CN104726342B - Safflower endogenetic fungus, Thick many candies and its production and use - Google Patents
Safflower endogenetic fungus, Thick many candies and its production and use Download PDFInfo
- Publication number
- CN104726342B CN104726342B CN201310712908.0A CN201310712908A CN104726342B CN 104726342 B CN104726342 B CN 104726342B CN 201310712908 A CN201310712908 A CN 201310712908A CN 104726342 B CN104726342 B CN 104726342B
- Authority
- CN
- China
- Prior art keywords
- safflower
- endogenetic fungus
- many candies
- thick many
- penicillium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Plant Substances (AREA)
- Cosmetics (AREA)
Abstract
The invention provides the safflower endogenetic fungus that a kind of deposit number is CCTCCNo.M2013472（Penicilliumsp.）, additionally provide Thick many candies being prepared by the safflower endogenetic fungus and its preparation method and application.Safflower endogenetic fungus Thick many candies obtained by the present invention have good antioxidation activity, natural can be used as to be applied to the fields such as food, medicine and cosmetics.
Description
Technical field
The present invention relates to a kind of biological polyoses and its production and use, particularly a kind of safflower endogenetic fungus, hide
Safflower endogenetic fungus Thick many candies and its production and use.
Background technology
Safflower (CrocussativusL.) is also referred to as west safflower, safron, is Iridaceae (Iridaceae) crocus
(CrocusL.) herbaceos perennial.It is a kind of rare traditional Chinese medicine in China.Its property sweet taste, there is promoting blood circulation and removing blood stasis, solution
It is strongly fragrant calm the nerves, strengthen immunity, reduce cholesterol the effect of.In recent years, with modern medicine, pharmacy and Protocols in Molecular Biology
Rapid development, find safflower it is antitumor, protection nervous system and anti-disease of cardiovascular system etc. have good effects,
Almost non-toxic side effect.It is used as medicine however, safflower is column cap, yield is extremely low；Again because its resource is extremely limited, cause its valency
Lattice are expensive, are described as always " plant gold ", it is difficult to meet the needs of market.
Plant endogenesis epiphyte (Endophyticfungus) refers to the bacterium lived in inside health plant tissue and organ, is
With host plant during long-term common evolutionary a derivative quasi-microorganism.American scientist Stierle in 1993 etc. is from short
The endogenetic fungus of the isolated one plant of production new type anticancer material taxol of leaf Chinese yew, has started and endogenetic fungus is separated from plant
And to the upsurge of its pharmacological activity and study mechanism.So far research shows that plant endogenesis epiphyte can produce similar to host plant
Or the metabolite of identical active component.Endogenetic fungus is expected to turn into the resource instead of medicinal plant, medicinal so as to solve part
The problem of plant resources shortage.Meanwhile endogenetic fungus is easy to fermented and cultured, it is easy to industrialized production.Fermented using endogenetic fungus
The industrialized production of bioactive substance is realized, product yield can be improved, reduce cost, meet the needs of market.It can also solve
Certainly many resources of medicinal plant resource and ecocrisis caused by a large amount of fell, are advantageous to rare and endangered medicinal plants reserve
Protection.
In the prior art, Escribano etc. (EscribanoJ., PiquerasA., MedinaJ.,
etal.Productionofacytotoxicproteoglycanusingcalluscultureofsaffroncorms
(Crocus sativusL.)[J].J.Biotechnol,1999,73(1):53-59.) research is found, from form corm of saffron point
A kind of proteoglycan separated out can significantly inhibit the growth of external Hela cells, also have to uterus epithelial cancer cells significant thin
Cellular toxicity acts on.Zhao into just etc.（Zhao Chenggang, Qu Weijing, a yellow deep west safflowers petal Thick many candies extraction and purification process and external anti-
Oxidation research [J] food industry, 2012,1:1-4.）West safflower petal Thick many candies are extracted, it was demonstrated that it is free to hydroxyl
Base, DPPH free radicals have certain scavenging action.
At present, it is also considerably less and thick for safflower endogenetic fungus for the research report in terms of safflower endogenetic fungus
The development and application of polysaccharide more needs people and is further explored and studied.
The content of the invention
An object of the present invention is to provide a kind of safflower endogenetic fungus（Penicilliumsp.）.
Realize that the technical scheme of above-mentioned purpose is as follows.
A kind of safflower endogenetic fungus（Penicilliumsp.）, its deposit number is CCTCCNo.M2013472.
Above-mentioned safflower endogenetic fungus（Penicilliumsp.）Application in safflower endogenetic fungus Thick many candies are prepared.
It is a further object of the present invention to provide a kind of safflower endogenetic fungus Thick many candies.
Concrete technical scheme is as follows.
A kind of safflower endogenetic fungus Thick many candies, it is in CCTCCNo.M2013472 safflower by deposit number
Raw fungi（Penicilliumsp.）It is prepared.
It is a further object of the present invention to provide a kind of preparation method of safflower endogenetic fungus Thick many candies.
Realize that the technical scheme of the purpose is as follows.
A kind of preparation method of safflower endogenetic fungus Thick many candies, comprises the following steps：
（1）Using safflower endogenetic fungus of the PYG fluid nutrient medium to deposit number as CCTCCNo.M2013472
（Penicilliumsp.）Fermented, tunning is filtered, obtain zymotic fluid；
（2）By step（1）Gained zymotic fluid, concentrated, centrifugation, ethanol precipitation, centrifugation, washing precipitate and drying, i.e.,
.
In one of the embodiments, the step（2）For：By the zymotic fluid, concentration, precipitation is abandoned in centrifugation, takes supernatant
Liquid；Supernatant is added slowly with stirring more than 3 times（More preferably 3~5 times）The ethanol of volume, stand, centrifugation, must precipitate
Thing；The sediment is washed with absolute ethyl alcohol, acetone successively, is dried, is produced safflower endogenetic fungus Thick many candies.
In one of the embodiments, step（1）Described in the operating condition fermented be：Inoculum concentration：More than 1%（More preferably
For 1~5%, V/V）, fermentation temperature：25~28 DEG C, shaking speed：100~200r/min, fermentation period：5~10 days.
In one of the embodiments, the formula of the PYG fluid nutrient medium is：0.5~1.5g of yeast extract, peptone
1.5~2.5g, 8~12g of glucose, 1.5~2.5g of sodium chloride, pH6.8~7.2, add deionized water to cumulative volume 1000mL.
It is a further object of the present invention to provide the application of above-mentioned safflower endogenetic fungus Thick many candies.
Concrete technical scheme is as follows.
Application of the above-mentioned safflower endogenetic fungus Thick many candies in antioxidant is prepared.
Above-mentioned safflower endogenetic fungus Thick many candies can prepare answering for food, medicine or cosmetics as antioxidant
With.
A kind of antioxidant, its active material include above-mentioned safflower endogenetic fungus Thick many candies.
Safflower endogenetic fungus of the present invention（Penicilliumsp.）State is preserved on October 14th, 2013
Depositary institution's China typical culture collection center (CCTCC, the address that Department of Intellectual Property of family specifies：Wuhan University), preservation day
October 14 2013 phase, deposit number CCTCCNo.M2013472.
The present invention has the advantages that：
The present invention for medicinal plant safflower scarcity of resources, can it is few with composition, culture be difficult to scale up caused by yield
The problem of low, expensive, according to the symbiosis theory of plant endogenesis epiphyte, a kind of new safflower endogenetic fungus is separated to, then
Using its metabolite as source new drugs, there is provided a kind of safflower endogenetic fungus Thick many candies, gained Thick many candies have significant antioxygen
Change activity, show obvious dose-effect correlation.In 1.00mg/mL, to the clearance rates of DPPH free radicals for 83.45 ±
0.18%；In 1.600mg/mL, the clearance rate to hydroxy radical is 81.31 ± 1.33%；In 6.0000mg/mL, to super oxygen
Radical anion clearance rate is 53.28 ± 1.72%；And it can effectively suppress Rat Erythrocytes haemolysis and have to lipid peroxidation
Significantly protective effect, can in inhibition system MDA generation：In 2.0mg/mL, it is to Rat Erythrocytes haemolysis inhibiting rate
94.91 ± 2.56%, it is 86.35 ± 5.01% to MDA generation inhibiting rates.Result of the test shows, safflower endogenetic fungus Thick many candies
Have the function that to remove free radical and anti-lipid peroxidation, be a kind of natural antioxidant, can be applied to food, medicine and
The fields such as cosmetics.
Present invention also offers the preparation method of the safflower endogenetic fungus Thick many candies, is fermented and realized using endogenetic fungus
The industrialized production of the bioactive substance, yield can be improved, reduce product cost, meet the needs of market.
Brief description of the drawings
Fig. 1 is the bacterium colony front of endogenetic fungus of the present invention.
Fig. 2 is the bacterium colony back side of endogenetic fungus of the present invention.
Fig. 3 is the microstructure of endogenetic fungus of the present invention（200 times）.
Fig. 4 is the examination that the safflower endogenetic fungus Thick many candies of various concentrations are acted on DPPH radicals scavengings in embodiment 2
Test result.
Fig. 5 is the experiment of the safflower endogenetic fungus Thick many candies of various concentrations to Hydroxyl Radical Scavenging in embodiment 2
As a result.
Fig. 6 is that the safflower endogenetic fungus Thick many candies of various concentrations are removed to ultra-oxygen anion free radical to be made in embodiment 2
Result of the test.
Fig. 7 is in embodiment 2, and the safflower endogenetic fungus Thick many candies of various concentrations press down to Rat Erythrocytes oxidative hemolysis
The result of the test of making.
Fig. 8 is the suppression that the safflower endogenetic fungus Thick many candies of various concentrations generate to Rat Erythrocytes MDA in embodiment 2
The result of the test of making.
Embodiment
The present invention is described in further detail with specific embodiment below in conjunction with the accompanying drawings.
Embodiment 1
The present embodiment is the preparation method embodiment of safflower endogenetic fungus Thick many candies.
1st, the preparation of culture medium：
PDA culture medium and PYG fluid nutrient medium of the present invention are to match somebody with somebody by the following method.
（1）PDA culture medium（Potato dextrose agar）：Potato 200g（Peeling, is cut into small pieces, appropriate deionized water
20min is boiled, filtered through gauze, abandons mashed potato, takes filtrate）, glucose 10g, agar 15g, pH are naturally, deionized water is settled to
1000mL。
（2）PYG fluid nutrient medium：Yeast extract 1g, peptone 2g, glucose 10g, sodium chloride 2g, pH6.8~7.2, go
Ionized water is settled to 1000mL.
Sterilized using preceding culture medium at 121 DEG C of temperature, pressure 0.1MPa 20min.
2nd, the activation of strain：
The endogenetic fungus, it is by strict processes for disinfecting surfaces, is separated with endogenetic fungus, purification technique, from strong
The form corm of saffron of health is isolated.The Species estimation of this plant of bacterium is Penicilliumsp..It is deposited in Chinese Typical Representative culture
Collection（CCTCC）, preservation date on October 14th, 2013, deposit number CCTCCNo.M2013472.
Aseptically, it is preserved in the safflower endogenetic fungus of PDA slant mediums a little with oese picking
（Penicilliumsp.）Strain, transfer in the culture dish equipped with PDA culture medium, put in climatic chamber, humidity 80%,
Temperature is 28 DEG C, activation culture 5 days, obtains activated spawn.
The endogenetic fungus, 28 DEG C of PDA culture medium are cultivated 3 days, bacterium colony straight stem 24mm, 5 days 30mm, 7 days 39mm.Bacterium colony causes
It is close, edge whitening color, more neatly, middle part dark green granular spore；The bacterium colony back side is colourless.Micro- sem observation mycelium tool is horizontal
Every wall is smooth, verticillate, and conidium is spherical, bunchiness growth.（Referring to Fig. 1,2,3）
The internal transcribed spacer sequence (ITS) of endogenetic fungus of the present invention is as follows：
CGTCTCCCTCCTGATCCGAGGTCACCTGGATAAAAATTTGGGTTGATCGGCAAGCGCCGGCCGGGCCTACAGAGCGG
GTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGATCGGAGG
ACGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGG
CGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTC
ATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAAATAATTTATATTTTCACTCAGACTACAATCTTCAGA
CAGAGTTCGAGGGTGTCTTCGGCGGGCGCGGGCCCGGGGGCGTAAGCCCCCCGGCGGCCAGTTAAGGCGGGCCCGCC
GAAGCAACAAGGTAAAATAAACACGGGTGGGAGGTTGGACCCAGAGGGCCCTCACTCGGTAATGATCCTTCCGCAGG
TTCACCTACGGAAACCTTGTTACGATTTTTTACTTCC（SEQ ID NO.1).
3rd, seed culture：
Activated spawn is aseptically broken into a diameter of 6mm fungus block with card punch, 2 ferfas blocks are inoculated in and are equipped with
In the 500mL triangular flasks of 250mLPYG fluid nutrient mediums, shaking table culture, rotating speed 120r/min, 28 DEG C are cultivated 3 days, obtain seed training
Nutrient solution.
4th, fermented and cultured：
Seed culture fluid is inoculated into the 500mL triangular flasks equipped with 250mL PYG fluid nutrient mediums, shaking table culture, connect
Kind amount 2%, rotating speed 120r/min, 28 DEG C are cultivated 7 days, filtered through gauze thalline, obtain zymotic fluid.
5th, alcohol precipitation, washing, drying
By above-mentioned zymotic fluid, the 1/4 of original volume (1L) is concentrated in vacuo to, precipitation is abandoned in centrifugation, takes supernatant.Under agitation to
Supernatant is slowly added to 4 times of volumes 95%（V/V）Ethanol, 4 DEG C of standing 12h, 4000r/min centrifugation 15min, obtains sediment.It is heavy
Starch is washed with absolute ethyl alcohol, acetone successively, each to wash three times.60 DEG C of vacuum drying, produce brown color Thick many candies.
Embodiment 2：
The present embodiment is the antioxidation in vitro system carried out to the safflower endogenetic fungus Thick many candies being prepared in embodiment 1
Row experiment, obtained experimental result is as shown in Fig. 4~Fig. 8.
1st, test method
（1）To the clearance test of DPPH free radicals
The Thick many candies solution of 0.5mL various concentrations is added in sample cell（Final concentration is respectively 0.05,0.10,0.20,
0.30th, 0.40,0.50,0.75 and 1.00mg/mL）80% is dissolved in 3.5mL 0.1mmol/L（V/V）The DPPH solution of ethanol
(now with the current)；In sample controls group DPPH solution is replaced with 80% ethanol；In blank group Thick many candies solution is replaced with distilled water.
After each experimental group solution mixes above, dark place is put, after room temperature places 30min, is adjusted with 0.5mL distilled water and 3.5mL80% ethanol
Zero, at 517nm, 1cm optical paths, survey each pipe absorbance.Vitamin C（Vc）For positive control.Press formula and calculate Thick many candies pair
DPPH free radical scavenging activities.
DPPH clearance rates %=100 × [ABlank–(ASample-ASample pair)]/ABlank
（2）To the clearance test of hydroxy radical
The test method is carried out by hydroxy radical test cassette method, and specific test method is said referring to hydroxy radical testing cassete
Bright book（Bioengineering Research Institute, article No. A018 are built up in Nanjing）.According to Fenton reaction principles, Thick many candies solution 0.2mL is taken（Eventually
Concentration is respectively 0.025,0.050,0.100,0.200,0.400,0.800,1.200 and 1.600mg/mL）, sequentially add reaction
Reagent, mix, 37 DEG C of water bath with thermostatic control reaction 1min add developer terminating reaction, mix.After room temperature places 20min, 1cm light
Footpath, 550nm, distilled water zeroing, survey each pipe absorbance.In control tube Thick many candies solution is replaced with isometric distilled water.Vc
For positive control.Press formula and calculate clearance rate of the Thick many candies to hydroxy radical.
Clearance rate %=100 of hydroxy radical ×（AIt is right-ASample）/AIt is right
（3）To the clearance test of ultra-oxygen anion free radical
The test method is to be carried out by suppression with producing ultra-oxygen anion free radical kit, and specific test method is referring to suppression
System is with producing ultra-oxygen anion free radical kit specification（Bioengineering Research Institute, article No. A052 are built up in Nanjing）.Analog machine
Xanthine and xanthine oxidase reaction system, take the μ L of Thick many candies solution 50 in body（Final concentration is respectively 0.0625,0.1250,
0.2500th, 0.5000,1.0000,2.0000,4.0000 and 6.0000mg/mL), sequentially add reaction reagent, 37 DEG C of thermostatted waters
Bath reaction 40min, adds chromogenic reagent, mixes, determine absorbance after 10min at 550nm.Used in equal volume in control tube
Distilled water replaces Thick many candies solution.Vc is positive control.Press formula and calculate removing of the Thick many candies to ultra-oxygen anion free radical
Rate.
Clearance rate %=100 of ultra-oxygen anion free radical ×（AIt is right-ASample）/AIt is right
（4）Suppress H2O2Induced rat erythrocyte hemolysis and MDA（MDA) generation experiment
SD rats eye socket is taken a blood sample, liquaemin anti-freezing, and 10min is centrifuged with 3000r/min rotating speed, removes supernatant, separation
Red blood cell, brine three times after, be made concentration of volume percent be 1% Rat Erythrocytes suspension.Sample measure group
For the Thick many candies solution of 0.5mL various concentrations（Final concentration is respectively 0.1,0.4,0.8,1.2,1.6 and 2.0mg/mL）, add
1mL1% Rat Erythrocytes suspension, 0.2mLH2O2（Final concentration of 100mmol/L）；The isometric physiological saline of sample controls group
Instead of 1% Rat Erythrocytes suspension；Normal group replaces Thick many candies solution and H with isometric physiological saline2O2；The bodies such as model group use
Long-pending physiological saline replaces Thick many candies solution.Shake up, after 37 DEG C are incubated 1h, 3000r/min, centrifuge 10min.Supernatant 1mL is taken,
After 3mL normal saline dilutions, at 415nm, 1cm optical paths, physiological saline zeroing, each pipe absorbance is determined.Supernatant is taken again
0.2mL, by MDA（MDA）Test cassette method（Bioengineering Research Institute, article No. A003-1 are built up in Nanjing）Determine MDA in each pipe
Content.Vc is positive control.With below equation according to calculating Thick many candies inhibiting rate.
Hemolysis rate %=100 ×（ASample-ASample pair）/AMould
Haemolysis inhibiting rate %=100 ×（Model group hemolysis rate-sample sets hemolysis rate）/（Model group hemolysis rate-normal group haemolysis
Rate）
MDA contents（nmol/mL）=[（ASurvey-AControl）/（AStandard-ABlank）] × standard concentration（10nmol/mL）
MDA generation inhibiting rates %=100 ×（Model group MDA contents-sample sets MDA contents）/（Model group MDA contents-normal
Group MDA contents）
2nd, result of the test
（1）Thick many candies represent that clearance rate is higher with clearance rate to the Scavenging activity of DPPH free radicals, illustrate Thick many candies antioxygen
Change effect is stronger.As shown in Figure 4, the safflower endogenetic fungus Thick many candies have significant Scavenging activity to DPPH free radicals, clearly
Significantly increased except acting on the increase of concentration.In the concentration range that concentration is 0.05~1.00mg/mL, its clearance rate
For 9.38 ± 0.42%~83.45 ± 0.18%.
（2）As shown in Figure 5, scavenging action of the Thick many candies to hydroxy radical is strong, and its scavenging action is in 0.025~1.600mg/
Show positive correlation dose-effect relationship in mL dosage ranges.The Thick many candies when concentration is 1.600mg/mL, clearance rate reaches 81.31 ±
1.33%.Illustrate that Thick many candies have very strong scavenging capacity to hydroxy radical.
（3）It will be appreciated from fig. 6 that with the increase of Thick many candies concentration, scavenging capacity of the Thick many candies to ultra-oxygen anion free radical
Also progressively increase, but whole capability is slightly weak, when concentration is 6.0000mg/mL, the clearance rates of the Thick many candies for 53.28 ±
1.72%.Illustrate that the Thick many candies have certain scavenging capacity to ultra-oxygen anion free radical.
（4）From Fig. 7,8, Thick many candies can effectively suppress Rat Erythrocytes haemolysis and MDA generation.With thick more
The increase of sugared concentration, haemolysis inhibiting rate strengthen, and MDA content also gradually decreases in system.It is described when concentration is 2.0mg/mL
It is 94.91 ± 2.56% that Thick many candies, which suppress erythrocyte hemolysis rate, is 86.35 ± 5.01% to MDA generation inhibiting rates.Illustrate Thick many candies
With the activity for suppressing H2O2 induced rats erythrocyte hemolysis and MDA generations.
Embodiment described above only expresses the several embodiments of the present invention, and its description is more specific and detailed, but simultaneously
Therefore the limitation to the scope of the claims of the present invention can not be interpreted as.It should be pointed out that for one of ordinary skill in the art
For, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the guarantor of the present invention
Protect scope.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
Claims (8)
1. safflower endogenetic fungus (Penicillium sp.), it is characterised in that its deposit number is CCTCC No.M
2013472。
2. safflower endogenetic fungus (Penicillium sp.) described in claim 1 is to prepare safflower endogenetic fungus slightly more
Application in sugar.
3. a kind of safflower endogenetic fungus Thick many candies, it is characterised in that it by deposit number is CCTCC No.M that it, which is,
What 2013472 safflower endogenetic fungus (Penicillium sp.) was prepared, preparation process includes：
(1) using safflower endogenetic fungus of the PYG fluid nutrient medium to deposit number as CCTCC No.M 2013472
(Penicillium sp.) is fermented, and tunning is filtered, obtains zymotic fluid；
(2) zymotic fluid obtained by step (1), concentration, centrifugation are abandoned precipitation, takes supernatant；Supernatant is added slowly with stirring
The ethanol of more than 3 times volumes of clear liquid, stand, centrifugation, obtain sediment；The sediment is washed with absolute ethyl alcohol, acetone successively,
Taking precipitate, dry, produce safflower endogenetic fungus Thick many candies；
The operating condition fermented described in step (1) is：Inoculum concentration：More than 1% (V/V), fermentation temperature：25~28 DEG C, shaking table
Rotating speed：100~200r/min, fermentation period：5~10 days.
4. a kind of preparation method of safflower endogenetic fungus Thick many candies, comprises the following steps：
(1) using safflower endogenetic fungus of the PYG fluid nutrient medium to deposit number as CCTCC No.M 2013472
(Penicillium sp.) is fermented, and tunning is filtered, obtains zymotic fluid；
(2) zymotic fluid obtained by step (1), concentration, centrifugation are abandoned precipitation, takes supernatant；Supernatant is added slowly with stirring
The ethanol of more than 3 times volumes of clear liquid, stand, centrifugation, obtain sediment；The sediment is washed with absolute ethyl alcohol, acetone successively,
Taking precipitate, dry, produce safflower endogenetic fungus Thick many candies；
The operating condition fermented described in step (1) is：Inoculum concentration：More than 1% (V/V), fermentation temperature：25~28 DEG C, shaking table
Rotating speed：100~200r/min, fermentation period：5~10 days.
5. preparation method according to claim 4, it is characterised in that the formula of the PYG fluid nutrient medium is：Yeast soaks
0.5~1.5g of cream, 1.5~2.5g of peptone, 8~12g of glucose, sodium chloride 1.5~2.5g, pH 6.8~7.2, add deionization
Water is to cumulative volume 1000mL.
6. application of the safflower endogenetic fungus Thick many candies in antioxidant is prepared described in claim 3.
7. the safflower endogenetic fungus Thick many candies described in claim 3 are preparing food, medicine or cosmetics as antioxidant
Application.
8. a kind of antioxidant, it is characterised in that it is slightly more that its active material includes safflower endogenetic fungus described in claim 3
Sugar.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310712908.0A CN104726342B (en) | 2013-12-20 | 2013-12-20 | Safflower endogenetic fungus, Thick many candies and its production and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310712908.0A CN104726342B (en) | 2013-12-20 | 2013-12-20 | Safflower endogenetic fungus, Thick many candies and its production and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104726342A CN104726342A (en) | 2015-06-24 |
| CN104726342B true CN104726342B (en) | 2018-02-13 |
Family
ID=53450762
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310712908.0A Active CN104726342B (en) | 2013-12-20 | 2013-12-20 | Safflower endogenetic fungus, Thick many candies and its production and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104726342B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106916853A (en) * | 2017-02-23 | 2017-07-04 | 南京博方生物科技有限公司 | The method for preparing bioactivator using plant base raw material and endophyte co-cultivation |
| CN112679272B (en) * | 2021-02-20 | 2022-07-19 | 长兴县中医院 | Biological bacterial fertilizer for saffron crocus and preparation method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559799A (en) * | 2011-01-27 | 2012-07-11 | 河北工业大学 | Preparation method for algae endophytic fungi exocellular polysaccharide |
-
2013
- 2013-12-20 CN CN201310712908.0A patent/CN104726342B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559799A (en) * | 2011-01-27 | 2012-07-11 | 河北工业大学 | Preparation method for algae endophytic fungi exocellular polysaccharide |
Non-Patent Citations (2)
| Title |
|---|
| 一株藏红花内生真菌多糖的提取及抗氧化活性研究;温露等;《时珍国医国药》;20111231;摘要，第1850页正文右栏第2段，第1.2、2.1、2.2、3.2、4小节 * |
| 藏红花内生真菌的分离和代谢产物的初步研究;焉兆萍等;《上海师范大学学报(自然科学版)》;20100228;71-77 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104726342A (en) | 2015-06-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107245457A (en) | A kind of extracting method and application of dendrobium candidum endogenetic fungal bacterial strain and its exocellular polysaccharide of generation and the exocellular polysaccharide | |
| Wang et al. | Quorum sensing molecule-farnesol increased the production and biological activities of extracellular polysaccharide from Trametes versicolor | |
| CN104672339A (en) | Cordyceps cicadae rhzomorph as well as preparation method and application thereof | |
| CN105695347A (en) | Strain producing pullulan, application thereof and pullulan production method | |
| CN104262502A (en) | Extraction method of ganoderma lucidum crude polysaccharide | |
| CN109295122A (en) | A kind of Preparation method and use of E. exserta endogenetic fungus Chaetomium sp secondary metabolite | |
| CN104726342B (en) | Safflower endogenetic fungus, Thick many candies and its production and use | |
| CN101397579A (en) | Method for preparing natamycin | |
| Zhang et al. | Effect of the extracts from Gastrodia elata BL. on mycelial growth and polysaccharide biosynthesis by Grifola frondosa | |
| Xiao et al. | Antioxidative potential of polysaccharide fractions produced from traditional Chinese medicinal macrofungus Cordyceps jiangxiensis in vitro | |
| CN103408550B (en) | Derive from 2,5-diketopiperazines dipeptides and the Synthesis and applications thereof producing the molten bacillus of enzyme | |
| CN106636252A (en) | Thelephora ganbajun Zang exopolysaccharide, preparation method thereof and application of exopolysaccharide | |
| CN104726343B (en) | Safflower endogenetic fungus, Thick many candies and its production and use | |
| CN103724290A (en) | Cyclopeptide compound clavatustide A as well as producing strain, preparation method and application thereof | |
| CN104450541B (en) | One plant of safflower endogenetic fungus and its Thick many candies and preparation method and purposes | |
| CN105661491A (en) | Peach gum health product and preparation method and application thereof | |
| Tonucci-Zanardo et al. | In vitro antimicrobial activity of aqueous extracts from Lentinula edodes isolates against Colletotrichum sublineolum and Xanthomonas axonopodis pv. Passiflorae | |
| CN101671385B (en) | Triterpene glycosides antifungal compounds of sea cucumber HolotoxinD-I and preparation method thereof | |
| CN106755184A (en) | Thelephora ganbajun mycelium polysaccharide and its preparation method and application | |
| CN102746995A (en) | Preparation method for isochromophilone VIII and application of same in preparation of antineoplastic drugs | |
| CN103641791B (en) | Cyclopeptide compound clavatustide B, and preparation method and application thereof | |
| CN101402951B (en) | Immobilization method for glossy ganoderma cell | |
| CN108342325B (en) | A kind of anthraquinone analog compound and its preparation method and application in Cordyceps cicadae source | |
| KR20050055161A (en) | The manufacturing method of enhanced mycelium for function using herbs resources(puerariae radix, artemisiae vulgaris folium) and its product | |
| CN100497595C (en) | Extract of soil actinomycetes fermenting liquid and its preparation and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |