CN104693199B - 2,9-bis-styryl substituted phenanthroline compounds, and preparation method and application thereof - Google Patents
2,9-bis-styryl substituted phenanthroline compounds, and preparation method and application thereof Download PDFInfo
- Publication number
- CN104693199B CN104693199B CN201510103607.7A CN201510103607A CN104693199B CN 104693199 B CN104693199 B CN 104693199B CN 201510103607 A CN201510103607 A CN 201510103607A CN 104693199 B CN104693199 B CN 104693199B
- Authority
- CN
- China
- Prior art keywords
- nucleic acid
- compound
- formula
- solution
- tetra
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
- C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
- C07D471/04—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K11/00—Luminescent, e.g. electroluminescent, chemiluminescent materials
- C09K11/06—Luminescent, e.g. electroluminescent, chemiluminescent materials containing organic luminescent materials
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
- C09K2211/10—Non-macromolecular compounds
- C09K2211/1018—Heterocyclic compounds
- C09K2211/1025—Heterocyclic compounds characterised by ligands
- C09K2211/1029—Heterocyclic compounds characterised by ligands containing one nitrogen atom as the heteroatom
- C09K2211/1033—Heterocyclic compounds characterised by ligands containing one nitrogen atom as the heteroatom with oxygen
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09K—MATERIALS FOR MISCELLANEOUS APPLICATIONS, NOT PROVIDED FOR ELSEWHERE
- C09K2211/00—Chemical nature of organic luminescent or tenebrescent compounds
- C09K2211/10—Non-macromolecular compounds
- C09K2211/1018—Heterocyclic compounds
- C09K2211/1025—Heterocyclic compounds characterised by ligands
- C09K2211/1044—Heterocyclic compounds characterised by ligands containing two nitrogen atoms as heteroatoms
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Physics & Mathematics (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Optics & Photonics (AREA)
- Biophysics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pathology (AREA)
- Microbiology (AREA)
- Materials Engineering (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Nitrogen Condensed Heterocyclic Rings (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides 2,9-bis-styryl substituted phenanthroline compounds specifically combined with G-tetrastrobila-structure nucleic acid and a preparation method thereof, and application of the 2,9-bis-styryl substituted phenanthroline compounds in tumor resistance. The structural formula is disclosed as Formula I. The compounds disclosed as Formula I can quickly judge whether the sample to be detected is G-tetrastrobila-structure nucleic acid by ultraviolet-visible absorption spectrum or fluorescence spectrum. The drug effect test proves that the compounds disclosed as Formula I in vitro have strong inhibiting actions on multiple tumor cell strains. The 2,9-bis-styryl substituted phenanthroline compounds can be used for preparing anticancer drugs.
Description
Technical field
The invention belongs to field of medicaments and in particular to 2,9- double styrenes replace phenanthroline compound and its preparation
Method and application.
Background technology
G- tetra- serobila (g-quadruplex) is by the nucleotide sequence of rich guanine (g), by corresponding g in interchain or chain
Form hoogsteen base pairing, so that one kind that the nucleic acid fragment of four or four sections rich g assembles formation is special between base
Nucleic acid secondary structure [s.burge et al.nucleic acids res, 2006,34,5402-5415].Rich g sequence is in tool
There is generally existing in the genome of critical function, such as telomere, gene promoter area, immunoglobulin (Ig) switch region etc.
[j.l.huppert et al.nucleic acids res,2005,33,2908-2916；2007,35,406-413；
a.k.todd et al.nucleic acids res,2005,33,2901-2907].And with human longevity, cancer, hiv and
The closely related grade of Forming Mechanism [the t.a.brooks et al.febs journal 2010,277,3459- of other diseases
3469], current g- tetra- serobila has become important drug target, for finding new antitumor class medicine.Therefore, develop
To g- tetra- stranded structure, there is the molecular probe of selective optic response and antineoplastic has great importance.
At present it has been found that some compounds that can be combined with nucleic acid g- tetra- serobila, such as two quinolines, two Yin
Diindyl derivative and dibenzimidazole derivatives etc., some of which compound shows the activity of suppression tumor cell proliferation.But it is big
Part of compounds is not high to the selectivity of g- tetra- serobila, can be combined [t.ou et with single nucleic acid strands and double-strand simultaneously
al.chemmedchem2008,3,690-713].In addition, majority of compounds is combined rear its optical property change with g- tetra- serobila
Inconspicuous it is impossible to for g- tetra- stranded structure detection.
Content of the invention
An object of the present invention is to provide a kind of phenanthroline compound of 2,9- double styrene replacement and its preparation
Method.
The phenanthroline compound that 2,9- double styrene provided by the present invention replaces, its structural formula is as shown in formula i:
In above-mentioned formula i, r1And r2Independently selected from following any one: h, halogen, the disubstituted amino of c1-c6 alkyl,
C1-c8 alkyl, substituted or unsubstituted containing heteroatomic cycloalkyl；
Described substituted or unsubstituted containing the hetero atom in heteroatomic cycloalkyl be selected from following at least one: n, o and
s；Described cycloalkyl is 3-6 unit cycloalkyl；
Described substituted it is selected from following at least one containing the substituent in heteroatomic cycloalkyl: c1-c6 alkyl ,-
(ch2)n- oh (n=1-8) ,-(ch2)n- ar (n=1-6, ar represent aromatic radical).
The phenanthroline compound that 2,9- double styrene shown in above-mentioned formula i replaces be preferably following any one:
The phenanthroline compound that 2,9- double styrene shown in above-mentioned formula i replaces is the method according to comprising the steps
Prepare:
Compound shown in formula is carried out condensation reaction with compound shown in formula and compound shown in formula, obtains formula i
The phenanthroline compound that shown 2,9- double styrene replaces；
In above-mentioned formula and formula, r1And r2Independently selected from following any one: h, halogen, c1-c6 alkyl are disubstituted
Amino, c1-c8 alkyl, substituted or unsubstituted containing heteroatomic cycloalkyl；
Described substituted or unsubstituted containing the hetero atom in heteroatomic cycloalkyl be selected from following at least one: n, o and
s；Described cycloalkyl is 3-6 unit cycloalkyl；
Described substituted it is selected from following at least one containing the substituent in heteroatomic cycloalkyl: c1-c6 alkyl ,-
(ch2)n- oh (n=1-8) ,-(ch2)n- ar (n=1-6, ar represent aromatic radical).
Compound shown in described formula and compound shown in described formula, compound shown in described formula mol ratio successively
For 1:1:1.
The temperature of described condensation reaction is 90 DEG C -120 DEG C, and the time is 12h-36h.
Described condensation reaction is carried out in organic solvent, described organic solvent concretely toluene.
It is a further object of the present invention to provide the phenanthroline compound that 2,9- double styrene shown in above-mentioned formula i replaces is made
For application in identification nucleic acid g- tetra- stranded structure for the molecular probe.
The phenanthroline compound being replaced using 2,9- double styrene shown in above-mentioned formula i identifies nucleic acid as molecular probe
The method of g- tetra- stranded structure, comprises the steps:
(1) nucleic acid samples to be detected and reference nucleic acid sample are dissolved in buffer solution respectively, obtain nucleic acid samples to be detected
Solution a and reference nucleic acid sample solution b；Phenanthroline 2,9- double styrene shown in described formula i being replaced with organic solvent
After compound dissolving, then obtain detecting solution c with the dilution of described buffer solution；
(2) described nucleic acid samples solution a to be detected and described detection solution c is mixed to get mixed solution 1, by described ginseng
It is mixed to get mixed solution 2 than nucleic acid samples solution b and described detection solution c, then will be molten to the mixed solution obtaining 1 and mixing
Liquid 2 is incubated respectively, mixed solution 2 after mixed solution 1 and incubation after being incubated；Again to mixed solution 1 after described incubation
With mixed solution 2 after described incubation carry out following a) or b):
A) carry out uv-visible absorption spectra respectively to mixed solution 2 after mixed solution 1 after described incubation and incubation to divide
Analysis, the ultraviolet of the phenanthroline compound that 2, the 9- double styrene shown in formula i in mixed solution 1 after described incubation is replaced-
The phenanthroline chemical combination that 2,9- double styrene shown in formula i in mixed solution 2 after visible absorption spectra and described incubation replaces
The uv-visible absorption spectra of thing is compared, thus judging whether described nucleic acid samples to be detected are g- tetra- stranded structure
Nucleic acid；
Or
B) spectrofluorimetry is carried out respectively to mixed solution 2 after mixed solution 1 after described incubation and incubation, incubate described
The fluorescence spectrum of phenanthroline compound educating the replacement of the 2,9- double styrene shown in formula i in rear mixed solution 1 is incubated with described
The fluorescence spectrum educating the phenanthroline compound that 2, the 9- double styrene shown in formula i in rear mixed solution 2 replaces is compared,
Thus judging that whether described nucleic acid samples to be detected are the nucleic acid of g- tetra- stranded structure.
In said method step (1), described nucleic acid samples to be detected are the nucleic acid with g- tetra- stranded structure.
Described nucleic acid samples to be detected are concretely: hum24 (its sequence is as shown in sequence 1 in sequence table), c-myc (its
Sequence is as shown in sequence 2 in sequence table), tba (its sequence is as shown in sequence 3 in sequence table), 22ag k+(wherein, the sequence of 22ag
Row are as shown in sequence 4 in sequence table) or 22ag na+(wherein, the sequence of 22ag is as shown in sequence 4 in sequence table).
Described reference nucleic acid sample is the nucleic acid of non-g- tetra- stranded structure, can be single-chain nucleic acid or double-strand core
Acid.
Described reference nucleic acid sample concretely ss-dna1 (its sequence is as shown in sequence 5 in sequence table), ss-dna2 (its
Complementary series for ss-dna1) or dsdna (ss-dna1+ss-dna2).
Described buffer solution is tris-hcl buffer solution or phosphate buffer.
The ph value of described buffer solution is 6-8.
Described nucleic acid samples solution a to be detected, the molar concentration of nucleic acid samples to be detected is 0.25 μm -60 μm.
In described reference nucleic acid sample solution b, the molar concentration of reference nucleic acid sample is 0.25 μm -60 μm.
Described organic solvent concretely dimethyl sulfoxide (DMSO).
In described detection solution c, phenanthroline compound that 2,9- double styrene shown in described formula i replaces mole dense
Spend for 0.5 μm -20 μm.
In said method step (2), in described mixed solution 1, described nucleic acid samples to be detected double benzene with 2,9- shown in formula i
The mol ratio of the phenanthroline compound that ethene replaces is 0.125-6.
In described mixed solution 2, the phenanthroline that described reference nucleic acid sample is replaced with 2,9- double styrene shown in formula i
The mol ratio of compound is 0.125-6.
Described a) in, it is adjacent luxuriant and rich with fragrance that 2, the 9- double styrene shown in formula i in mixed solution 1 after observing described incubation replaces
The uv-visible absorption spectra of sieve quinoline class compound is remarkably reinforced in the range of 310～550nm, and in 470～550nm scope
Interior new absworption peak, then described nucleic acid samples to be detected confirm as the nucleic acid of g- tetra- stranded structure；Conversely, being then non-g- tetra-
The nucleic acid of stranded structure.
Described b) in, it is adjacent luxuriant and rich with fragrance that 2, the 9- double styrene shown in formula i in mixed solution 1 after observing described incubation replaces
The fluorescence emission spectrum of sieve quinoline class compound fluorescence peak in the range of 450～630nm and fluorescence intensity raises, and is higher than institute
The fluorescence emission spectrum of the phenanthroline compound that the 2,9- double styrene shown in formula i in mixed solution 2 after stating incubation replaces
Occur in the range of 450～630nm fluorescence intensity (generally greater than 2 times of the fluorescence intensity of reference nucleic acid sample mix liquid with
On), then described nucleic acid samples to be detected confirm as the nucleic acid of g- tetra- stranded structure；Conversely, being then the core of non-g- tetra- stranded structure
Acid.
It is also another object of the present invention to provide the use of the phenanthroline compound of the replacement of 2,9- double styrene shown in formula i
On the way.
The purposes of the phenanthroline compound that 2,9- double styrene shown in formula i provided by the present invention replaces be it under
State the application of aspect:
1) application in preparation eucaryote tumor cell proliferation inhibitor；2) in preparation prevention and/or treatment tumour
Application in medicine.
Described eucaryote is mammal；Described tumour cell is cancer cell；Described cancer cell is lung carcinoma cell, mammary gland
Cancer cell or prostate gland cancer cell.
Described lung adenocarcinoma cell is specially drug resistance lung carcinoma cell a549t.
Described breast cancer cell is specially human breast cancer cell mcf-7.
Described lung carcinoma cell is specially human lung carcinoma cell a549.
Described prostate gland cancer cell is specially Human Prostate Cancer Cells pc-3.
Described tumour is cancer；Described cancer is lung cancer, breast cancer or prostate cancer.
The eucaryote that the phenanthroline compound being replaced with 2,9- double styrene shown in formula i is prepared for active component is swollen
The medicine of tumor cell proliferation inhibitor or prevention and/or treatment tumour falls within protection scope of the present invention.
The medicine of described eucaryote tumor cell proliferation inhibitor or prevention and/or treatment tumour can be by injection, spray
Penetrate, collunarium, eye drip, infiltration, absorption, the method that physically or chemically mediates import body such as muscle, intracutaneous, subcutaneous, vein, mucous membrane
Tissue；Or import body by other material mixings or after wrapping up.
When needs, said medicine can also add one or more pharmaceutically acceptable carrier.Described load
Body includes the conventional diluent of pharmaceutical field, excipient, filler, adhesive, wetting agent, disintegrant, sorbefacient, surface
Activating agent, absorption carrier, lubricant etc..
The eucaryote that the phenanthroline compound being replaced with 2,9- double styrene shown in formula i is prepared for active component is swollen
Tumor cell proliferation inhibitor or prevention and/or tumor can make parenteral solution, tablet, pulvis, granule, capsule,
The various ways such as oral liquid, paste, creme.The medicine of above-mentioned various formulation all can be according to the conventional method system of pharmaceutical field
Standby.
The neighbour of 2,9- double styrene replacement has been inquired in the change of present invention uv-visible absorption spectra and fluorescence spectrum
Phenanthroline class compound and the interaction of nucleic acid g- tetra- serobila, and the phase with single-chain nucleic acid, double-strandednucleic acid as a comparison
Interaction.
Because the phenanthroline compound that 2, the 9- double styrene of the present invention replaces contains big conjugation fragrance planar structure,
Pi-pi accumulation can be formed with the g- tetrad plane of nucleic acid g- tetra- serobila and combine, but not have in the structure of single-chain nucleic acid, double-strandednucleic acid
There is big fragrant planar structure, the phenanthroline compound that therefore can not be replaced with 2,9- double styrene is combined.By ultraviolet-
Visible absorption spectra and fluorescence spectrum can quickly judge the structure of nucleic acid in solution be g- stranded structure or single-chain nucleic acid, double
Chain nucleic acid structure.
2,9- double styrenes replace phenanthroline compound have have necessarily flexible conjugate planes so as to compare
Easily it is deposited on g tetrad plane, and then with g- tetra- serobila, there is stronger affinity, its special crescent structure makes
It is combined weaker with other secondary structure such as double-strandednucleic acids.Because molecule has larger conjugate planes, easily in aqueous liquid
In system, intermolecular aggregation is formed by Van der Waals force, lead to the purple of the phenanthroline compound of 2,9- double styrene replacement
Outward-visible absorption reduces, and nitrogen-containing group therein and aqueous phase interaction simultaneously produces nonradiative transition and lead to its fluorescence to disappear,
So when phenanthroline compound and the nucleic acid g- tetra- serobila sample mix that 2,9- double styrene replaces, itself and g- tetra- serobila
Interaction makes aggregation disaggregation, thus passing through pi-pi accumulation with the g- tetrad plane in g- tetra- serobila in the form of monomer
Interact and combine, so that conjugated degree is increased, lead to new absorption band to occur.Meanwhile, shield with the combination of g- tetra- serobila its with
The interaction of hydrone, leads to compound fluorescence to greatly enhance.
The present invention have studied the antineoplastic action of the phenanthroline compound of 2,9- double styrene replacement simultaneously.
G- tetra- stranded structure is widely present in telomere and gene promoter area, particularly more related to tumour gene
Promoter region has sequence [the s.balasubramanian et that multistage can form g- tetra- serobila
al.natrevdrugdiscov,2011,10,261-275].The compound being much combined with g- tetra- serobila is shown and kills tumour
Cell or the ability of suppression proliferative activity o f tumor.But majority of compounds is not high to the selectivity of g- tetra- serobila, can be simultaneously
Be combined with single nucleic acid strands and double-strand, therefore larger toxicity produced to normal cell.Therefore to selectively high point of g- tetra- serobila
Son will be helpful to reduce its toxic and side effect to normal cell.The phenanthroline compound that 2,9- double styrene is replaced by we
It is added in the nutrient solution containing tumour cell, cultivates together with tumour cell, find that it has higher suppression tumour thin really
The effect of born of the same parents' proliferation activity.
The present invention compared with prior art has the advantage that
1) the phenanthroline compound that 2,9- double styrene provided by the present invention replaces is readily synthesized, and very steady
Fixed, it is easy to store, there is the effect of stronger suppression proliferative activity o f tumor, have the potentiality as antineoplastic；
2) the phenanthroline compound that 2,9- double styrene provided by the present invention replaces can specifically combine g-
Four stranded structure it is achieved that difference with single-chain nucleic acid, double-strandednucleic acid structure, using uv-visible absorption spectra and fluorescence light
Spectrum can distinguish nucleic acid g- tetra- stranded structure, simply, fast, with low cost, can the carrying out of real-time on-site detect.
Brief description
Fig. 1 a is uv-visible absorption spectra change after compound e1 is acted on nucleic acid g- tetra- serobila.
Fig. 1 b is ultraviolet-ray visible absorbing after compound e1 is acted on reference nucleic acid and nucleic acid g- tetra- serobila (c-myc) respectively
Spectrum change comparison diagram.
Fig. 2 a is the fluorescent exciting of compound e1 after compound e1 is acted on nucleic acid g- tetra- serobila and reference nucleic acid respectively
Spectrum change comparison diagram.
Fig. 2 b is the nucleic acid g- tetra- serobila 22ag na of compound e1 and variable concentrations+Fluorescence emission spectrum change after effect
Figure.
Fig. 2 c is compound after reference nucleic acid/nucleic acid g- tetra- serobila is incubated with different mixed in molar ratio from compound e1
The relative fluorescence of e1.
Fig. 3 is the inhibitory activity to tumour cell for the compound e1.
Specific embodiment
Below by specific embodiment, the present invention will be described, but the invention is not limited in this.
Experimental technique used in following embodiments if no special instructions, is conventional method；Institute in following embodiments
Reagent, biomaterial etc., if no special instructions, all commercially obtain.
Embodiment 1, the synthesis of compound e1
By 4- (4- methyl piperazine) benzaldehyde (purchased from lark prestige) (2.04g, 10mmol) and 2,9- dimethyl -2,9- is adjacent luxuriant and rich with fragrance
Sieve quinoline (purchased from lark prestige) (1.04g, 5mmol) is dissolved in dry toluene (10ml), and at temperature is 120 DEG C, reaction 24 is little
When, the solvent in system is spin-dried for obtaining crude product, silica gel column chromatography purification is crossed as eluent using dichloromethane and obtains 975mg
Solid, as compound e1, yield be 35%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.42(d,2h),7.02(d,2h),6.85(m,2h),3.34(t,8h),2.85(d,8h),2.87(s,6h).13c nmr
(cdcl3, 400mhz): δ (ppm): 156.71,151.24,145.84,136.25,133.84,128.45,127.85,
127.06,125.50,120.02,115.51,54.95,48.32,46.13.hrms (esi-tof) calcd for c38h41n6
[m]+581.3387,found 581.3386.
Embodiment 2, the synthesis of compound e2
Substantially same as Example 1, except that (being purchased from compound 4- (4- (2- ethoxy) piperazine) benzaldehyde
Lark prestige) replace 4- (4- methyl piperazine) benzaldehyde, 120 DEG C are reacted 24 hours, and rotary evaporation falls toluene and obtains crude product, thick product
Product carry out silica gel column chromatography with ethyl acetate as eluent and separate, and obtain compound e2.Yield: 38%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.42(d,2h),7.02(d,2h),6.85(m,2h),3.65(s,2h),3.34(m,20h),2.53(t,4h).13c nmr
(cdcl3, 400mhz): δ (ppm): 156.71,151.24,145.84,136.25,133.84,128.45,127.85,
127.06,125.50,120.02,115.51,59.41,56.32,51.33.hrms (esi-tof) calcd for c40h44n6o2
[m]+640.3526,found 640.3528.
Embodiment 3: the synthesis of compound e3
Substantially same as Example 1, except that with compound 4- (4- morpholine) benzaldehyde (purchased from lark prestige) generation
For 4- (4- methyl piperazine) benzaldehyde, 120 DEG C are reacted 24 hours, and rotary evaporation falls toluene and obtains crude product, crude product acetic acid
Ethyl ester carries out silica gel column chromatography as eluent and separates, and obtains compound e3.Yield: 42%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.42(d,2h),7.02(d,2h),6.85(m,2h),3.65(t,8h),3.18(t,8h).13c nmr(cdcl3,
400mhz): δ (ppm): 156.71,151.24,145.84,136.25,133.84,128.45,127.85,127.06,
125.50,120.02,115.51,66.35,54.62.hrms (esi-tof) calcd for c36h34n4o2[m]+554.2682,
found 554.2679.
Embodiment 4: the synthesis of compound e4
Substantially same as Example 1, except that with compound 4- lignocaine benzaldehyde (purchased from lark prestige) generation
For 4- (4- methyl piperazine) benzaldehyde, 120 DEG C are reacted 24 hours, and rotary evaporation falls toluene and obtains crude product, crude product acetic acid
Ethyl ester carries out silica gel column chromatography as eluent and separates, and obtains compound e4.Yield: 56%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.42(d,2h),7.02(d,2h),6.85(m,2h),3.41(q,8h),1.15(t,12h).13c nmr(cdcl3,
400mhz): δ (ppm): 156.71,151.24,145.84,136.25,133.84,128.45,127.85,127.06,
125.50,120.02,115.51,47.32,12.96.hrms (esi-tof) calcd for c36h38n4[m]+526.3096,
found 526.3098.
Embodiment 5, the synthesis of compound e5
Substantially same as Example 1, except that replacing 4- (4- with compound 4- bromobenzaldehyde (purchased from lark prestige)
Methyl piperazine) benzaldehyde, 120 DEG C are reacted 24 hours, and rotary evaporation falls toluene and obtains crude product, crude product ethyl acetate conduct
Eluent carries out silica gel column chromatography and separates, and obtains compound e5.Yield: 30%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.56(d,4h),7.42(d,2h),7.02(d,2h).13c nmr(cdcl3, 400mhz): δ (ppm): 156.71,
151.24,145.84,136.25,133.84,130.92,128.45,127.85,127.06,125.50,122.30,
120.02.hrms(esi-tof)calcd for c28h18n2br2[m]+539.9837,found 539.9834.
Embodiment 6, the synthesis of compound e6
Substantially same as Example 1, except that replacing 4- with compound 4- butyl benzaldehyde (purchased from lark prestige)
(4- methyl piperazine) benzaldehyde, 120 DEG C are reacted 24 hours, and rotary evaporation falls toluene and obtains crude product, crude product ethyl acetate
Carry out silica gel column chromatography as eluent to separate, obtain compound e6.Yield: 62%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.42(d,2h),7.02(d,2h),6.85(m,2h),2.62(t,4h),1.59(m,4h),1.31(m,4h),0.91(t,
6h).13c nmr(cdcl3, 400mhz): δ (ppm): 156.71,151.24,145.84,141.81,136.25,133.84,
128.45,127.85,127.06,125.50,120.02,115.51,36.23,33.21,23.14,13.98.hrms (esi-
tof)calcd for c36h36n2[m]+496.2878,found 496.2881.
Embodiment 7, the synthesis of compound e7
Substantially same as Example 1, except that replacing 4- with compound 4- piperidines benzaldehyde (purchased from lark prestige)
(4- methyl piperazine) benzaldehyde, 120 DEG C are reacted 24 hours, and rotary evaporation falls toluene and obtains crude product, crude product ethyl acetate
Carry out silica gel column chromatography as eluent to separate, obtain compound e7.Yield: 48%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.42(d,2h),7.02(d,2h),6.85(m,2h),3.44(t,8h),1.56(m,12h).13c nmr(cdcl3,
400mhz): δ (ppm): 156.71,151.24,148.52,145.84,136.25,133.84,128.45,127.85,
127.06,125.50,120.02,115.51,54.95,24.95.hrms (esi-tof) calcd for c38h38n4[m]+
550.3096,found 5850.3092.
Embodiment 8, the synthesis of compound e8
Substantially same as Example 1, except that with compound 4- (4- benzyl diethylenediamine) benzaldehyde (purchased from lark
Prestige) replace 4- (4- methyl piperazine) benzaldehyde, 120 DEG C are reacted 24 hours, and rotary evaporation falls toluene and obtains crude product, and crude product is used
Ethyl acetate carries out silica gel column chromatography as eluent and separates, and obtains compound e8.Yield: 26%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.42(d,2h),7.33(m,4h),7.26(d,2h),7.23(d,4h),7.02(d,2h),6.85(m,2h),3.66(s,
4h),3.34(t,8h),2.85(d,8h).13c nmr(cdcl3, 400mhz): δ (ppm): 156.71,151.24,145.84,
138.64,136.25,133.84,130.56,129.21,128.84,128.45,127.85,127.23,127.06,125.50,
120.02,115.51,64.85,54.95,52.36.hrms (esi-tof) calcd for c50h48n6[m]+732.3940,
found 732.3942.
Embodiment 9: the synthesis of compound e9
4- (4- methyl piperazine) benzaldehyde, 4- lignocaine benzaldehyde and 2,9- dimethyl -2,9- Phen are massaged
You are dissolved in dry toluene than the ratio for 1:1:1, and 120 DEG C are reacted 24 hours, and rotary evaporation falls toluene and obtains crude product, slightly
Product carries out silica gel column chromatography with ethyl acetate as eluent and separates, and obtains compound e9.Yield: 23%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.42(d,2h),7.02(d,2h),6.85(m,2h),3.44(m,8h),2.36(t,4h),2.27(s,3h),1.16(t,
6h).13c nmr(cdcl3, 400mhz): δ (ppm): 156.71,151.24,145.84,136.25,133.84,130.56,
128.45,127.85,127.06,125.50,120.02,115.51,57.36,52.84,48.32,46.13,12.93.hrms
(esi-tof)calcd for c37h39n5[m]+553.3205,found 553.3208.
Embodiment 10, the synthesis of compound e10
By (4- (4- methyl piperazine) benzaldehyde, 4- butyl benzaldehyde and 2,9- dimethyl -2,9- Phen are in molar ratio
Ratio for 1:1:1 is dissolved in dry toluene, and 120 DEG C are reacted 24 hours, and rotary evaporation falls toluene and obtains crude product, crude product
Carry out silica gel column chromatography with ethyl acetate as eluent to separate, obtain compound e10.Yield: 28%.
Compound structure confirmation data is:
1h nmr(cdcl3,400mhz):δ(ppm):8.04(d,2h),7.95(d,2h),7.83(m,4h),7.64(d,
4h),7.42(d,2h),7.02(d,2h),6.85(m,2h),3.34(t,4h),2.85(t,4h),2.62(t,2h),2.26(s,
3h),1.61(m,4h),0.91(t,3h).13c nmr(cdcl3, 400mhz): δ (ppm): 156.71,151.24,145.84,
136.25,133.84,130.64,128.45,127.85,127.06,125.50,120.02,115.51,57.36,52.84,
46.13,36.25,33.36,23.17,13.93.hrms(esi-tof)calcd for c37h38n4[m]+538.3096,found
538.3093.
Embodiment 11, compound e1 are combined the change of rear spectroscopy with nucleic acid
1. prepare sample:
Dna sample: dna sample is purchased from Beijing Sheng Gong Bioisystech Co., Ltd, the dna in addition to 22ag sequence is dissolved in slow
Rush (10mm tris-hcl, ph=7.4,20mm kcl, 100mmnacl) in liquid, 22ag is dissolved in na+Cushioning liquid (10mm
Tris-hcl, 100mm nacl, 0.1mm edta, ph=7.4) form antiparallel g- tetra- serobila secondary structure (22ag na+),
22ag is dissolved in k+In cushioning liquid, (10mm tris-hcl, 20mm kcl, 0.1mm edta, ph=7.4) forms mixed structure
G- tetra- serobila (22ag k+), denaturation at 95 DEG C is put in 4 DEG C of refrigerators after 10 minutes and is annealed overnight.
The dna sample of test and sequence include:
Reference nucleic acid:
Ss-dna1:ccagttcgtagtaaccc (its sequence is shown in sequence 5 in sequence table)
Ss-dna2 is the complementary series of ss-dna1
Dsdna:ss-dna1+ss-dna2
Determined nucleic acid:
Nucleic acid g- tetra- serobila
Hum24:ttagggttagggttagggttaggg (its sequence is shown in sequence 1 in sequence table)
C-myc:tgagggtggggagggtggggaa (its sequence is shown in sequence 2 in sequence table)
Tba:ggttggtgtggttgg (its sequence is shown in sequence 3 in sequence table)
22ag k+: agggttagggttagggttaggg (its sequence is shown in sequence 4 in sequence table)
22ag na+: agggttagggttagggttaggg (its sequence is shown in sequence 4 in sequence table)
Compound e1 solution: compound e1 is first made into the storage mother liquor of 10mm with dimethyl sulfoxide (DMSO), then uses buffer solution
The solution c that storage mother liquor is diluted to 0.5～20 μm is used for by (10mmtris-hcl, ph=7.4,20mmkcl, 100mmnacl)
Test, special is pointed out that for 22ag na+Compound e1 with cushioning liquid (10mm tris-hcl, 100mm nacl,
0.1mm edta, ph=7.4), for 22ag k+Compound e1 with cushioning liquid (10mm tris-hcl, 20mm kcl,
0.1mm edta, ph=7.4) the solution c that is diluted to 0.5～20 μm is used for testing.
The preparation of nucleic acid solution: determined nucleic acid is dissolved in tris-hcl (ph=7.4) buffer solution, obtaining concentration is 0.25
μm～60 μm of solution a；Reference nucleic acid is diluted with the buffer solution of tris-hcl (ph=7.4), obtaining concentration is 0.25 μm～60 μ
The solution b of m.
2. absorption spectrum:
By solution a and solution c, solution b and solution c are sufficiently mixed respectively, then enter obtain two kinds of mixed liquors respectively
Two kinds of reaction solutions after above-mentioned incubation are carried out uv-visible absorption spectra analysis by row incubation 10 minutes.
2.1) with nucleic acid g- tetra- serobila hum24, c-myc, tba, 22ag k+、22ag na+As a example
Fig. 1 a is uv-visible absorption spectra change after compound e1 is acted on nucleic acid g- tetra- serobila.
As shown in Figure 1a, the concentration in 200 μ l is that to be separately added into the concentration of 200 μ l in 10 μm of compound e1 solution be 60
μm nucleic acid g- tetra- chain liquid solution, by ultraviolet specrophotometer, uv-visible absorption spectra is carried out to the mixed liquor after incubation
Analysis, the uv-visible absorption spectra that makes discovery from observation integrally strengthens, and it is because compound e1 is from aggregation to the change of monomer
Change causes.Additionally, compound e1 occurs in that one newly with the mixed solution of nucleic acid g- tetra- serobila in the range of 470～550nm
Wide absorption band.
2.2) taking reference nucleic acid ss-dna1, ss-dna2, dsdna as a example
Fig. 1 b is ultraviolet-ray visible absorbing after compound e1 is acted on reference nucleic acid and nucleic acid g- tetra- serobila (c-myc) respectively
Spectrum change compares figure.
As shown in Figure 1 b, in uv-visible absorption spectra, as 60 μm of reference nucleic acid ss-dna1, ss-dna2 of 200 μ l
Or after dsdna mixes incubation with 10 μm of compound e1 solution of 200 μ l, the absorption spectrum of compound e1 integrally strengthens, it is by gathering
Collective is to caused by the change of monomer, but the addition of ss-dna1, ss-dna2 or dsdna does not make compound e1 in 470nm to 550nm
In the range of a wide absorption band occurs, illustrate that compound e1 is combined with g- tetra- serobila, has high selectivity.Therefore compare
Whether compound e1 absorption spectrum a wide absorption band in the range of 470nm to 550nm, and whether absworption peak substantially increases
By force and higher than reference nucleic acid mixed liquor, if it is can determine whether the nucleic acid that determined nucleic acid is g- tetra- stranded structure；Conversely, being then non-
The nucleic acid of g- tetra- stranded structure.
3. fluorescence spectrum
Compound e1 solution: compound e1 is first made into the storage mother liquor of 10mm with dimethyl sulfoxide (DMSO), then with tris-hcl (ph
=7.4) storage mother liquor is diluted to the solution c that concentration is 0.5～20 μm and is used for testing by buffer solution.
The preparation of nucleic acid solution: determined nucleic acid is dissolved in tris-hcl (ph=7.4) buffer solution, obtaining concentration is 0.1 μ
The solution a of m～30 μm；Reference nucleic acid is diluted with the buffer solution of tris-hcl (ph=7.4), obtains concentration and be 0.1 μm～30 μm
Solution b.
By solution a and solution c, and solution b and solution c is sufficiently mixed respectively, then by obtain two kinds of mixed liquors respectively
Carry out being incubated 30 minutes, fluorescence excitation spectrum and emission spectrographic analysis are carried out to two kinds of reaction solutions after above-mentioned incubation.
3.1) with nucleic acid g- tetra- serobila hum24, c-myc, tba, 22ag k+、22ag na+, reference nucleic acid ss-dna1, ss-
As a example dna2, dsdna
Concentration by 100 μ l is nucleic acid g- tetra- chain that the concentration that 4 μm of compound e1 solution is separately added into 100 μ l is 20 μm
Liquid solution；Concentration by 100 μ l is that the reference nucleic acid that the concentration that 4 μm of compound e1 solution is separately added into 100 μ l is 20 μm is molten
Liquid, by XRF, carries out spectrofluorimetry respectively to the mixed liquor after incubation.
Fig. 2 a is the fluorescent exciting of compound e1 after compound e1 is acted on nucleic acid g- tetra- serobila and reference nucleic acid respectively
Spectrum change comparison diagram.
As shown in Figure 2 a, compound e1 does not originally almost have fluorescence, compound e1 and reference nucleic acid (ss- in buffer solution
Dna1, ss-dna2, dsdna) effect after, still there is no fluorescence or change in fluorescence very little, but with nucleic acid g- tetra- serobila (hum24,
c-myc、tba、22ag k+、22ag na+) after effect, fluorescence has significant enhancing.
Concentration by 100 μ l be 4 μm of compound e1 solution be 1.0 μm respectively with the concentration of 100 μ l, 2.0 μm, 4.0 μm,
6.0 μm, 8.0 μm, 12.0 μm, 16.0 μm, 20.0 μm, 24.0 μm of nucleic acid g- tetra- serobila 22ag na+After effect, after incubation
Mixed liquor carry out spectrofluorimetry respectively.
Fig. 2 b is the nucleic acid g- tetra- serobila 22ag na of compound e1 and variable concentrations+Fluorescence emission spectrum change after effect
Figure.
As shown in Figure 2 b, the fluorescence emission spectrum of the compound e1 in determined nucleic acid sample mix liquid is in 450～630nm model
Enclose and interior fluorescence peak occurs and fluorescence intensity shows with nucleic acid g- tetra- serobila 22ag na+Concentration (0.5 μm, 1.0 μm, 2.0 μm,
3.0 μm, 4.0 μm, 6.0 μm, 8.0 μm, 10.0 μm, 12.0 μm) increase and strengthen.Nucleic acid g- tetra- serobila hum24, c-myc,
tba、22ag k+Fluorescence spectrum change with 22ag na+Similar.
Fig. 2 c is compound after reference nucleic acid/nucleic acid g- tetra- serobila is incubated with different mixed in molar ratio from compound e1
The relative fluorescence of e1.
As shown in Figure 2 c, when the mol ratio of reference nucleic acid ss-dna1, ss-dna2 or dsdna and compound e1 is 5:1,
Significantly changing does not occur in the fluorescence intensity of compound e1.
And with nucleic acid g- tetra- serobila hum24, c-myc, tba, 22ag k+、22ag na+With the mol ratio of compound e1
Increase, the fluorescence intensity of compound e1 also gradually strengthens, as nucleic acid g- tetra- serobila hum24, c-myc, tba, 22ag k+、22ag
na+When mol ratio with compound e1 is 5:1, the fluorescence intensity level of compound e1 reaches maximum, thus explanation compound e1
Be combined with g- tetra- serobila, can be used for identifying nucleic acid g- tetra- stranded structure, there is high selectivity.
Therefore with compound e1, whether the fluorescent emission intensity in the range of 450～630nm is significantly raised, and is higher than reference
When more than 2 times of the fluorescence intensity of compound e1 in nucleic acid mixed liquor, then can determine whether that determined nucleic acid is g- tetra- stranded structure
Nucleic acid；Conversely, being then the nucleic acid of non-g- tetra- stranded structure.
Embodiment 12, the proliferation inhibition activity to tumour cell for the compound e1-e10
1. experimental procedure:
1.1) the kind plate of cell: in each 96 orifice plate every hole inoculate 5000 cells (cell line is mcf-7, a549,
A549t, pc3), 100 microlitres of the every pore volume of the nutrient solution containing cell.
1.2) addition of measured object: after 96 orifice plates of inoculated cell are placed 24 hours in 37 DEG C of insulating box, will change
Compound e1 is divided into 9 concentration gradients (10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm and 100 μm), so
Afterwards e1100 microlitre of the compound of each concentration is added separately in 3 parallel holes in 96 orifice plates, zeroing hole (without cell)
In can be not added with or plus isopyknic nutrient solution.
1.3) detection of cytoactive, the old nutrient solution of reject after 72 hours, add the solution that 110 μ l contain cck-8
(dojindo molecular technologies, inc) (100 μ l nutrient solution+10 μ l contains the solution of cck-8), 37 DEG C of temperature baths
The absorbance at 450nm is detected with ELIASA after 30～60min.
2. the inhibitory activity to tumour cell for the compound e1
Fig. 3 is the inhibitory activity to tumour cell for the compound e1.
As shown in figure 3, with the rising of compound e1 concentration, the survival rate of cell reduces.Calculate Cell growth inhibition respectively
Reach the concentration of compound e1 when 50%, with ic50Value represents, result is as shown in table 1.
Table 1 compound e1-e10 is to different tumor cell line growth inhibition effect (ic50/μm)
| Cell line | Compound e1 | Compound e2 | Compound e3 | Compound e4 | Compound e5 |
| mcf-7 | 2.90 | 8.91 | 7.61 | 2.56 | 1.89 |
| a549 | 0.85 | 4.36 | 5.41 | 0.36 | 3.20 |
| a549t | 2.57 | 5.27 | 3.68 | 1.89 | 2.84 |
| pc3 | 1.44 | 6.38 | 4.26 | 1.56 | 3.36 |
| Cell line | Compound e6 | Compound e7 | Compound e8 | Compound e9 | Compound e10 |
| mcf-7 | 10.61 | 6.86 | 2.48 | 3.47 | 3.16 |
| a549 | 8.93 | 10.13 | 8.26 | 2.94 | 1.23 |
| a549t | 11.35 | 5.64 | 6.27 | 4.69 | 2.78 |
| pc3 | 9.62 | 3.89 | 10.29 | 5.79 | 3.66 |
Result shows the phenanthroline compound of 2,9- double styrene replacement of the present invention in vitro to these four
Tumor cell line has stronger inhibitory action.The phenanthroline chemical combination that 2,9- double styrene therefore of the present invention replaces
Thing can be used for preparing the medicine of anticancer.
Claims (12)
1. compound shown in formula i:
In above-mentioned formula i, r1And r2Independently selected from following any one: c1-c8 alkyl, substituted or unsubstituted containing hetero atom
Cycloalkyl；Or r1And r2One of be the disubstituted amino of c1-c6 alkyl, another be substituted or unsubstituted containing miscellaneous
The cycloalkyl of atom；
Described substituted or unsubstituted containing the hetero atom in heteroatomic cycloalkyl be selected from following at least one: n, o and s；Institute
Stating cycloalkyl is 3-6 unit cycloalkyl；
Described substituted it is selected from following at least one: c1-c6 alkyl ,-(ch containing the substituent in heteroatomic cycloalkyl2)n-
Oh wherein n=1-8 ,-(ch2)n- ph wherein n=1-6, ph represent phenyl.
2. compound according to claim 1 it is characterised in that: described compound be following any one:
3. a kind of method preparing compound described in claim 1, comprises the steps: compound shown in formula and formula institute
Show that shown in compound and formula, compound carries out condensation reaction, obtain compound shown in formula i；
In above-mentioned formula and formula, r1And r2Independently selected from following any one: c1-c8 alkyl, substituted or unsubstituted containing
Heteroatomic cycloalkyl；Or r1And r2One of be the disubstituted amino of c1-c6 alkyl, another be substituted or unsubstituted
Containing heteroatomic cycloalkyl；
Described substituted or unsubstituted containing the hetero atom in heteroatomic cycloalkyl be selected from following at least one: n, o and s；Institute
Stating cycloalkyl is 3-6 unit cycloalkyl；
Described substituted it is selected from following at least one: c1-c6 alkyl ,-(ch containing the substituent in heteroatomic cycloalkyl2)n-
Oh wherein n=1-8 ,-(ch2)n- ph wherein n=1-6, ph represent phenyl.
4. method according to claim 3 it is characterised in that: in methods described, compound shown in described formula with described
Compound shown in formula, the mol ratio of compound shown in described formula are followed successively by 1:1:1；
The temperature of described condensation reaction is 90 DEG C -120 DEG C, and the time is 12h-36h.
5. the application in identification nucleic acid g- tetra- stranded structure as molecular probe of compound described in claim 1 or 2.
6. a kind of recognition methods of nucleic acid g- tetra- stranded structure it is characterised in that: the identification side of described nucleic acid g- tetra- stranded structure
Method adopts the compound described in claim 1 or 2 as the identification probe of nucleic acid g- tetra- stranded structure；
The recognition methods of described nucleic acid g- tetra- stranded structure, comprises the steps:
(1) nucleic acid samples to be detected and reference nucleic acid sample are dissolved in buffer solution respectively, obtain nucleic acid samples solution a to be detected
With reference nucleic acid sample solution b；With organic solvent by after the dissolving of compound shown in described formula i, obtained with the dilution of described buffer solution
Detection solution c；
(2) described nucleic acid samples solution a to be detected is mixed to get mixed solution 1 with detection solution c, by described reference nucleic acid sample
Product solution b is mixed to get mixed solution 2 with detection solution c, then carries out the mixed solution obtaining 1 and mixed solution 2 respectively
Incubation, mixed solution 1 and mixed solution 2 after being incubated after be incubated；After again to mixed solution 1 after described incubation and described incubation
Mixed solution 2 carry out following a) or b):
A) uv-visible absorption spectra analysis is carried out respectively to mixed solution 2 after mixed solution 1 after described incubation and incubation, will
Mixed solution 2 after the uv-visible absorption spectra of compound shown in formula i in mixed solution 1 after described incubation and described incubation
In the uv-visible absorption spectra of compound shown in formula i be compared, thus judging that whether described nucleic acid samples to be detected are
The nucleic acid of g- tetra- stranded structure；
Or
B) spectrofluorimetry is carried out respectively to mixed solution 2 after mixed solution 1 after described incubation and incubation, after described incubation
Compound shown in formula i in mixed solution 2 after the fluorescence spectrum of compound shown in formula i in mixed solution 1 and described incubation
Fluorescence spectrum is compared, thus judging that whether described nucleic acid samples to be detected are the nucleic acid of g- tetra- stranded structure.
7. method according to claim 6 it is characterised in that: in methods described step (1), described nucleic acid samples to be detected
Nucleic acid for g- tetra- stranded structure；
Described reference nucleic acid sample is the nucleic acid of non-g- tetra- stranded structure；
Described buffer solution is tris-hcl buffer solution or phosphate buffer；
The ph value of described buffer solution is 6-8；
Described nucleic acid samples solution a to be detected, the molar concentration of nucleic acid samples to be detected is 0.25 μm -60 μm；
In described reference nucleic acid sample solution b, the molar concentration of reference nucleic acid sample is 0.25 μm -60 μm；
In described detection solution c, the molar concentration of compound shown in formula i is 0.5 μm -20 μm.
8. the method according to claim 6 or 7 it is characterised in that: in methods described step (2), described mixed solution 1
In, described nucleic acid samples to be detected are 0.125-6 with the mol ratio of compound shown in formula i；
In described mixed solution 2, described reference nucleic acid sample is 0.125-6 with the mol ratio of compound shown in formula i；
Described a) in, when observe described incubation after mixed solution 1 in compound shown in formula i uv-visible absorption spectra
It is remarkably reinforced in the range of 310～550nm, and new absworption peak occurs in the range of 470～550nm, then described core to be detected
The nucleic acid of g- tetra- stranded structure confirmed as by sour sample；Conversely, being then the nucleic acid of non-g- tetra- stranded structure；
Described b) in, the fluorescence emission spectrum of compound shown in formula i in mixed solution 1 after observing incubation 450～
Fluorescence peak occurs in the range of 630nm and fluorescence intensity raises, and higher than the chemical combination shown in formula i in mixed solution 2 after described incubation
The fluorescence intensity that the fluorescence emission spectrum of thing occurs in the range of 450～630nm, then nucleic acid samples to be detected confirm as g- tetra- chain
The nucleic acid of body structure；Conversely, being then the nucleic acid of non-g- tetra- stranded structure.
9. the compound described in claim 1 or 2 is in the application of following aspects:
1) application in preparation eucaryote tumor cell proliferation inhibitor；2) in preparation prevention and/or tumor
In application；
Described eucaryote is mammal；Described tumour cell is cancer cell；Described tumour is cancer.
10. according to claim 9 application it is characterised in that: described cancer cell be lung carcinoma cell, breast cancer cell or front
Row adenocarcinoma cell；Described cancer is lung cancer, breast cancer or prostate cancer.
11. according to claim 10 application it is characterised in that:
Described lung carcinoma cell is drug resistance lung carcinoma cell a549t；
Described breast cancer cell is human breast cancer cell mcf-7；
Described lung carcinoma cell is human lung carcinoma cell a549；
Described prostate gland cancer cell is Human Prostate Cancer Cells pc-3.
A kind of 12. products, its active component is the compound described in claim 1 or 2, and wherein, described product is: 1) eucaryon life
Thing tumor cell proliferation inhibitor；2) medicine of prevention and/or treatment tumour.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510103607.7A CN104693199B (en) | 2015-03-09 | 2015-03-09 | 2,9-bis-styryl substituted phenanthroline compounds, and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510103607.7A CN104693199B (en) | 2015-03-09 | 2015-03-09 | 2,9-bis-styryl substituted phenanthroline compounds, and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104693199A CN104693199A (en) | 2015-06-10 |
| CN104693199B true CN104693199B (en) | 2017-01-25 |
Family
ID=53340791
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510103607.7A Active CN104693199B (en) | 2015-03-09 | 2015-03-09 | 2,9-bis-styryl substituted phenanthroline compounds, and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104693199B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108066340B (en) * | 2016-11-10 | 2020-10-27 | 中国科学院化学研究所 | Pharmaceutical composition |
| CN108066341B (en) * | 2016-11-10 | 2020-10-30 | 中国科学院化学研究所 | Application of compound in preparation of anti-cancer drugs |
| WO2019134680A1 (en) * | 2018-01-05 | 2019-07-11 | 广州市恒诺康医药科技有限公司 | Inhibitor of apoptosis signal-regulating kinase-1 and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1035213A1 (en) * | 1997-11-04 | 2000-09-13 | Fuji Photo Film Co., Ltd. | Method for enzyme assay |
-
2015
- 2015-03-09 CN CN201510103607.7A patent/CN104693199B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1035213A1 (en) * | 1997-11-04 | 2000-09-13 | Fuji Photo Film Co., Ltd. | Method for enzyme assay |
Non-Patent Citations (2)
| Title |
|---|
| Arylvinylene phenanthroline derivatives for electron transport in blue organic light emitting diodes;Poopathy Kathirgamanathan et al.;《Organic Electronic》;20110125;第12卷;666-676页 * |
| Synthesis of new functionalized 1,10-phenanthrolines;Gulakova , E. N. et al;《Russian Chemical Bulletin》;20101231;第9卷;第1292-1295页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104693199A (en) | 2015-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | A novel p-aminophenylthio-and cyano-substituted BODIPY as a fluorescence turn-on probe for distinguishing cysteine and homocysteine from glutathione | |
| Elmas et al. | A novel fluorescent probe based on isocoumarin for Hg2+ and Fe3+ ions and its application in live-cell imaging | |
| Qin et al. | Synthesis, DNA-binding affinities, and binding mode of berberine dimers | |
| CN103728294B (en) | Bisbenzimidazole connection carbazole compound is for specific binding nucleic acid G-tetra-chain body structures and in the application of antineoplastic | |
| CN104449669B (en) | A kind of polyaryl substituted imidazole fluorescence probe and preparation method thereof and the application in detection G-tetra-stranded structure | |
| CN104693199B (en) | 2,9-bis-styryl substituted phenanthroline compounds, and preparation method and application thereof | |
| Zhao et al. | A coumarin-based terpyridine–zinc complex for sensing pyrophosphate and its application in in vivo imaging | |
| Rescifina et al. | Synthesis and biological activity of novel bifunctional isoxazolidinyl polycyclic aromatic hydrocarbons | |
| Lee et al. | Synthesis, anticancer activity and pharmacokinetic analysis of 1-[(substituted 2-alkoxyquinoxalin-3-yl) aminocarbonyl]-4-(hetero) arylpiperazine derivatives | |
| Sović et al. | Synthesis, antitumor activity and DNA binding features of benzothiazolyl and benzimidazolyl substituted isoindolines | |
| Basu et al. | Nucleic acids binding strategies of small molecules: Lessons from alkaloids | |
| Johnson et al. | Aminonaphthalimide hybrids of mitoxantrone and amonafide as anticancer and fluorescent cellular imaging agents | |
| Suseela et al. | Recognition of G-quadruplex topology through hybrid binding with implications in cancer theranostics | |
| Gabr et al. | Platinum (II) complexes with sterically expansive tetraarylethylene ligands as probes for mismatched DNA | |
| Shrestha et al. | Design, synthesis, biological evaluation, structure-activity relationship study, and mode of action of 2-phenol-4, 6-dichlorophenyl-pyridines | |
| Purgatorio et al. | Scouting around 1, 2, 3, 4‐Tetrahydrochromeno [3, 2‐c] pyridin‐10‐ones for Single‐and Multitarget Ligands Directed towards Relevant Alzheimer's Targets | |
| Holden et al. | Selective, disruptive luminescent Ru (II) polypyridyl probes of G-quadruplex | |
| Pandith et al. | Loop-mediated fluorescent probes for selective discrimination of parallel and antiparallel G-Quadruplexes | |
| CN107674076A (en) | One kind has the preparation method and purposes of the rutaecarpin split nitrogen mustard derivatives of antitumor activity | |
| Wang et al. | Synthesis of 9, 9‐Dialkyl‐4, 5‐diazafluorene Derivatives and Their Structure–Activity Relationships Toward Human Carcinoma Cell Lines | |
| Javid et al. | AIEE active novel chalcone based fluorescent probe for sensitive detection of drotaverine in solid state and real samples through fluorescence enhancement | |
| Morozov et al. | Supramolecular Recognition of Cytidine Phosphate in Nucleotides and RNA Sequences | |
| Refat et al. | Spectrophotometric determination of albendazole drug in tablets: Spectroscopic characterization of the charge‐transfer solid complexes | |
| Janovec et al. | Synthesis, DNA interaction, and cytotoxic activity of a novel proflavine− dithiazolidinone pharmacophore | |
| Chang et al. | Identification of a new class of WNT1 inhibitor: Cancer cells migration, G-quadruplex stabilization and target validation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |