CN104711257A - Guide RNA target points for treating hepatitis B virus infection - Google Patents
Guide RNA target points for treating hepatitis B virus infection Download PDFInfo
- Publication number
- CN104711257A CN104711257A CN201510067097.2A CN201510067097A CN104711257A CN 104711257 A CN104711257 A CN 104711257A CN 201510067097 A CN201510067097 A CN 201510067097A CN 104711257 A CN104711257 A CN 104711257A
- Authority
- CN
- China
- Prior art keywords
- hbv
- sequence
- guiding rna
- expression vector
- grna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides 15 guide RNA (short guide RNA, gRNA) target points for treating hepatitis B virus (HBV) infection and a use thereof for preparation of drugs for treating HBV infection. Multi-genotype HBV covalently closed circular DNA (cccDNA) is efficiently destructed through a CRIPSR/Cas system, so as to inhibit HBV replication. A number of control regions and coding regions of HBV are covered by the gRNA target points.
Description
Technical field
The present invention relates generally to molecular biology, cytobiology and field of gene.More specifically, the present invention relates to for hepatitis B virus (Hepatitis B virus, HBV) 15 guiding RNA (short guide RNA for the treatment of of infection, gRNA) target spot, the guiding RNA obtained by these target spots and recombinant expression vector thereof, and apply these target spots and guiding RNA obtain in every way for HBV infection treatment medicine and method.
Background technology
Antiviral at present for HBV is nucleotide analog and Interferon, rabbit.Although, nucleotide analog (Nucleotide, NAs) by suppressing the active high-effect inhibition HBV replication of HBV polysaccharase, but it is to HBV covalently closed circular DNA (Covalently closed circular DNA, cccDNA) without effect, because cccDNA is the masterplate of hbv replication, its transformation period can reach the several years to many decades, so NAs can not remove HBV in a short time, the factors such as the low or resistance of immunity of organisms all can bring out HBV reactivation and hepatitis recurrence.Although, interferon alpha (IFN-α) can remove the HBV in a part of the infected's body, and experiment in vitro confirms the IFN-α degradable cccDNA of high dosage, but it removes ratio lower (<8%), and there is very strong side effect due to the IFN-α of high dosage, body can not tolerate.Therefore, HBV cccDNA is the large obstacle in chronic hepatitis B (hepatitis B) therapeutic process, there is no the method for high-efficient cleaning except HBV cccDNA at present.
CRISPR/Cas system is a kind of instrument that can carry out target editor to genomic dna newly grown up recent years.This system is a kind of system of defense tackling the foreign DNAs such as virus be present in bacterium originally.In some bacterial genomes, there is the DNA sequence dna of a series of cluster arrangement, be referred to as " the short palindrome tumor-necrosis factor glycoproteins of regular intervals cluster " (Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR).The intervening sequence of these tumor-necrosis factor glycoproteinss, is found identical with the phage DNA sequence that much can invade bacterium.And, these sequences are being transcribed into after for RNA, one class that can produce with host bacteria is called that the protein of Cas (CRISPR associated) forms complex body, guide effect is played to Cas albumen, therefore this section of RNA is also referred to as guiding RNA (guide RNA, gRNA).When complex body detects that DNA with the gRNA sequence of invasion is consistent, CRISPR/Cas system can identify the special fragment in exogenous nucleic acid, motif (i.e. Protospacer Associated Motif, PAM) is adjoined containing prototype intervening sequence in this special fragment.Cas albumen arrive the specific site of PAM recognition sequence thus and foreign DNA is fixed a point, special cutting, reach the modification of DNA sequence dna or the object of editor.
Strictly speaking, in bacterial body, gRNA is made up of two portions: a part is for coming from transcribed spacer, identifying crRNA (the CRISPR RNA of invader dna, crRNA), the tracrRNA (trans-activating crRNA, tracrRNA) of another part needed for activation Cas albumen.In artificial constructed CRISPR-Cas9 systemic vectors, these two sections of RNA can permeate bar, are called guiding RNA (guide RNA, gRNA).
CRISPR-Cas system in bacterium is very various, and one come self-produced Streptococcus pyrogenes (Streptococcus pyogenes) the system participated in by Cas9 albumen by people study the most thorough.Therefore people transform it, the sequence of coding Cas9 albumen and subsidiary component co-manufactured thereof are become a single carrier.After proceeding to host cell, the artificial constructed gRNA of generation just can instruct the specific DNA sequence dna of Cas9 Protein cleavage host cell, thus plays the effect of gene editing.
Based on CRISPR-Cas system, develop the novel method being more effectively used for HBV infection treatment by being expected to, the method needs to provide the gRNA target spot effectively removing HBV cccDNA.Present invention accomplishes this requirement, provide for the gRNA target spot of this object, gRNA and recombinant expression vector etc.
Summary of the invention
In order to overcome the above problems, the invention provides the gRNA target spot of target HBV, comprise or the expression vector of gRNA target spot that complementation the present invention relates to, recombinant vectors and host cell for building, and can obtain for obtaining the medicine including and obtained by the gRNA target spot that the present invention relates to.
GRNA target spot provided by the invention can target HBV, can destroy covalently closed circular DNA and inhibition HBV replication.GRNA target spot provided by the invention obtains by the following method: select design can the gRNA target sequence of target HBV, gRNA is built by designing suitable primer, and be cloned into expression vector and obtain corresponding gRNA expression vector, this carrier being carried out cotransfection experiments with HBV expression vector respectively, obtaining suitable gRNA target spot by detecting the Analysis and Screening such as HBsAg level and qualification suppression specificity.
The invention provides the guiding RNA target sequence of a kind of target HBV, it is selected from one of following sequence:
(1) sequence in SEQ ID NOs:1-15 described in any one;
(2) with sequence in (1), there is at least 70% (preferably at least 80%, 85%, 90%, 95%, 99% or higher) conforming sequence;
(3) nucleotide sequence can hybridized with sequence in (1) under strict conditions or under high stringency;
(4) sequence only having 1-3 (preferred 1-2, more preferably 1) Nucleotide different with the sequence in (1); And
(5) with the fragment of sequence in (1)-(4) or complementary sequence.
In concrete at one, described gRNA target sequence can target HBV A, B, C or D type gene.
In an embodiment of the invention, gRNA target sequence N
18-20meet following structure: in 5 '-Nx-NGG-3 ', NGG, N represents any one in A, G, C and T, in Nx, N represents any one of A, G, C and T, x=18-20.
The present invention goes back providing package containing the nucleic acid construct of guiding RNA target sequence according to the present invention or carrier as expression vector.
The present invention also provides guiding RNA that guiding RNA target sequence according to the present invention obtains, that can destroy covalently closed circular DNA or inhibition HBV replication or reduction HBsAg.
In one embodiment, gRNA of the present invention is formed by connecting by the RNA fragment that can combine with target sequence complementation and skeleton RNA fragment successively, and skeleton RNA fragment can be combined with Cas nuclease.Specifically, the RNA fragment that can combine with target sequence complementation in gRNA is can Nx (N middle with 5 '-Nx-NGG-3 '
18-20) fragment complementation combine RNA fragment.Preferably, gRNA comprises the fragment that can be combined with following target sequence, and it is selected from one of following sequence:
(1) sequence in SEQ ID NOs:1-15 described in any one;
(2) with sequence in (1), there is at least 70% (preferably at least 80%, 85%, 90%, 95%, 99% or higher) conforming sequence;
(3) nucleotide sequence can hybridized with sequence in (1) under strict conditions or under high stringency;
(4) sequence only having 1-3 (preferred 1-2, more preferably 1) Nucleotide different with the sequence in (1); And
(5) with the fragment of sequence in (1)-(4) or complementary sequence.
In one preferred embodiment, the gRNA sequence containing the gRNA target sequence obtained by the present invention can make cell obtain the ability of inhibition HBV replication and viral gene expression after importing liver cell.
The present invention also provides the recombinant expression vector can expressing guiding RNA of the present invention.
In one embodiment, the recombinant expression vector of guiding RNA of the present invention has following characteristics: the gRNA sequence containing guiding RNA target sequence provided by the invention, these gRNA sequences are operably connected with expression control sequenc, making can at eukaryotic cell (particularly mammalian cell, as people's cell, preferred liver cell and stem cell) the middle gRNA expressing target HBV.
