING, DESIGN & SELECTION》 * |
| 任辉等: "HER2×CD3双抗体治疗过度表达HER2基因裸鼠乳腺癌及其机制", 《中华实验外科杂志》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107602702A (en) * | 2017-09-22 | 2018-01-19 | 生标（上海）医疗器械科技有限公司 | Antibody that is a kind of while targetting people p185 and VEGF and its application |
| US10973916B2 (en) | 2017-09-22 | 2021-04-13 | Sun-Bio Medical Device Co., Ltd. | Bispecific antibody targeting human p185 and vascular endothelial growth factor and application thereof |
| WO2020088365A1 (en) * | 2018-10-30 | 2020-05-07 | 深圳新诺微环生物科技有限公司 | Minicircle dna expressing bridging molecule linking her2-positive cell and effector cell and application thereof |
| WO2020088403A1 (en) * | 2018-11-01 | 2020-05-07 | 安源医药科技（上海）有限公司 | Homodimer-type bispecific antibody against her2 and cd3 and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104744592B (en) | 2019-08-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2018050039A1 (en) | Novel anti-pd-1 nano-antibody and application thereof | |
| CN110050000A (en) | Fusion protein and its medical usage containing TGF-β receptor | |
| CN110352070A (en) | Bispecific checkpoint inhibitor antibody | |
| CN106397598B (en) | Expression and preparation method of multivalent multispecific antibody and immune hybrid protein | |
| CN108463245A (en) | The binding molecule of J chains with modification | |
| CN102448987A (en) | Anti-VEGF monoclonal antibody and pharmaceutical composition comprising said antibody | |
| CN105722855A (en) | Constant chain modified bispecific, penta-and hexavalent Ig-M antibodies | |
| CN105622753B (en) | A kind of PD-1 monoclonal antibody and its application | |
| US20220340657A1 (en) | Antibody and bispecific antibody targeting lag-3 and use thereof | |
| CN107488229A (en) | PD L1 antibody and application thereof | |
| WO2022017487A1 (en) | TGF-β RII MUTANT AND FUSION PROTEIN THEREOF | |
| CN102321173A (en) | Humanized macrophage inhibitory factor 1 monoclonal antibody and application thereof | |
| CN111995685B (en) | Bispecific antibody targeting HER2 and PD-1 and application thereof | |
| CN106397599A (en) | Expression and preparation methods for bivalent bispecific antibody and hybrid protein | |
| CN114685666B (en) | Anti-mesothelin nanobody and application thereof | |
| CN104744592A (en) | Anti-HER2-anti-CD3 scFv bispecific tetravalent antibody | |
| CN101701039B (en) | Variable regions of light chains and heavy chains of FMU-EPCAM-2A9 monoclonal antibodies | |
| CN115698088A (en) | Immune cell adaptor multi-specificity binding protein and preparation and application thereof | |
| CN105368904A (en) | Preparation method and application of immunoglobulin G fragment | |
| CN102443063A (en) | Anti-TNFalpha humanized Fab, humanized antibody and its application | |
| CN104098698A (en) | Antibody against CD3, and preparation method and application thereof | |
| CN104558193B (en) | A kind of bispecific antibody preparation method and application of targeted mouse T lymphocyte CD3 and human tumor antigen HER2 | |
| CN114685667B (en) | Mesothelin binding molecules and uses thereof | |
| CN104231086B (en) | Bifunctional fusion protein, preparation method and application thereof | |
| CN104193828A (en) | Recombinant fusion protein capable of simultaneously blocking HER2 and VEGFR signal paths |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |