CN104726608B - The application process in VEGFR2 gene Val297Ile site - Google Patents

Abstract

The invention discloses the application process in VEGFR2 gene Val297Ile site, specifically for the preparation of detecting disturbances in patients with Parkinson disease for the kit that adopts drug susceptibility when levodopa treatment. In this kit, contain the probe and the primer that detect VEGFR2 gene Val297Ile site, described probe and primer can and amplify the gene order that comprises VEGFR2 gene Val297Ile site with the gene order specific binding of front and back, VEGFR2 gene Val297Ile site. The present invention is the kit that detects gene pleiomorphism based on Taqman classifying method, and this kit can detect the gene loci (VEGFR2 gene Val297Ile polymorphism) relevant to levodopa treatment Parkinson drug susceptibility accurately, fast, easily.

Description

The application process in VEGFR2 gene Val297Ile site

Technical field

The invention belongs to biology field, be specifically related to a kind of levodopa treatment Parkinson's medicaments insensitiveThe application process in the VEGFR2 gene Val297Ile site that property is relevant.

Background technology

VEGF R2 (vascularendothelialgrowthfactorreceptor2,VEGFR2) belong to receptor tyrosine kinase (receptortyrosinekinase, RTK) superfamily, mainly divideCloth, in vascular endothelial cell and lymph endothelial cell, is VEGF-A (vascularEndothelialgrowthfactor, VEGF-A) promote to improve blood vessel penetrating by vascular endothelial cell division growthProperty main regulatory factors, and play a leading role in the signal conduction of VEGF-A.

Research report levodopa (levodopa, L-dopa) treatment Parkinson's induced movement obstacle complication,May with blood-brain barrier functional deterioration, make the medicine being originally difficult to by blood-brain barrier infiltrate black substance and line shapeBody, causes due to the variation of valid density in L-dopa brain. The multinomial L-dopa of studies confirm that cause dyskinesia withVEGF-A raises, and induction blood-brain barrier endothelium generates, and changes blood-brain barrier permeability relevant.

Research shows that VEGFR2 gene pleiomorphism is relevant to various diseases, and has adopted different Genotyping sidesMethod checks. For example, there is research to adopt mass spectrum classifying method to confirm that VEGFR2 (rs2071559) is polymorphicProperty increases relevant with glioma risk; There is research to adopt Taqman sonde method to study VEGFR2-604T/CPolymorphism and nasopharyngeal carcinoma neurological susceptibility and invasive relation. Mass spectrum somatotype is the high flux for large sample multidigit pointClassifying method, and Taqman sonde method is the goldstandard of middle flux somatotype, and there is highly sensitive, costRelatively less advantage.

Taqman sonde method is between PCR upstream and downstream primer, to choose one section of sequence as probe, and on probeLower mark fluorophor and quenching group, this probe can be combined with template, in extension, when primer synthesizesDuring to probe and template junction, 5 ' 5 prime excision enzyme activity of Taq enzyme can degrade probe 5 ' end, make fluorescent baseGroup separates with quenching group, discharges fluorescence. Anti-with respect to traditional RFLP polymerase chainShould (PCR-RFLP), Taqman sonde method has that sensitivity is higher, the simpler advantage of operation, and pathHigher.

Summary of the invention

The present invention aims to provide the application process in VEGFR2 gene Val297Ile site, specifically a kind of inspectionThe kit of the polymorphism of survey and levodopa treatment Parkinson drug susceptibility related gene, this kit can be usedReagent in preparation detection with the polymorphism of levodopa treatment Parkinson drug susceptibility related gene.

In order to achieve the above object, technical scheme provided by the invention is:

The application process in VEGFR2 gene Val297Ile site, described VEGFR2 gene Val297IleSite is for the preparation of detecting disturbances in patients with Parkinson disease for the preparation that adopts drug susceptibility when levodopa treatment.

Above-mentioned preparation comprises kit, particularly comprises the kit that adopts Taqman sonde method.

In described kit, contain the probe and the primer that detect VEGFR2 gene Val297Ile site, described inProbe and primer can and increase with the gene order specific binding of front and back, VEGFR2 gene Val297Ile siteGo out to comprise the gene order in VEGFR2 gene Val297Ile site.

Described probe and primer preferably with VEGFR2 gene Val297Ile site before and after the gene of 500bpSequence-specific is in conjunction with also amplifying the gene order that comprises VEGFR2 gene Val297Ile site.

In described kit, contain following probe:

VIC-CCTTAACTATAGATGGTGTAACC-MGB；

FAM-CTTAACTATAGATGGTATAACC-MGB；

In described kit, contain following primer:

5’-CAGTCTGGGAGTGAGATGAAGAAAT-3’；

5’-GGTCATCAGCCCACTGGAT-3’。

VIC and FAM are reporter group, VIC absorbing wavelength 515-535nm, emission wavelength 540-560nm;FAM absorbing wavelength 485-505nm, emission wavelength 515-530nm; MGB is quenching group.

Mentioned reagent box is suitable with VIC fluorescence intensity according to FAM while detection, and VEGFR2 gene is describedVal297Ile site is AG genotype; VIC fluorescence intensity is much larger than FAM fluorescence intensity, explanationVEGFR2 gene Val297Ile site is GG genotype; FAM fluorescence intensity is strong much larger than VIC fluorescenceDegree, illustrates that VEGFR2 gene Val297Ile site is AA genotype.

The early-stage Study of this seminar shows, VEGFR2 gene polymorphic Val297Ile (rs2305948) may lead toCross and affect VEGFR2 expression, thus relevant to levodopa treatment Parkinson drug susceptibility, and beforeThere is no relevant report.

The extracellular domain of VEGFR2 albumen comprises 7 immunoglobulin-like loops. Outer the 1st loop of born of the same parents is to be combined with VEGFNecessary position, 2-3 loop is the main position of combining closely with VEGF, VEGFR2 gene Val297Ile positionPoint coding VEGFR2 extracellular domain the 3rd loop. In Chinese han population, its minimum gene frequency (MinorAlleleFrequency, MAF) be 29.71%. Due to also do not have at present relevant Val297Ile gene pleiomorphism andThe relevant report of its function, this seminar recent research is just found itself and levodopa treatment Parkinson medicaments insensitiveProperty relevant, so also nobody detected VEGFR2 gene Val297Ile polymorphism, more there is no coherent detectionReagent kit product emerges. Therefore, explore and detect with levodopa treatment Parkinson drug susceptibility related geneThe method of polymorphism and product seem of far-reaching significance.

Kit of the present invention can detect and levodopa treatment Parkinson medicaments insensitive accurately, fast, easilyThe gene loci (VEGFR2 gene Val297Ile polymorphism) that property is relevant.

Brief description of the drawings

Fig. 1 is that Taqman sonde method detects VEGFR2 gene Val297Ile loci gene type;

Fig. 2 is that mass spectrography detects VEGFR2 gene Val297Ile loci gene type.

Detailed description of the invention

Be intended to further illustrate the present invention below in conjunction with embodiment, and unrestricted the present invention.

Embodiment 1

1. design Taqman probe and primer

1.1 search 500bp sequence before and after VEGFR2 gene Val297Ile site

In PUBMEDSNP database, search for VEGFR2, enter Geneview, select NC_000004.12 to turnRecord this and show the SNP (SNP) of whole gene region, enter rs2305948, at FastaIn sequence, can obtain the sequence (SEQIDNO.5 and SEQIDNO.6) of the forward and backward 500bp of this polymorphic site,For finding suitable probe and primer.

CAGGCTATGAATATTAGTTTTCTCTAGGTGATTACATCTTTCCACATTATGTCATTTCTCTGTTCTCCAAAGTTTTTGATCTACATTCCTTTTAAGGGAATTTCTCTTTAAGAGGTGGCATGAGATACACTGCTCCTTAAACAGTGGTCACATTTACTTGTGTTTCTGCAGTTTATATCCATCTCACTTTCACCACGTGAGGTTTTAAAAATCCTAATTCAGTTGGTTCCATTTATTTCTCCTGAAACAAAATATATTTGTTGTCTGCATGAGGTTAAAAGTTCTGGTGTCCCTGTTTTTAGCATTAAATAATGTTTACCAAAGCCCAGATTTAATTCTGTGTGTTACTAGAAGTTATTGGGTAATGTTATATGCTGTGCTTTGGAAGTTCAGTCAACTCTTTTTTTCAGCATCAGCATAAGAAACTTGTAAACCGAGACCTAAAAACCCAGTCTGGGAGTGAGATGAAGAAATTTTTGAGCACCTTAACTATAGATGGT(SEQIDNO.5)

Y (Y refers to VEGFR2 gene Val297Ile site)

TAACCCGGAGTGACCAAGGATTGTACACCTGTGCAGCATCCAGTGGGCTGATGACCAAGAAGAACAGCACATTTGTCAGGGTCCATGGTAAGCTATGGTCTTGGAAATTATTCTGTGCCTTGACAAGTGAGATAATTTAAATAAATTTAGGTCACTTAGTGATTCCTATTTTGTTCATTCAGAAGATAGTTTCTAGTTTTTCTTGTTAGGGAGGCCACATGACCTAGAGGTCAAGAGCATAGCTTTGTAGTCAGGAACTTGGGTTCAAACCTCAACTTTAAAGATGAGATGTGCTGATATACAGTAAGAGTTCATTTAGTATTACTTATTATAGTTATTGCTGCTATTAGGATTGTTACTATGATAAATAGTATTAGCTAAGGTAGTTTTTAAATTTTCATTTTATTGCAAGGCTGAGAGGCCTACTTGAATAAGCATGAGCTTTGCAAACTGGGGAAACATTTAGCAATATACAGTTGACCTGTGAGCAACTCAGGGAT(SEQIDNO.6)

1.2 utilize PrimerExpress3.0 to carry out probe and design of primers

(1) probe design principle:

1. guarantee that G-C content is between 20%-80%.

2. first base of probe 5 ' end can not be G.

3. the probe Tm value of calculating with PrimerExpress software should be between 68-70 DEG C.

4. probe is short as much as possible, but is not smaller than 13 bases.

5. avoid same base to repeat too much, particularly G, can not exceed 4 and more than.

6. use containing C more than the probe containing G as far as possible. If C is less than G, use the probe on complementary strand.

7. if SNP, pleomorphism site is positioned at probe central authorities as far as possible.

(2) design of primers principle:

1. after determining, probe selects again primer.

2. primer will approach probe as much as possible, but not overlapping.

3. keep G-C content between 20%-80%.

4. avoid same base to repeat too much. Particularly G, can not exceed 4 and more than.

5. the Tm value of calculating with PrimerExpress software should be between 58-60 DEG C.

6. in 5 bases of 3 ' end, G and C base are added up and are not exceeded 2.

(3) PrimerExpress3.0 method of operating

Enter PrimerExpress3.0 software, File/New/ selects TaqmanMGBAllelic. Paste SNP500bp sequence before and after site, demarcates SNP position and selects variation type. Then select primer/probe to search,Software start to search suitable primer and probe. If there is no primer and the probe of coupling, can manual designs.Determine that VEGFR2 gene Val297Ile site Taqman probe and primer are as follows:

Probe (AppliedBiosystems company):

Probe1(G)：VIC-CCTTAACTATAGATGGTGTAACC-MGB(SEQIDNO.1)；

Probe2(A)：FAM-CTTAACTATAGATGGTATAACC-MGB(SEQIDNO.2)；

VIC absorbing wavelength 515-535nm, emission wavelength 540-560nm;

FAM absorbing wavelength 485-505nm, emission wavelength 515-530nm;

MGB is quenching group.

Primer (AppliedBiosystems company):

Primer-F：5’-CAGTCTGGGAGTGAGATGAAGAAAT-3’(SEQIDNO.3)；

Primer-R：5’-GGTCATCAGCCCACTGGAT-3’(SEQIDNO.4)。

2.SNP detects

2.1PCR amplification system and program

2XMasterMix12.5μl

20XAssayWorkingStock1.25μl

(comprise Probe1,2 and Primer-F, Primer-R)

Nuclease-freewater10.25μl

gDNA1μl(1–20ng)

Totalvolume25μl

Program (AppliedBiosystems7500)

AmpliTaqUP,EnzymeActivation：95℃，10minutes，HOLD

[Denaturation：95℃，15seconds；

Annealing/Extension：60℃，1minute]40cycles

Amplified production (108bp):

CAGTCTGGGAGTGAGATGAAGAAATTTTTGAGCACCTTAACTATAGATGGT

Y (Y refers to VEGFR2 gene Val297Ile site)

TAACCCGGAGTGACCAAGGATTGTACACCTGTGCAGCATCCAGTGGGCTGATGACC(SEQIDNO.7)。

2.2 experimental technique Accuracy Verifications

51 samples to unknown VEGFR2 gene Val297Ile loci gene type are undertaken by this detection methodDetect, experimental result as shown in Figure 1, is wherein got representative 3 samples: No. 45 sample FAM and VICFluorescence intensity is suitable, illustrates that it is AG genotype; No. 46 sample VIC fluorescence intensities (533-580nm)Obviously be greater than FAM fluorescence intensity (465-510nm), illustrate that it is GG genotype; No. 47 sample FAMFluorescence intensity (465-510nm) is obviously greater than VIC fluorescence intensity (533-580nm), illustrates that it is AAGenotype; The negative contrast of NoTemplateControl. Adopt mass spectral analysis to carry out above-mentioned 51 samplesGenotype detection (Fig. 2), wherein No. 45 samples are AG genotype; No. 46 samples are GG genotype;No. 47 samples are AA genotype. We set up the genotype of the corresponding sample that Taqman sonde method detectsIn full accord with known type, show that our TaqmanSNP detection method is successfully set up.

The SNP of 2.3 experiment samples detects

Detect the method for VEGFR2 gene Val297Ile polymorphism according to the Taqman sonde method of above-mentioned foundation,We have carried out somatotype experiment to 51 samples. Experimental result is as shown in table 1, and in table 1, Call representative is analyzedExperimental result (Homozygous1/1 is GG genotype, and Homozygous2/2 is AA genotype,Heterozygous1/2 is AG genotype), the 51 routine samples that detect have 36 examples for GG genotype, 14Example is AG genotype, and 1 example is AA genotype, and three kinds of genotype are distribution in group in Fig. 1 to be concentrated, groupBetween distributional difference obvious. Illustrate further us and successfully set up Taqman sonde method to VEGFR2 geneThe detection method that Val297Ile is polymorphic.

Adopt kit of the present invention can detect quickly rapidly VEGFR2 gene Val297Ile polymorphism,And highly sensitive.

In our early-stage Study, collected 69 routine Parkinsonian's samples, wherein, experimental group (is used L-dopaTreat in 5 years and move obstacle) 32 examples, control group (uses L-dopa treatment not transport above for 8 yearsMoving obstacle) 37 examples. VEGFR2 gene Val297Ile (rs2305948) is carried out to Genotyping experiment, send outThe maximum L-dopa using dosage (mg/day) of existing rs2305948 site AA type [565.00 ± 163.55,P=0.038] be significantly higher than AG type [396.88 ± 200.39] and GG type [300.00 ± 80.18]; And AA typeMAIMS scale value [17.00 ± 5.24, P=0.026] be significantly higher than AG type [8.94 ± 6.53] and GG type[7.86 ± 4.45]. This result shows, the required L-dopa dosage of disturbances in patients with Parkinson disease that carries AA type will be higher than AGType and GG type genotype patient, and the MAIMS scale value of AA type significantly raises, and prompting AA type existsIn the therapeutic process of L-dopa, may there is correlation with dyskinesia. Therefore, VEGFR2 geneTo disturbances in patients with Parkinson disease L-dopa, treatment has certain Clinical significance of MG to Val297Ile.

Table 1Taqman sonde method detects VEGFR2 gene Val297Ile polymorphism result

Claims (1)

1. the preparation that detects VEGFR2 gene Val297Ile loci polymorphism judges disturbances in patients with Parkinson disease pair in preparationApplication on the preparation of the drug susceptibility in the time adopting levodopa treatment, is characterized in that, preparation comprises examinationAgent box, contains following probe in described kit:

VIC-CCTTAACTATAGATGGTGTAACC-MGB；

FAM-CTTAACTATAGATGGTATAACC-MGB；

In described kit, contain following primer:

5’-CAGTCTGGGAGTGAGATGAAGAAAT-3’；

5’-GGTCATCAGCCCACTGGAT-3’；

VIC and FAM are reporter group, VIC absorbing wavelength 515-535nm, emission wavelength 540-560nm;FAM absorbing wavelength 485-505nm, emission wavelength 515-530nm; MGB is quenching group.