Recombinant expression vector of the present invention can be plasmid vector or virus vector.
The present invention goes back the host cell of providing package containing lead RNA target sequence or nucleic acid construct of the present invention or carrier or guiding RNA of the present invention or recombinant expression vector of the present invention of the present invention, comprise prokaryotic cell prokaryocyte (as bacterial cell, Bacillus coli cells) and eukaryotic cell (as fungal cell, insect cell, vegetable cell, zooblast, particularly mammalian cell is as people's cell, preferred liver cell and stem cell).
The invention still further relates to the pharmaceutical composition for the treatment of or prevention HBV infection or HBV patient, its comprise in the guiding RNA that gRNA target sequence provided by the invention obtains one or more and/or comprise in the recombinant expression vector of described guiding RNA one or more, and optional pharmaceutical carrier.
The invention still further relates to comprise gRNA target sequence provided by the invention obtain guiding RNA in one or more and/or comprise described guiding RNA recombinant expression vector in one or more preparation treatment or prevention HBV infection or HBV patient medicine in purposes.
The invention still further relates to one or more and/or one or more purposes destroyed covalently closed circular DNA or inhibition HBV replication in preparation or reduce in the medicine of HBsAg of comprising in the recombinant expression vector of described guiding RNA of comprising in guiding RNA that gRNA target sequence provided by the invention obtains.
The invention still further relates to the application of any one in screening Anti-HBV drugs in the nucleic acid construct or carrier/or guiding RNA/ or recombinant expression vector or host cell of the present invention comprising guiding RNA target sequence provided by the invention or gRNA target sequence provided by the invention acquisition.
The present invention also provides the method for inhibition HBV replication, comprise in the guiding RNA that the gRNA target sequence provided by the invention of effective dose is obtained one or more and/or comprise in the recombinant expression vector of described guiding RNA one or more be administered to patient.
The present invention also provides the method for inhibition HBV replication, comprises the following steps:
(1) by one or more in the guiding RNA of gRNA target sequence acquisition provided by the invention and/or one or more importing host cells comprised in the recombinant expression vector of described guiding RNA or organism; And
(2) express gRNA target sequence provided by the invention obtain guiding RNA in one or more and/or comprise described guiding RNA recombinant expression vector in one or more, and under expressed guiding RNA and the acting in conjunction of Cas9 nuclease, destroy covalently closed circular DNA.
Beneficial effect of the present invention
The invention provides the gRNAs target sequence that efficiently can destroy HBV cccDNA based on CRISPR/Cas system.These gRNAs obtained by the gRNA target sequence of target HBV pass through design, screening, select the shearing effectively both can carrying out separately single site, and then cause inserting or disappearance (Insertion-deletion by non-homologous end joining (Non-homologous End Joining-NHEJ) recombination mechanism, InDel) suddenly change, the shearing of multidigit point is carried out again by multiple combination, while increase InDel mutation rate, cause the disappearance of DNA fragmentation between shearing site; The combined utilization of multiple gRNA, can destroy HBVcccDNA to a greater degree, makes its fragmentation, thus the possibility losing hbv replication and propagate again, fundamentally eliminate infection and the infection of HBV.
In addition, gRNA target sequence provided by the invention for multiple genotype of HBV, can be applicable to the HBV patient of different genotype simultaneously.In the patient using conventional medicament interferon therapy, A type curative effect is best, is secondly D type, is then Type B, and the most refractory is C type.The hepatitis B virus genotypes of China's Chronic Hepatitis B, C type is for accounting for 60%, and Type B is 30%, and south is based on Type B, and the north, based on C type, separately has minority to be that D type and B+C type mixed type infect.Therefore, the chronic viral hepatitis B of China is than western countries' more refractory treatment.And gRNA target sequence provided by the invention is simultaneously for multiple genotype of HBV, there is not the situation different to the reactivity of pharmaceutical composition provided by the invention because Patient genotype is different, than conventional medicament, there is higher broad spectrum.
The gRNA obtained by gRNA target sequence provided by the invention or the pharmaceutical composition etc. comprising described gRNA obviously can suppress copying of HBV, stronger restraining effect is had to the secretion of hepatitis B e, s antigen, significantly can reduce the content of HBsAg in serum, HBeAg, less to cytotoxicity, to HBV, there is good curative effect and side effect is little.
Below in conjunction with accompanying drawing, the present invention will be described in more detail.From detailed description hereafter, above-mentioned aspect of the present invention and other aspects of the present invention will be obvious.
Accompanying drawing explanation
Fig. 1 is the schematic diagram that gRNA sequence distributes in HBV gene group.
Fig. 2 illustrates the ability of 15 gRNAs inhibition HBV replications.
Fig. 3 illustrates that 11 kinds of two RNA are on the impact of A, B and C genotype hbv replication level.
Fig. 4 illustrates the shearing action of 5 kinds of two gRNA combinations to HBV DNA.
Fig. 5 illustrates the destruction of HBV gRNA to HBV cccDNA.
Embodiment
Unless stated otherwise, term of the present invention has the normally used implication in this area.
The invention provides can the gRNA target spot of target HBV, any one or the several sequence that comprise following sequence or have with it at least 70% (preferably at least 80%, 85%, 90%, 95%, 98% or higher) conforming sequence: SEQ ID NO:1-15.
Consistence (identity) can calculate according to method well known in the art.The preferred example being suitable for the algorithm determining sequence identity and sequence similarity percentage ratio is BLAST and BLAST 2.0 algorithm, and they are described in (1990) J.Mol.Biol.215:403-410 such as (1977) Nucl.Acid.Res.25:3389-3402 and Altschul such as Altschul respectively.Adopt such as parameter described herein, BLAST and BLAST 2.0 may be used for the Percent sequence identity determining polynucleotide of the present invention and polypeptide.The software performing BLAST analysis can by US National Biotechnology Information center (NCBI) by the public be obtained.
In other embodiments, the nucleotide sequence that the sequence of described gRNA target spot has under strict conditions or high stringency and gRNA provided herein or its fragment or its complementary sequence can be hybridized.In biology field, hybridization technique is known.For illustrative purposes, the condition of described hybridization is stringent condition, such as hybridize at about 45 DEG C in 6X sodium chloride/sodium citrate (SSC) with the membrane-bound DNA of filter, in 0.2XSSC/0.1%SDS, at about 50-65 DEG C, do one or many washing afterwards; High stringency, such as, hybridize at about 45 DEG C with the membrane-bound nucleic acid of filter, do one or many washing afterwards in 0.1XSSC/0.2%SDS at about 68 DEG C in 6X SSC; Or other stringent hybridization condition well known by persons skilled in the art is (see such as Ausubel, the volume such as F.M., 1989, CurrentProtocols inMolecular Biology, I roll up, Green PublishingAssociates, and John Wiley & Sons, Inc. Inc., New York, 6.3.1-6.3.6 and 2.10.3 page).
The invention still further relates under strict conditions or the nucleotide sequence that can hybridize of arbitrary sequence of high stringency and SEQ ID NOs:1-15 or its fragment or its complementary sequence.
In the present invention, gRNA can be designed in conjunction with target goal gene or regulating and controlling sequence, such as, need to be combined with target sequence, identifies target sequence, helps Cas nuclease shear fracture target sequence.For gene or its regulating and controlling sequence can be any gene or its regulating and controlling sequence that need shear fracture, such as from pathogenic agent or participate in formation of cancer and development those, particularly target HBV.GRNA of the present invention can conventionally design.
" gRNA of RNA target sequence acquisition of leading according to the present invention " refers to the gRNA obtained by modes such as design expression or design and synthesis, and its target sequence acted on is include the gRNA target sequence that the present invention relates to.
The design of embodiment 1.gRNA sequence
Many A, B, C and D genotype HBV reference sequences are downloaded from GenBank, by the conserved sequence of MegAlign software analysis different genotype HBV, in conjunction with the regulation and control region and the coding region that affect hbv replication, according to the principle of design of gRNA in CRISPR/Cas9 system, design 15 gRNA sequences (table 1).These gRNAs cover multiple control region and coding region (Fig. 1) of HBV gene group.
A table 1.15 gRNA target sequence information
Embodiment 2. builds gRNA expression vector
According to pSpCas9 (BB)-2A-GFP (p458) (Addgene, 48138) in carrier framework, human U_6 promoter downstream sequence can form 5 after BbsI enzyme is cut " cohesive end of-CACC and 3 '-CAAA; and U6 promotor starts the characteristic that first base of transcribing is " G ", synthesizes a pair oligonucleotide (being synthesized by Sangon Biotech (Shanghai) Co., Ltd.).Top sequence is CACCGN (18-20), and Bottom sequence is AAACN (18-20) C, the N18-20 sequence wherein in Top oligonucleotide and the N18-20 sequence reverse complemental in Bottom.Two oligonucleotide 1:1 of synthesis are mixed, after denatured by boiling 5 minutes, naturally slowly room temperature is annealed to, finally by annealing after oligonucleotide through T4DNA ligase enzyme (Takara, D2011A) with BbsI (NEB, R0539S) enzyme cut after p458 carrier (pSpCas9 (BB)-2A-GFP) connect 8 hours at 16 DEG C, build p458-HBV gRNA expression vector.
Few nucleotide sequence is as follows:
HBV gRNA1-top:5’-CACCGCCTGCTGGTGGCTCCAGTTC-3’(SEQ ID No：16)
HBV gRNA1-bottom:5’-AAACGAACTGGAGCCACCAGCAGGC-3’(SEQ ID No：17)
HBV gRNA1 expressed sequence is as follows:
Example
5‘-CACCGCCTGCTGGTGGCTCCAGTTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT-3’(SEQ ID No：18)
Embodiment 3.15 gRNAs inhibition HBV replication evaluation of result
1) evaluate the ability of 15 gRNAs inhibition HBV replications, and its cytotoxicity is evaluated.Respectively by HBV expression vector and each HBV gRNA expression vector (p458-HBV gRNA) (1.2 ì g) corotation in Huh7 cell, detect the expression level of HBsAg and HBeAg in cells and supernatant.And the cytotoxicity of each gRNA is detected by MTT experiment.Result confirms: 15 gRNAs all efficiently can suppress the expression level (Fig. 2 A) of HBsAg (HBV surface antigen, HBsAg).Major part gRNAs efficiently can suppress the expression level (Fig. 2 B) of HBV e antigen (HBV e antigen, HBeAg).Article 15, gRNAs is without obvious cytotoxicity (Fig. 2 C).
Respectively by HBV expression vector (pBB4.5-HBV1.2) (0.4 μ g) and each HBV gRNA expression vector (p458-HBV gRNA) (1.2 μ g) corotation in Huh7 cell, after 72 hours, collecting cell supernatant, adopts temporal resolution immunofluorescence detection agent box to detect the expression level of HBsAg (A) and HBeAg (B) in cells and supernatant.(C) MTT experiment detects the cytotoxicity of each gRNA.
2) ability of the two gRNA inhibition HBV replication of various combination is evaluated.Respectively by HBV expression vector and two kinds of HBV gRNA expression vector corotation in Huh7 cell, by detecting the level of HBsAg and HBeAg in cells and supernatant, the ability of the two gRNA inhibition HBV replication of various combination.Result confirms: 11 kinds of two RNA all efficiently can suppress the levels of replication (Fig. 3 A, 3B and 3C) of A, B and C genotype HBV.
Respectively by HBV expression vector (pBB4.5-HBV1.2) (0.4 μ g) and two kinds of HBV gRNA expression vector (each 0.6 μ g) corotation in Huh7 cell, after 72 hours, collecting cell supernatant, adopts temporal resolution immunofluorescence detection agent box to detect the levels of replication of C (A), A (B) and B (C) genotype HBV in cells and supernatant.
3) ability that HBV gRNA shears HBV DNA is evaluated.Result confirms: carry out pcr amplification with the primer containing two gRNA shearing site, all gRNA all can effectively shear HBV DNA, cuts away the HBV DNA fragmentation between two gRNA shearing site, forms the small segment (Fig. 4 A) after the shearing of expection size.Sequencing result confirms further, and two gRNA can cut away the HBV DNA fragmentation (Fig. 4 B) between two gRNA shearing site really.
Wherein, in Figure 4 A, carry out pcr amplification with the primer containing 5 kinds of two gRNA combination (1+13,5+12,2+14,3+5 and 4+5) shearing sites, PCR primer carries out 1.5% agarose gel electrophoresis.The two gRNA (1+13) of sequencing analysis shown in Fig. 4 B is to the shearing action of HBV DNA.
4) HBV gRNA is evaluated to the destruction of HBV cccDNA.By the expression vector corotation of gRNA5 and gRNA12 two kinds of gRNAs in D genotype hbv replication sexual cell model-HepAD38 cell, by detecting the level of HBsAg and HBeAg in cells and supernatant, and the level of HBV cccDNA in cell, evaluate gRNA to the destruction of HBV cccDNA.Result confirms: when HepAD38 cell transfecting efficiency is lower (Fig. 5 A), gRNA5 and gRNA12 two kinds of gRNAs still significantly can suppress the expression level of HBsAg and HBeAg, wherein expression level decline 50% (Fig. 5 B) nearly of HBsAg.By KCl precipitation, PSAD (Plasmid-Safe
tMaTP-Dependent DNase) enzyme is cut, rolling circle amplification and confirm that HBV gRNA significantly can suppress the level of HBV cccDNA across two breach fluorescent quantitative PCR technique, points out the destruction (Fig. 5 C) that it is stronger to HBV cccDNA gene.
Wherein, Fig. 5 A illustrates that fluorescent microscope detects the transfection efficiency of HepAD38 cell.In figure 5b, by temporal resolution Immunofluorescence test technology for detection gRNA5 and gRNA12 two kinds of gRNAs on the impact of HBsAg and HBeAg level in HepAD38 cell conditioned medium.In figure 5 c, by KCl precipitation, PSAD (Plasmid-Safe
tMaTP-Dependent DNase) enzyme is cut, rolling circle amplification and detect the level of HBVcccDNA in HepAD38 cell across two breach fluorescent quantitative PCR technique.
Those skilled in the art should understand, although for illustrative purposes, this document describes the specific embodiment of the present invention, can carry out various amendment and without departing from the spirit and scope of the present invention to it.Therefore, the specific embodiment of the present invention and embodiment should not be considered as limiting the scope of the invention.The present invention is only by the restriction of claims.The all documents quoted in the application are all intactly incorporated to herein as a reference.
Sequence table
Claims (11)
1. a guiding RNA target sequence of target HBV, it is selected from one of following sequence:
(1) sequence in SEQ ID NOs:1-15 described in any one;
(2) with sequence in (1), there is at least 70% (preferably at least 80%, 85%, 90%, 95%, 99% or higher) conforming sequence;
(3) nucleotide sequence can hybridized with sequence in (1) under strict conditions or under high stringency;
(4) sequence only having 1-3 (preferred 1-2, more preferably 1) Nucleotide different with the sequence in (1); And
(5) with the fragment of sequence in (1)-(4) or complementary sequence.
2. comprise the nucleic acid construct of guiding RNA target sequence according to claim 1 or carrier as expression vector.
3. guiding RNA target sequence according to claim 1 obtain, covalently closed circular DNA or inhibition HBV replication can be destroyed or reduce the guiding RNA of HBsAg.
4. a recombinant expression vector, it comprises guiding RNA according to claim 3.
5. a host cell, it comprises the host cell of guiding RNA target sequence according to claim 1 or nucleic acid construct according to claim 2 or carrier or any one led in RNA or recombinant expression vector according to claim 4 according to claim 3.
6. the pharmaceutical composition of a treatment or prevention HBV infection or HBV patient, it comprises one or more in one or more or the recombinant expression vector according to claim 4 in guiding RNA according to claim 3, and optional pharmaceutical carrier.
7. one or more in one or more or recombinant expression vector according to claim 4 in guiding RNA according to claim 3 purposes in the medicine of preparation treatment or prevention HBV infection or HBV patient.
8. one or more purposes destroyed covalently closed circular DNA or inhibition HBV replication in preparation or reduce in the medicine of HBsAg in one or more or recombinant expression vector according to claim 4 in guiding RNA according to claim 3.
9. the application of any one in screening Anti-HBV drugs in guiding RNA target sequence according to claim 1 or nucleic acid construct according to claim 2 or carrier or guiding RNA according to claim 3 or recombinant expression vector according to claim 4 or host cell according to claim 5.
10. a method for inhibition HBV replication, it comprises one or more in one or more or the recombinant expression vector according to claim 4 in the guiding RNA according to claim 3 of effective dose is administered to patient.
The method of 11. 1 kinds of inhibition HBV replications, it comprises the following steps:
(1) one or more in one or more in guiding RNA according to claim 3 or recombinant expression vector according to claim 4 are imported in host cell or organism; And
(2) express in one or more or the recombinant expression vector according to claim 4 in guiding RNA according to claim 3 one or more, and under expressed guiding RNA and the acting in conjunction of Cas9 nuclease, destroy covalently closed circular DNA.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510067097.2A CN104711257B (en) | 2015-02-09 | 2015-02-09 | Guiding RNA target point for treating hepatitis B virus infection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510067097.2A CN104711257B (en) | 2015-02-09 | 2015-02-09 | Guiding RNA target point for treating hepatitis B virus infection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104711257A true CN104711257A (en) | 2015-06-17 |
| CN104711257B CN104711257B (en) | 2017-11-03 |
Family
ID=53410975
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510067097.2A Active CN104711257B (en) | 2015-02-09 | 2015-02-09 | Guiding RNA target point for treating hepatitis B virus infection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104711257B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106729753A (en) * | 2016-12-16 | 2017-05-31 | 谭旭 | The delivery system and biological agent of anti-hepatitis B virus |
| CN106754912A (en) * | 2016-11-16 | 2017-05-31 | 上海交通大学 | One class orientation removes DNA, plasmid and the preparation of HBVccc in liver cell |
| CN109528653A (en) * | 2018-11-22 | 2019-03-29 | 北京大学 | Film property vesica with gene editing function and preparation method thereof, pharmaceutical composition and purposes |
| CN113249384A (en) * | 2021-04-27 | 2021-08-13 | 重庆医科大学 | Specific sgRNA sequence capable of targeted editing of HBV cccDNA and application thereof |
| CN114008200A (en) * | 2019-04-18 | 2022-02-01 | 株式会社图尔金 | Compositions and methods for inhibiting hepatitis b virus proliferation |
| WO2024040254A3 (en) * | 2022-08-19 | 2024-05-30 | Tune Therapeutics, Inc. | Compositions, systems, and methods for regulation of hepatitis b virus through targeted gene repression |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911376A (en) * | 2014-04-03 | 2014-07-09 | 南京大学 | CRISPR-Cas9 targeted knockout hepatitis b virus cccDNA and specific sgRNA thereof |
| US20140357530A1 (en) * | 2012-12-12 | 2014-12-04 | The Broad Institute Inc. | Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof |
-
2015
- 2015-02-09 CN CN201510067097.2A patent/CN104711257B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20140357530A1 (en) * | 2012-12-12 | 2014-12-04 | The Broad Institute Inc. | Functional genomics using crispr-cas systems, compositions, methods, knock out libraries and applications thereof |
| CN103911376A (en) * | 2014-04-03 | 2014-07-09 | 南京大学 | CRISPR-Cas9 targeted knockout hepatitis b virus cccDNA and specific sgRNA thereof |
Non-Patent Citations (7)
| Title |
|---|
| BEOM KYUNG KIM等: "HBV genotypes: relevance to natural history,pathogenesis and treatment of chronic hepatitis B", 《ANTIVIRAL THERAPY》 * |
| EDWARD M. KENNEDY等: "Suppression of hepatitis B virus DNA accumulation in chronically infected cells using a bacterial CRISPR/Cas RNA-guided DNA endonuclease", 《VIROLOGY》 * |
| NATTANAN PANJAWORAYAN等: "Effects of HBV Genetic Variability on RNAi Strategies", 《HEPATITIS RESEARCH AND TREATMENT》 * |
| PATRICK D HSU等: "DNA targeting specificity of RNA-guided Cas9 nucleases", 《NATURE BIOTECHNOLOGY》 * |
| S ZHEN等: "Harnessing the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated Cas9 system to disrupt the hepatitis B virus", 《GENE THERAPY》 * |
| SU-RU LIN等: "The CRISPR/Cas9 System Facilitates Clearance of the Intrahepatic HBV Templates In Vivo", 《MOLECULAR THERAPY-NUCLEIC ACIDS》 * |
| YANFANG FU等: "Improving CRISPR-Cas nuclease specificity using truncated guide RNAs", 《NAT BIOTECHNOL》 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754912A (en) * | 2016-11-16 | 2017-05-31 | 上海交通大学 | One class orientation removes DNA, plasmid and the preparation of HBVccc in liver cell |
| CN106754912B (en) * | 2016-11-16 | 2019-11-08 | 上海交通大学 | One kind orientation removes the plasmid and preparation of HBVcccDNA in liver cell |
| CN106729753A (en) * | 2016-12-16 | 2017-05-31 | 谭旭 | The delivery system and biological agent of anti-hepatitis B virus |
| CN109528653A (en) * | 2018-11-22 | 2019-03-29 | 北京大学 | Film property vesica with gene editing function and preparation method thereof, pharmaceutical composition and purposes |
| CN114008200A (en) * | 2019-04-18 | 2022-02-01 | 株式会社图尔金 | Compositions and methods for inhibiting hepatitis b virus proliferation |
| EP3957734A4 (en) * | 2019-04-18 | 2023-03-08 | Toolgen Incorporated | Composition and method for inhibiting proliferation of hepatitis b virus |
| CN113249384A (en) * | 2021-04-27 | 2021-08-13 | 重庆医科大学 | Specific sgRNA sequence capable of targeted editing of HBV cccDNA and application thereof |
| WO2024040254A3 (en) * | 2022-08-19 | 2024-05-30 | Tune Therapeutics, Inc. | Compositions, systems, and methods for regulation of hepatitis b virus through targeted gene repression |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104711257B (en) | 2017-11-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104711257A (en) | Guide RNA target points for treating hepatitis B virus infection | |
| US20230287401A1 (en) | Rna guided compositions for preventing and treating hepatitis b virus infections | |
| CN108350454B (en) | Allele-selective gene editing and uses thereof | |
| Stacey et al. | Macrophages ingest and are activated by bacterial DNA. | |
| Tamura et al. | Historic overview of genetic engineering technologies for human gene therapy | |
| CN107893074A (en) | A kind of gRNA, expression vector, knockout system, kit for being used to knock out CXCR4 genes | |
| CN107406854A (en) | RNA-guided eradication of human JC virus and other polyomaviruses | |
| EP2682459A1 (en) | Oncolytic adenovirus for target therapy of human tumor and use thereof | |
| JP2021502077A5 (en) | ||
| JP2020505390A (en) | Lentiviruses and non-integrating lentiviruses as viral vectors for delivering CRISPR therapeutics | |
| CA3143627A1 (en) | Carbohydrate nanocarrier delivery of hepatitis b virus (hbv) vaccines | |
| CN113025613B (en) | ADORA2A gene knockout cell and construction method and application thereof | |
| Karagyaur et al. | Practical recommendations for improving efficiency and accuracy of the CRISPR/Cas9 genome editing system | |
| TW202108598A (en) | Self-replicating rna molecules for hepatitis b virus (hbv) vaccines and uses thereof | |
| WO2022001080A1 (en) | Recombinant herpes simplex virus and construction method therefor | |
| KR101842131B1 (en) | A programmable nuclease targeting hepatitis B virus and a composition for treating HBV infection comprising the same | |
| WO2022006306A2 (en) | Compositions for genome editing and methods of use thereof | |
| KR20180128864A (en) | Gene editing composition comprising sgRNAs with matched 5' nucleotide and gene editing method using the same | |
| KR102213837B1 (en) | Genetically modified NK cells and use thereof | |
| Lomov et al. | CRISPR/Cas9 technology for targeted genome editing | |
| KR20200129959A (en) | Carrier-free multiplex CRISPR/Cas gene editing complex and uses thereof | |
| CN107007830A (en) | A kind of purposes, vaccine and the preparation method of avirulent strain toxoplasm and herbal polysaccharide adjunvant composition | |
| Kaneko et al. | Uphill Battle of CRISPR/Cas9: A Budding Technology in Need of Refinement | |
| CN118147171A (en) | Self-amplifying mRNA nucleic acid sequences with enhanced expression levels of exogenous genes | |
| WO2022256522A1 (en) | Crispr induced disruption of mogs gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |