CN104673759A - Exogenous gene-expressed recombinant influenza virus as well as preparation method and application of recombinant influenza virus - Google Patents
Exogenous gene-expressed recombinant influenza virus as well as preparation method and application of recombinant influenza virus Download PDFInfo
- Publication number
- CN104673759A CN104673759A CN201410317186.3A CN201410317186A CN104673759A CN 104673759 A CN104673759 A CN 104673759A CN 201410317186 A CN201410317186 A CN 201410317186A CN 104673759 A CN104673759 A CN 104673759A
- Authority
- CN
- China
- Prior art keywords
- gene
- virus
- recombinant
- influenza
- ediii
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an exogenous gene-expressed recombinant influenza virus. The recombinant influenza virus is a recombinant virus constructed by inserting an exogenous gene into the HA gene packaging signal sequence of the PR8 influenza virus. The invention also discloses a preparation method and the application of the recombinant influenza virus. The exogenous gene-expressed recombinant influenza virus is used for developing novel viral vaccines and is also used for screening antivirus drugs.
Description
Technical field
The present invention relates to technical field of bioengineering, particularly relate to recombinant influenza of a kind of expression alien gene and its preparation method and application.
Background technology
Influenza virus is segmented sub-thread minus-stranded rna virus, belongs to orthomyxoviridae family (Orthomyxoviridae) Influenza Virus (Influenza virus).A type influenza is one of disease of the current topmost threat mankind and animal health, and it can infect the population in the whole world 30% within the several months, and the estimation that lethality rate is guarded reaches 2%.But the general less generation of being very popular of influenza, average every 10-50 occurs once.Since twentieth century, there occurs five flu outbreaks in history, be respectively the spanish influenza of 1918, nineteen fifty-seven Asia influenza, nineteen sixty-eight Mao flu and the Russian flu of 1977, the Pademic H1N1 influenza of 2009.The outburst of each influenza causes huge loss all to the health of the mankind and social economy.In order to prevention and corntrol influenza virus, the exploitation of new anti-influenza virus medicament is imperative.
Tokiko Watanabe etc., by building a series of deletion plasmid, after packaging efficiency is compared in inspection after transfection, determine the HA packaging signal utilized for the HA vRNA required for virus packaging.The influenza virus of expression alien gene can be used for screening antiviral, neutralizing antibody, propagates and Study on Pathogenicity as vaccine and for body inner virus.
Summary of the invention
The present invention will solve the technical problem lacking efficient anti-influenza virus medicament at present, and provide a kind of recombinant influenza of expression alien gene, this recombinant influenza can not only be used for the virus vaccines of development of new, and can be used for screening antiviral.
In addition, the preparation method and application of the recombinant influenza that a kind of above-mentioned expression alien gene is provided also are needed.
In order to solve the problems of the technologies described above, the present invention is achieved through the following technical solutions:
In one aspect of the invention, provide a kind of recombinant influenza of expression alien gene, this recombinant influenza is the recombinant virus inserting foreign gene in the HA gene packaging signal sequence of PR8 influenza virus.
Preferably, described foreign gene comprises: renilla luciferase gene, duck tembusu virus E protein the 3rd domain gene sequence or H9N2 hypotype SH441 strain HA gene.
In another aspect of this invention, provide a kind of nucleic acid molecule, comprise the HA gene order of PR8 influenza virus, in the packaging signal sequence of this HA gene, be inserted with exogenous gene sequence.
Described foreign gene comprises: renilla luciferase gene, duck tembusu virus E protein the 3rd domain gene sequence or H9N2 hypotype SH441 strain HA gene.
In another aspect of this invention, a kind of recombinant vectors comprising above-mentioned nucleic acid molecule is additionally provided.
In another aspect of this invention, additionally provide a kind of preparation method of recombinant influenza of expression alien gene, comprise the following steps:
Build the recombinant vectors containing PR8 influenza virus HA gene, in the packaging signal sequence of described HA gene, be inserted with exogenous gene sequence;
By described recombinant vectors, with to transcribe plasmid and transient expression PB1, PB2, PA, NP transfection 293T cell together with the plasmid of HA of PR8 virus PB1, PB2, PA, NP, NA, M, NS gene respectively, rescue obtains the recombinant influenza of expression alien gene.
In another aspect of this invention, a kind of application of above-mentioned recombinant influenza is additionally provided, for the preparation of antiviral vaccine.
In another aspect of this invention, a kind of application of above-mentioned recombinant influenza is additionally provided, for screening antiviral.When the foreign gene inserted in recombinant influenza of the present invention be fluorescence protein gene as renilla luciferase gene time, this recombinant influenza can be used for screening new antiviral.
The recombinant influenza of expression alien gene of the present invention, can not only be used for the virus vaccines of development of new, and can be used for screening antiviral.
Accompanying drawing explanation
Below in conjunction with the drawings and specific embodiments, the present invention is further detailed explanation.
Fig. 1 is the Western Blot qualification result figure of the embodiment of the present invention 2 containing EDIII peptide section recombinant virus HA-EDIII-HA expression alien gene;
Fig. 2 is the embodiment of the present invention 2 confocal laser scanning microscope foreign protein positioning result figure;
Fig. 3 is foreign gene detected result figure after the embodiment of the present invention 2 viral passages is cultivated;
Fig. 4 is HA-EDIII-HA virus growth curve chart on MDCK-HA2 cell of the embodiment of the present invention 2;
Fig. 5 is the HA-EDIII-HA intramuscular inoculation immune animal experimental result picture of the embodiment of the present invention 2;
Fig. 6 is the HA-EDIII-HA intravenous injection immunoprophylaxis results of animal figure of the embodiment of the present invention 2.
Embodiment
In the following example, the experimental technique of unreceipted actual conditions, usual condition routinely, as " fine works molecular biology experiment guide " (F.M. Ao Sibai, R.E. James Kingston, the chief editors such as J.G. Sai Deman, Ma Xuejun, Su Yuelong translates. Beijing: Science Press, 2004) described in method carry out.
The present invention utilizes the clone of reverse genetics manipulation technology and stably express HA albumen, in PR8-HA packaging signal, insert different foreign gene, builds chimeric recombinant virus.And the recombinant virus HA-EDIII-HA to stable expression of exogenous gene in MDCK-HA2 clone, immunization experiment animal, for the antibody situation of foreign protein in tracking monitor animal blood, thus determines that it has immune protective effect further.
First the HA gene packaging signal of PR8 is inserted into rna transcription carrier by the present invention, then insert respectively between packaging signal renilla luciferase gene (Renilla luciferase), duck tembusu virus (DTMUV) codon optimized or the EDIII sequence that wild E gene, duck tembusu virus are codon optimized or wild, codon optimized or wild H9N2 hypotype SH441 strain HA gene, utilize influenza virus reverse genetic operating system Revive virus.Result shows: the recombinant virus containing HA-Renilla-HA, HA-EDIII-HA, HA-441-HA-HA can be saved successfully, proves that foreign gene is present in recombinant virus by RT-PCR method.
After the restructuring HA-EDIII-HA virus infection MDCK-HA2 cell of expressing external source EDIII peptide section goes down to posterity by the present invention further, with 100 μ l10
3tCID
50after cells infected, after 60h, HA-HI test reaches and is up to 2
5, 48h virus titer is up to 10
5.0tCID
50/ 100 μ l.By laser co-focusing and Western Blot method, find in HA-EDIII-HA virus infected cell, the expression of NP albumen and EDIII albumen can be detected simultaneously at kytoplasm.
The present invention for experimental animal model, through muscle, intravenous inoculation HA-EDIII-HA, HA-Renilla-HA, establishes negative control with the SPF sheldrake in surrounding age simultaneously, and immunity twice, with the antibody horizontal of EDIII in indirect ELISA method tracking and measuring sheldrake body.Result shows: HA-EDIII-HA group is exempted from EDIII antibody in one week two and risen fast, and decline subsequently, intravenous immunisations antibody is higher than intramuscular immunisation.Latter 2 weeks of second time immunity, intramuscular inoculation 10
3.5eLD
50duck tembusu virus FX2010, to attack after poison 1,2,3,4d blood sampling, fluorescence quantitative PCR detection sheldrake virus in blood nucleic acid copies, analyzes the proliferative conditions of virus in sheldrake body.Result shows: attack the rear first day of poison, the viral nucleic acid copy number of HA-Renilla-HA group is close with control group, and HA-EDIII-HA group is lower; Second day, HA-EDIII-HA papova nucleic acid copies was starkly lower than HA-Renilla-HA and PBS group; 3rd day and the 4th day, the duck viral nucleic acid copy number content of all groups declined, and HA-EDIII-HA group is starkly lower than other groups.These experimental results show, the recombinant influenza of expression alien gene EDIII of the present invention can excite effective antibody response in animal body, plays immanoprotection action.
Embodiment 1 expresses the strains of influenza viruses of renilla luciferase (Renilla luciferase) albumen
1. Renilla luciferase gene is inserted the structure containing HA packaging signal plasmid
With pIRES-Renilla plasmid for template, with xhoI-Renilla-F and NheI-Renilla-R (xhoI-Renilla-F:CTACTCGAGGCCACCATGACTTCGAAAGTTTATGATCC (SEQ ID NO.4); NheI-Renilla-R:CCGGCTAGCTTATTGTTCATTTTTGAGAACTCGC (SEQ ID NO.5)) be upstream and downstream primer amplification renilla luciferase gene Renilla luciferase sequence (SEQ ID NO.1).And be connected to (this laboratory structure on the PUC19-HA-packaging signals carrier of same double digestion with XhoI, NheI double digestion, wherein, the packaging signal sequence of HA gene is as shown in SEQ ID NO.21, and in SEQ ID NO.21,43-100 position nucleotide sequence is the restriction enzyme site inserted), transform, PCR identifies, extracts positive plasmid pUC19-HA-Renilla-HA, with M13-47, RV-M sequencing primer checks order
M13-47：5’-CGCCAGGGTTTTCCCAGTCACGAC-3’(SEQ ID NO.6)，
RV-M:5’-GAGCGGATAACAATTTCACACAGG-3’(SEQ ID NO.7)。
After order-checking is correct, intracellular toxin extracting plasmid, for subsequent use in-20 DEG C.
2. the rescue containing Renilla luciferase virus
12-24h before transfection, is laid on 293T cell on 6 orifice plates, carries out transfection when the density of monolayer cell reaches more than 80%.Use transfection reagent Lipofectamine
tM2000, (except 4 helper plasmid pCAGGS-PB2, pCAGGS-PB1, pCAGGS-PA and pCAGGS-NP each transfection 1 μ g, all the other 9 plasmids pUC19-HA-Renilla-HA, pBD-PR8PB1, pBD-PR8PB2, pBD-PR8PA, pBD-PR8NP, pBD-PR8NA, pBD-PR8NS, pBD-PR8M, pCAGGS-HA are transfection 0.3 μ g respectively; ) cotransfection 293T cell.The CO being put in 37 DEG C is continued after transfection
2cultivate 48h in incubator, the viral nomenclature saved out is HA-Renilla-HA.
3. rescue the qualification obtaining virus
A. hemagglutination test qualification
Cell conditioned medium after transfection 48h is added the TPCK-Trypsin of 1 μ l0.5mg/ml, 37 DEG C of incubation 2h, then the MDCK-HA2 cell growing to 80% is inoculated in, after absorption 1.5h, three times are washed with PBS, add serum-free medium SFM (Gibico), be placed in 37 DEG C of incubators and cultivate.Observation of cell pathology, when pathology reaches 90%, collecting cell supernatant also does hemagglutination test, and hemagglutinative titer is 2
4.
Hemagglutination test method is as follows: in U-shaped 96 orifice plates, and every hole adds the PBS solution of 50 μ L; Getting 50 μ L cell conditioned medium liquid respectively adds in the hole of first row, and the supernatant liquor drawing 50 μ L with the volley of rifle fire mixes in the second hole, then draws 50 μ L in the 3rd hole, doubling dilution successively, and in the 12 round, 50 μ L liquid of sucking-off mixing discard; Then every hole adds the red corpuscle of 50 μ L0.5% respectively; Room temperature leaves standstill observations after 30min.The HA-HI test of result display recombinant virus is 2
4.Collect have the supernatant packing of pathology and frozen in-80 DEG C.
B. rescued virus RT-PCR identifies
Collect and have pathology and the MDCK-HA2 cell culture supernatant having blood clotting, extract the RNA of virus by TRIZOL method.Get the viral RNA that 5 μ l extract, add the reverse transcription primer 12bp (5'-AGCAAAAGCAGG-3'(SEQ ID NO.8) of 2 μ l), abundant mixing is placed on PCR instrument, 70 DEG C of effect 10-15min, are placed in rapidly 2min on ice, add following reagent: DEPC water 6 μ l, 5 × M-MLV RT damping fluid 4 μ l, dNTP mixed solution (10mM) 2 μ l, RNasin ribonuclease inhibitor 0.5 μ l, M-MLV reversed transcriptive enzyme 0.5 μ l; Reaction conditions: 30 DEG C of 10min, 42 DEG C of 2h, 70 DEG C of 15min.
With synthesis cDNA for template, the M gene of amplicon virus and Renilla gene fragment, the primer sequence of M gene respectively: M-F:CACACAgctcttctattAGCAAAAGCAGGTAG (SEQ ID NO.9); M-R:CACACAgctcttcggccAGTAGAAACAAGGTAGTTTTT (SEQ ID NO.10); The primer of Renilla gene is: xhoI-Renilla-F (SEQ ID NO.4) and NheI-Renilla-R (SEQ ID NO.5).Reaction system is as follows: PCR Mix:25 μ l; Ultrapure water: 19 μ l; Upstream primer: 2 μ l; Downstream primer: 2 μ l; CDNA:2 μ l.Reaction conditions: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, 53 DEG C of annealing 30s, 72 DEG C of extensions: 1min/1,000bp, 30 circulations, 72 DEG C extend 10min, 12 DEG C of preservations.Cut object band glue and reclaim order-checking.Sequencing result checking is correct.
C.Renilla Luciferase protein determination
MDCK-HA2 cell 48 orifice plate grows to about 80%, washes cell 2 times with sterilizing PBS, adds the serum free medium (SFM) of 100 μ l after washing.Connect virus liquid (MOI=4) extremely every hole that 100 μ l dilute.Hatch 2h, abandon supernatant for 37 DEG C, wash cell 2 times with aseptic PBS, after washing, add the serum free medium (SFM) of 200-250 μ l.48h after connecing poison, collects its cell conditioned medium and lysing cell respectively.Cell is washed three times with PBS, then the mensuration of Renilla Luciferase albumen is carried out according to Renilla Luciferase Assay System (Promega) specification sheets, simply tell as follows: add 65 μ l1 × Renilla Luciferase Assay Buffer to treating gaging hole, shaking table shakes 15-20min.Collect lysate and cell debris, 10000rpm high speed centrifugation 30s, get supernatant, the Renilla Luciferase Assay Reagent of 100 μ l adds the cell pyrolysis liquid of 20 μ l, spectrophotometer reading numerical values is used in quick mixing (1-2s), and result is 13026670Relative light unit/sec.
D. the Secondary Culture of virus
In order to observe the stability of this virus, HA-Renilla-HA virus being met 200 μ l by 1:10 dilution on MDCK-HA2 cell, passed for 4 generations continuously, then blood clotting mensuration is carried out to every generation, cytopathy is observed and Renilla Luciferase genetic testing.Result display often all can make the cytopathy of more than 80% for viral 72h, and hemagglutinative titer is 2
4, every Dai Junneng detects the existence of Renilla Luciferase gene and Renilla Luciferase albumen, shows that this virus can be stablized and goes down to posterity.
E. viral TCID
50mensuration
By virus 10 times of doubling dilutions, from 10
-1~ 10
-9each extent of dilution infects the individual layer MDCK-HA2 cell to 96 orifice plates respectively, adds 100 μ l virus liquids in each hole, and each extent of dilution does 4 repetitions; Within 5th day, observe the cytopathy situation in each hole after connecing poison, and utilize Reed-Muench method to calculate the TCID of virus
50, result measures the TCID of this virus
50be 10
5.6/ 100 μ l.
Embodiment 2 expresses the influenza virus of duck tembusu virus major antigenic region
1. duck tembusu virus E, optiE, EDIII, optiEDIII gene inserts the structure containing HA packaging signal plasmid
Taking pCAGGS-E as template, is the E gene order of upstream and downstream primer amplification duck tembusu virus (DTMUV) with primer sequence xhoI-E-F and NheI-E-R listed by following table 1; Be upstream and downstream primer amplification EDIII (E protein the 3rd structural domain) sequence (SEQ ID NO.2) with xhoI-EDIII-F and NheI-EDIII-R; Taking pCAGGS-optiE as template, is the codon optimized E gene order optiE of upstream and downstream primer amplification with xhoI-optiE-F and NheI-optiE-R; Be the codon optimized EDIII sequence optiEDIII of upstream and downstream primer amplification with xhoI-optiEDIII-F and NheI-optiEDIII-R; Double digestion amplified production is carried out with XhoI, NheI, be connected on the PUC19-HA-packaging signals carrier of same double digestion again, PCR qualification after transforming, extract positive plasmid pUC19-HA-E-HA, pUC19-HA-optiE – HA, pUC19-HA-EDIII – HA, pUC19-HA-optiEDIII – HA respectively, check order with M13-47, RV-M.After order-checking is correct, intracellular toxin is extracting plasmid in a small amount, for subsequent use in-20 DEG C.
Table 1 fragment amplification primer
Note: underscore represents restriction enzyme site.
2. Revive virus
12-24h before transfection, is laid on 293T cell on 6 orifice plates, carries out transfection when the density of monolayer cell reaches more than 80%.Use transfection reagent LipofectamineTM2000, (except 4 helper plasmid pCAGGS-PB2, pCAGGS-PB1, pCAGGS-PA and pCAGGS-NP each transfection 1 μ g, all the other 9 plasmid pUC19-HA-E-HA/pUC19-HA-optiE-HA/pUC19-HA-EDIII-HA/pUC19-HA-optiEDIII-HA, pBD-PR8PB1, pBD-PR8PB2, pBD-PR8PA, pBD-PR8NP, pBD-PR8NA, pBD-PR8NS, pBD-PR8M, pCAGGS-HA are transfection 0.3 μ g respectively; ) cotransfection 293T cell.Continue after transfection to be put in the CO2 incubator of 37 DEG C and cultivate 48h, the viral nomenclature saved out is HA-E-HA/HA-optiE-HA/HA-EDIII-HA/HA-optiEDIII-HA.
3. rescue the qualification obtaining virus
A. hemagglutination test qualification
Cell conditioned medium after transfection 48h is added the TPCK-Trypsin of 1 μ l0.5mg/ml, 37 DEG C of incubation 2h, then the MDCK-HA2 cell growing to 80% is inoculated in, after absorption 1.5h, three times are washed with PBS, add serum-free medium SFM (Gibico), be placed in 37 DEG C of incubators and cultivate.Observation of cell pathology, when pathology reaches 90%, collecting cell supernatant also does hemagglutination test.
Hemagglutination test method is as follows: in U-shaped 96 orifice plates, and every hole adds the PBS solution of 50 μ L; Getting 50 μ L cell conditioned medium liquid respectively adds in the hole of first row, and the supernatant liquor drawing 50 μ L with the volley of rifle fire mixes in the second hole, then draws 50 μ L in the 3rd hole, doubling dilution successively, and in the 12 round, 50 μ L liquid of sucking-off mixing discard; Then every hole adds the red corpuscle of 50 μ L0.5% respectively; Room temperature leaves standstill observations after 30min.The HA-HI test of result display recombinant virus HA-E-HA, HA-optiE-HA, HA-EDIII-HA, HA-optiEDIII-HA is 2
4.Collect and have the supernatant packing of pathology and frozen in-80 DEG C.
B. rescued virus RT-PCR identifies
Collect and have pathology and the MDCK-HA2 cells and supernatant having blood clotting, extract the RNA of virus by TRIZOL method.Get the viral RNA that 5 μ l extract, add the reverse transcription primer 12bp (5'-AGCAAAAGCAGG-3') of 2 μ l, abundant mixing is placed on PCR instrument, 70 DEG C of effect 10-15min, are placed in rapidly 2min on ice, add following reagent: DEPC water 6 μ l, 5 × M-MLVRT damping fluid 4 μ l, dNTP mixed solution (10mM) 2 μ l, RNasin ribonuclease inhibitor 0.5 μ l, M-MLV reversed transcriptive enzyme 0.5 μ l; Reaction conditions: 30 DEG C of 10min, 42 DEG C of 2h, 70 DEG C of 15min.
With synthesis cDNA for template, the M gene of amplicon virus and EDIII gene fragment, the primer sequence of M gene respectively: M-F:CACACAgctcttctattAGCAAAAGCAGGTAG (SEQ ID NO.9); M-R:CACACAgctcttcggccAGTAGAAACAAGGTAGTTTTT (SEQ ID NO.10); Respectively by xhoI-E-F and NheI-E-R, xhoI-optiE-F and NheI-optiE-R, xhoI-EDIII-F and NheI-EDIII-R, xhoI-optiEDIII-F and NheI-optiEDIII-R amplification E, optiE, EDIII, optiEDII sequence.Reaction system is as follows: PCR Mix:25 μ l; Ultrapure water: 19 μ l; Upstream primer: 2 μ l; Downstream primer: 2 μ l; CDNA:2 μ l.Reaction conditions: 95 DEG C of denaturation 3min, 95 DEG C of sex change 30s, 53 DEG C of annealing 30s, 72 DEG C of extensions: 1min/1,000bp, 30 circulations, 72 DEG C extend 10min, 12 DEG C of preservations.Cut object band glue and reclaim order-checking.Sequencing result is verified, four kinds of viruses all can detect M gene, have illustrated that influenza virus is saved out, but only have HA-EDIII-HA the existence of goal gene EDIII can be detected, and sequencing result is correct.
C.Western Blot identifies
After virus infection MDCK-HA2 cell, when pathology reaches more than 80%, discard supernatant, collect the cell having pathology, then cell pyrolysis liquid cracking is added, get the SDS-Poly n alkylacrylates (SDS-PAGE) that supernatant carries out 15%, then transferring film carries out Western Blot qualification.The serum (mouse serum prepared by this laboratory prokaryotic expression EDIII) that the primary antibodie wherein used is mouse-anti EDIII, simultaneously with β-Actin for internal reference contrast (difficult to understand biological purchased from prestige), two resist for IRDye@680RD donkey against murine IgG (purchased from American LI-COR), with Odyssey Dual band IR laser imaging system scanning imagery, as shown in Figure 1, HA-EDIII-HA can detect that target protein EDIII expresses to result.
D. laser co-focusing is to the location of foreign protein
MDCK-HA2 cell is layered in the Tissue Culture Dish containing cover glass, when Growth of Cells reaches the density of 10-20%, by HA-E-HA, HA-optiE-HA, HA-EDIII-HA, HA-optiEDIII-HA virus infected cell, continue to cultivate about 16h, fix with 4% paraformaldehyde (PFA) of precooling, with 0.5%Triton X-100 permeabilized cells, the macromole such as antibody are passed through; Then hatch with containing in the PBS solution of 1%BSA, normal temperature is closed; Next anti-the hatching of primary antibodie two is carried out, the primary antibodie of influenza NP albumen is the anti-NP of rabbit many anti-(purchased from Gene Tex), the primary antibodie of duck tembusu virus is 1F5 monoclonal antibody, two anti-be respectively FITC mark sheep anti-mouse igg (H+L) (purchased from Zhong Shan Golden Bridge) and TRITC mark goat anti-rabbit igg (purchased from Jaxkson); With the DAPI (difficult to understand biological purchased from prestige) of 5ug/ml, nucleus is dyeed; Finally add a small amount of anti-cancellation mountant mounting.With laser confocal microscope scanning, light source uses 488nm, 408nm, 543nm wavelength respectively, excites green, blueness and red fluorescence.As shown in Figure 2, HA-ED III-HA virus can express NP albumen and ED III albumen to result simultaneously in kytoplasm.
4. the Secondary Culture of virus
In order to observe the stability of this virus, HA-E-HA, HA-optiE-HA, HA-EDIII-HA, HA-optiEDIII-HA virus is met 200 μ l by 1:10 dilution on MDCK-HA2 cell, in continuous biography 4 generation, then blood clotting mensuration is carried out to every generation, cytopathy is observed and EDIII genetic testing.Result display often all can make the cytopathy of more than 80% for viral 72h, and hemagglutinative titer is 2
4, per in generation, can detect EDIII gene (see Fig. 3) to only have HA-EDIII-HA, shows that HA-EDIII-HA virus can be stablized and goes down to posterity.In Fig. 3, M:2000Marker, the first-generation of 0: negative control, 1-4:HA-E-HA is to forth generation; The first-generation of 5-7:HA-opti-E – HA is to the third generation; The first-generation of 8-11:HA-EDIII-HA is to forth generation; The first-generation of 12-14:HA-opti-EDIII – HA is to the third generation.
5.HA-EDIII-HA virus TCID
50mensuration
By virus 10 times of doubling dilutions, from 10
-1~ 10
-9each extent of dilution infects the individual layer MDCK-HA2 cell to 96 orifice plates respectively, adds 100 μ l virus liquids in each hole, and each extent of dilution does 4 repetitions; Within 5th day, observe the cytopathy situation in each hole after connecing poison, and utilize Reed-Muench method to calculate the TCID of virus
50, result measures the TCID of this virus
50be 10
5/ 100 μ l.
The drafting of 6.HA-EDIII-HA virus growth curve on MDCK-HA2 cell
Virus liquid is diluted for 1000TCID
50/ 100 μ l, get 100 μ l and are inoculated in 25mm
2grow on the MDCK-HA2 monolayer cell of 80% in culturing bottle, 12h, 24h, 36h, 48h, 60h and 72h after connecing poison, collect the cell conditioned medium of 500 μ l respectively, the hemagglutinative titer that then a part of supernatant carries out measures, and another part carries out TCID
50measure, finally draw the growth curve of virus on MDCK-HA2 cell, as shown in Figure 4,60h HA-HI test reaches the highest by 2
5(Fig. 4 A), 48h virus titer is up to 10
5.0tCID
50/ 100 μ l (Fig. 4 B).
7.HA-EDIII-HA immune animal is tested
With 4 week age sheldrake for experimental animal model, be divided into 5 groups, often organize 3, muscle, intravenous injection inoculate 200 μ lHA-EDIII-HA, HA-Renilla-HA, dosage 10
6tCID
50/ only, immunity twice, takes a blood sample weekly, the EDIII antibody horizontal of tracing detection sheldrake weekly; Then attack duck tembusu virus FX2010, to attack after poison 1,2,3,4d blood sampling, measure the viral level of attacking in latter four days of poison in sheldrake blood with fluorescence quantifying PCR method, analyze the immunoprotection situation of virus to sheldrake.
Result shows: exempt from one week HA-EDIII-HA group EDIII antibody two and rise fast, two exempt from two weeks HA-EDIII-HA group EDIII antibody declines to some extent, and HA-Renilla-HA (Renilla) vein group is difference extremely remarkable (P<0.001) compared with HA-EDIII-HA (ED III) vein group.The EDIII antibody that the immunity of EDIII vein group produces is higher than intramuscular immunisation group, and Renilla group is close with control group.Tembusu virus FX2010 virulent strain is attacked after exempting from second week two, attack the rear first day of poison, the viral nucleic acid copy number of Renilla group is close with control group, and Renilla muscle groups is significant difference (P<0.05) compared with EDIII muscle groups, and EDIII group is all lower; Attack poison latter second day, the viral nucleic acid copy number of EDIII group obviously declines, and Renilla vein group compares significant difference (P<0.05) with the muscle groups of EDIII; 3rd day and the 4th day, the duck serum inner virus nucleic acid copies of all groups declined, identical with the nucleic acid copies that negative serum records (Fig. 5,6).
Embodiment 3 expresses H9N2 hypotype SH441 strain HA influenza virus
1.HA gene packaging signal expresses the plasmid construction of 441-HA, 441-opti-HA
Take 441-HA-PBD as template, by XhoI-441HA-ORF-1F (sequence: ACTG
cTCGAGgCCACCATGGAGACAGTATC (SEQ ID NO.19)) and NheI-441-HA-ORF-R (sequence: TCAG
gCTAGCtTATATACAAATGTTGCATCTGCAAGACCC (SEQ ID NO.20)) be upstream and downstream primer amplification 441-HA-ORF sequence (SEQ ID NO.3), and carry out double digestion with XhoI, NheI and be connected on the PUC-HA-packaging signals carrier of same double digestion, transform PCR qualification, extract positive plasmid, with M13-47, RV-M order-checking, remove intracellular toxin extracting plasmid.
With the 441-opti-HA plasmid of synthesis for template, be upstream and downstream primer amplification 441-HA-ORF sequence with XhoI-opti-441HA-ORF-1F and NheI-opti-441-HA-ORF-R, be connected on the PUC-HA-packaging signals carrier of same double digestion with XhoI, NheI double digestion, transform, PCR identifies, extract positive plasmid pUC19-HA-441-opti-HA-HA, check order with M13-47, RV-M.After order-checking is correct, remove intracellular toxin extracting plasmid in a small amount, for subsequent use in-20 DEG C.
2. Revive virus
12-24h before transfection, is laid on 293T cell on 6 orifice plates, carries out transfection when the density of monolayer cell reaches more than 80%.Use transfection reagent Lipofectamine
tM2000, (except 4 helper plasmid pCAGGS-PB2, pCAGGS-PB1, pCAGGS-PA and pCAGGS-NP each transfection 1 μ g, all the other 9 plasmids pUC19-HA-441HA-HA/pUC19-HA-441-optiHA-HA, pBD-PR8PB1, pBD-PR8PB2, pBD-PR8PA, pBD-PR8NP, pBD-PR8NA, pBD-PR8NS, pBD-PR8M, pCAGGS-HA are transfection 0.3 μ g respectively; ) cotransfection 293T cell.The CO being put in 37 DEG C is continued after transfection
2cultivate 48h in incubator, the viral nomenclature saved out is HA-441HA-HA/HA-441-optiHA-HA.
3. the qualification of Revive virus
Through blood clotting measuring, rescue and obtain recombinant virus HA-441-HA-HA and be connected on chicken embryo, the hemagglutinative titer recorded is 2
7, and HA-441-optiHA – HA is without blood clotting.HA-441-HA-HA is by RT-PCR, and increase with primer 441-HA-ORF-1F and NheI-441-HA-ORF-1683R, result obtains special 441-HA-ORF fragment and is about 1700bp, and PCR primer sequencing result sequence is consistent with expection.
The above embodiment only have expressed embodiments of the present invention, and it describes comparatively concrete and detailed, but therefore can not be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Claims (8)
1. a recombinant influenza for expression alien gene, is characterized in that, this recombinant influenza is the recombinant virus inserting foreign gene in the HA gene packaging signal sequence of PR8 influenza virus.
2. recombinant influenza according to claim 1, is characterized in that, described foreign gene comprises: renilla luciferase gene, duck tembusu virus E protein the 3rd domain gene sequence or H9N2 hypotype SH441 strain HA gene.
3. a nucleic acid molecule, is characterized in that, comprises the HA gene order of PR8 influenza virus, in the packaging signal sequence of this HA gene, be inserted with exogenous gene sequence.
4. nucleic acid molecule according to claim 3, is characterized in that, described foreign gene comprises: renilla luciferase gene, duck tembusu virus E protein the 3rd domain gene sequence or H9N2 hypotype SH441 strain HA gene.
5. a recombinant vectors, is characterized in that, comprises nucleic acid molecule described in claim 3 or 4.
6. a preparation method for the recombinant influenza of expression alien gene, is characterized in that, comprises the following steps:
Build the recombinant vectors containing PR8 influenza virus HA gene, in the packaging signal sequence of described HA gene, be inserted with exogenous gene sequence;
By described recombinant vectors, with to transcribe plasmid and transient expression PB1, PB2, PA, NP transfection 293T cell together with the plasmid of HA of PR8 virus PB1, PB2, PA, NP, NA, M, NS gene respectively, rescue obtains the recombinant influenza of expression alien gene.
7. the application of recombinant influenza described in claim 1, is characterized in that, for the preparation of antiviral vaccine.
8. the application of recombinant influenza described in claim 1, is characterized in that, for screening antiviral.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410317186.3A CN104673759A (en) | 2014-07-04 | 2014-07-04 | Exogenous gene-expressed recombinant influenza virus as well as preparation method and application of recombinant influenza virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410317186.3A CN104673759A (en) | 2014-07-04 | 2014-07-04 | Exogenous gene-expressed recombinant influenza virus as well as preparation method and application of recombinant influenza virus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104673759A true CN104673759A (en) | 2015-06-03 |
Family
ID=53309353
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410317186.3A Pending CN104673759A (en) | 2014-07-04 | 2014-07-04 | Exogenous gene-expressed recombinant influenza virus as well as preparation method and application of recombinant influenza virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104673759A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184284A (en) * | 2019-05-22 | 2019-08-30 | 华南农业大学 | The recombinant fowl influenza virus for carrying NanoLuc gene and its application in living imaging mouse model |
| CN110305854A (en) * | 2019-07-18 | 2019-10-08 | 山东中医药大学 | A kind of recombination H3N2 subtype influenza virus, construction method and application carrying luciferase |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1546658A (en) * | 2003-12-02 | 2004-11-17 | 中国农业科学院哈尔滨兽医研究所 | Artificially recombinant H9N2 hypotype influenza virus and its uses |
| CN102864127A (en) * | 2011-09-08 | 2013-01-09 | 中国农业科学院上海兽医研究所 | Recombinant influenza virus for efficiently expressing HA (Hemagglutinin) protein and preparation method as well as application thereof |
-
2014
- 2014-07-04 CN CN201410317186.3A patent/CN104673759A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1546658A (en) * | 2003-12-02 | 2004-11-17 | 中国农业科学院哈尔滨兽医研究所 | Artificially recombinant H9N2 hypotype influenza virus and its uses |
| CN102864127A (en) * | 2011-09-08 | 2013-01-09 | 中国农业科学院上海兽医研究所 | Recombinant influenza virus for efficiently expressing HA (Hemagglutinin) protein and preparation method as well as application thereof |
Non-Patent Citations (3)
| Title |
|---|
| GLENN A. MARSH，ET AL.: "Specific Residues of the Influenza A Virus Hemagglutinin Viral RNA Are Important for Efficient Packaging into Budding Virions", 《 JOURNAL OF VIROLOGY》 * |
| JIANG W,ET AL: "Influenza A virus(A/chicken/Henan/F8/2010(H9N2))segment 4 hemagglutinin HA)", 《GENBANK 登录号JN803972.1 》 * |
| SVETLIN TCHATALBACHEV: "The packaging signal of influenza viral RNA molecules", 《RNA》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110184284A (en) * | 2019-05-22 | 2019-08-30 | 华南农业大学 | The recombinant fowl influenza virus for carrying NanoLuc gene and its application in living imaging mouse model |
| CN110184284B (en) * | 2019-05-22 | 2021-02-19 | 华南农业大学 | Recombinant avian influenza virus carrying NanoLuc gene and application thereof in vivo imaging mouse model |
| CN110305854A (en) * | 2019-07-18 | 2019-10-08 | 山东中医药大学 | A kind of recombination H3N2 subtype influenza virus, construction method and application carrying luciferase |
| CN110305854B (en) * | 2019-07-18 | 2023-09-15 | 山东中医药大学 | Recombinant H3N2 subtype influenza virus carrying luciferase, construction method and application |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Szczepanski et al. | Canine respiratory coronavirus, bovine coronavirus, and human coronavirus OC43: receptors and attachment factors | |
| Smyth | A review of the strain diversity and pathogenesis of chicken astrovirus | |
| Wen et al. | Development of a novel thermostable Newcastle disease virus vaccine vector for expression of a heterologous gene | |
| Wilson et al. | Experimental infection of calves by two genetically-distinct strains of Rift Valley fever virus | |
| Dey et al. | Newcastle disease virus vectored bivalent vaccine against virulent infectious bursal disease and Newcastle disease of chickens | |
| Yamamoto et al. | Avian influenza virus (H5N1) replication in feathers of domestic waterfowl | |
| Hassan et al. | Pathogenicity of the Canadian Delmarva (DMV/1639) infectious bronchitis virus (IBV) on female reproductive tract of chickens | |
| Soubies et al. | Propagation and titration of infectious bursal disease virus, including non-cell-culture-adapted strains, using ex vivo-stimulated chicken bursal cells | |
| Hu et al. | Engineered Newcastle disease virus expressing the F and G proteins of AMPV-C confers protection against challenges in turkeys | |
| Sun et al. | Airborne transmission of human-isolated avian H3N8 influenza virus between ferrets | |
| Zhugunissov et al. | Development of the inactivated QazCovid-in vaccine: protective efficacy of the vaccine in Syrian hamsters | |
| Zhang et al. | Evaluation of cross-protection between G1a-and G2a-genotype porcine epidemic diarrhea viruses in suckling piglets | |
| Rivera-Benitez et al. | Molecular detection and isolation of avian metapneumovirus in Mexico | |
| Tan et al. | A recombinant La Sota vaccine strain expressing multiple epitopes of infectious bronchitis virus (IBV) protects specific pathogen-free (SPF) chickens against IBV and NDV challenges | |
| CN104561092B (en) | Express construction method and the application of CSFV E 2 protein recombination PRRS viral genetic engineering vaccine | |
| Hassan et al. | Efficacy of commercial infectious bronchitis vaccines against Canadian Delmarva (DMV/1639) infectious bronchitis virus infection in layers | |
| Keep et al. | Limited cross-protection against infectious bronchitis provided by recombinant infectious bronchitis viruses expressing heterologous spike glycoproteins | |
| Isakova-Sivak et al. | Recombinant live attenuated influenza vaccine viruses carrying conserved T cell epitopes of human adenoviruses induce functional cytotoxic T cell responses and protect mice against both infections | |
| Saikia et al. | Recombinant Newcastle disease virus (NDV) expressing sigma C protein of avian reovirus (ARV) protects against both ARV and NDV in chickens | |
| Steitz et al. | Assessment of route of administration and dose escalation for an adenovirus-based influenza A Virus (H5N1) vaccine in chickens | |
| CN1828299B (en) | Nucleotide sequence, reagent kit and checking method for detecting fowl influenza virus | |
| do Nascimento et al. | An orf-virus (ORFV)-based vector expressing a consensus H1 hemagglutinin provides protection against diverse swine influenza viruses | |
| Fang et al. | Construction, characterization and application of recombinant porcine deltacoronavirus expressing nanoluciferase | |
| Yan et al. | Detection and characterization of a reassortant mammalian orthoreovirus isolated from bats in Xinjiang, China | |
| Zhang et al. | Generation and Evaluation of Recombinant Thermostable Newcastle Disease Virus Expressing the HA of H9N2 Avian Influenza Virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150603 |
|
| RJ01 | Rejection of invention patent application after publication |