CN104651494A - DNA fragment for controlling line number and kernel number of corncobs, molecular marker and applications - Google Patents
DNA fragment for controlling line number and kernel number of corncobs, molecular marker and applications Download PDFInfo
- Publication number
- CN104651494A CN104651494A CN201510021578.XA CN201510021578A CN104651494A CN 104651494 A CN104651494 A CN 104651494A CN 201510021578 A CN201510021578 A CN 201510021578A CN 104651494 A CN104651494 A CN 104651494A
- Authority
- CN
- China
- Prior art keywords
- krn4
- gene
- corn
- line number
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the field of corn gene engineering, and relates to a DNA fragment for controlling the line number and kernel number of corncobs, a molecular marker and applications. A main-effect QTL KRN4 gene for controlling the line number of corncobs is obtained, and the sequence of the main-effect QTL KRN4 gene is shown in SEQ ID NO: 1. Allelic genes of the main-effect QTL KRN4 gene are also obtained, and the sequences of the allelic genes are shown in SEQ ID NO: 2-5. A KRN4 locus is located at a fourth maize chromosome, and the locus is used for controlling the important yield traits such as line number and kernel number of maize ears. Relevant experiments prove that KRN4, through affecting the expression of downstream ZmSBP30 genes, affects the line number and kernel number, axis diameter and average truss production of corncobs, so that the line number and kernel number of corncobs can be obviously increased, thereby achieving the purpose of production increasing. The invention also develops related molecular marker primers which can be applied to the marker assisted selection of corns.
Description
Technical field
The invention belongs to corn gene field of engineering technology.Be specifically related to a kind of control mealie line number and grain number per spike DNA fragmentation, molecule marker and application.Described DNA fragmentation, clones and obtains, be positioned on corn the 4th karyomit(e) from a kind of pleiotropy QTL KRN4 of corn.This QTL controls the important yield traitses such as the thick and single fringe output of the tassel row number of corn ear, grain number per spike, axle.The invention discloses the separating clone of a control tassel row number QTL KRN4, functional verification and application, the invention still further relates to the molecular markers development based on this QTL and application.
Background technology
Grain security is the significant problem being related to national economy always.Corn (Zea may L.) is the most important grain in the world today, feed, industrial raw material and energy crop, and in guarantee world food safety, Economic development and alleviating energy crisis etc., effect is huge.Compared with nineteen ninety, China's corn ultimate production in 2010 adds 1.83 times, but total increase of producing depends on the increase of cultivated area, and per unit area yield improves the contribution about 35% ~ 40% increased total product.Because the rigidity of land supply restricts, for meeting the demand of Chinese national economy sustainable development to corn, improve the key subjects that corn yield per unit is genetic breeding subject.
The theory and practice of corn breeding proves, the output of self-mating system is hybrid with it the output closely related (Richey, 1946) of planting.From the thirties in last century to the nineties, the output of american corn cross-fertilize seed progressively improves, and rise to 9.1 tons/hectare of 1980S from 5.9 tons/hectare of 1930S with corn hybrid seed output, self-mating system output rises to 4.5 tons/hectare from 2.1 tons/hectare; During 1949 to 1996 years, China's corn yield increases by 8.88 times, and wherein, sown area increases by 1.25 times, and yield per unit improves 3.29 times.The Yield-increasing Factors of the raising at least 40% of corn yield is owing to breed improvement.Under different planting densities, cross-fertilize seed output and the trend of the parallel growth of self-mating system output are consistent (Duvick, 1999), and this illustrates that the improvement of self-mating system output is most important to raising cross-fertilize seed output.Under specific planting density, the output of unit surface is made up of corn single ear grain yield and spike number, and single tassel seed output is made up of tassel row number, row grain number and 100-grain weight.Visible, output is a very complicated proterties, and directly carrying out genetic analysis to yield traits is very complicated, a difficult research topic, and yield traits is resolved into each the factors of yield study respectively beyond doubt one select preferably.Tassel row number is an important the factors of yield, positive correlation (Liu Jilin remarkable in output, 2000), the Genetic Mechanisms verifying tassel row number formation contributes to the Genetic Mechanisms of illustrating Yield Traits In Corn formation, and the heredity that also can be Yield Traits In Corn provides theoretical direction and new genetic resources.
Summary of the invention
The object of the present invention is to provide a kind of pleiotropy QTLKRN4 gene controlling the thick and single fringe output of mealie line number, grain number per spike, axle, according to site 1.2-Kb PAV and S23 that in KRN4 site, two significantly associate with tassel row number, the economy molecule marker primer easily of design PCR-based, these labeled primers can be used for the genetic improvement of corn yield.Wherein the sequence of KRN4 near isogenic line H21 material is as shown in SEQ ID NO:1, and KRN4 is at H21
nX531sequence in (China typical culture collection center, CCTCC NO.P201504) is as shown in SEQ ID NO:2, and the sequence of S23 in H21 (from national farm crop preserving seed center) is as shown in SEQ ID NO:3, and S23 is at H21
nX531in sequence as shown in SEQ ID NO:4, the sequence of S23 in corn inbred line W138 (from national farm crop preserving seed center) is as shown in SEQ ID NO:5.KRN4 gene has the function improving the thick and single fringe output of mealie line number, grain number per spike, axle.
Another object of the present invention there are provided a kind of molecule marker primer based on KRN4 gene, for H21 and H21
nX531kRN4 sequence difference, design genetic marker primer, by molecular marker-assisted selection method, the differentiation of accurate quick can control the quality of the proterties allelotypes such as tassel row number, namely selects to have and H21
nX531the self-mating system of identical allelotype is used for the genetic improvement of corn as the allelic variation of excellence.
Last object of the present invention there are provided and a kind ofly controls the thick and single fringe yield QTL KRN4 gene of mealie line number, grain number per spike, axle and the application of molecule marker primer in increasing crop yield thereof, by increasing ear of crops line number, grain number per spike, axle are thick, do not reduce 100-grain weight, reach the object of volume increase.
Technical scheme of the present invention is as described below:
The present invention to be separated with map-based cloning by association analysis and to control mealie line number, row grain number, fringe with corn the 4th karyomit(e) 4.08bin slightly and the main effect QTL KRN4 of Ear weight, this unnamed gene is KRN4 gene or QTL KRN4 gene by we, and biometric authentication is carried out to this candidate gene KRN4, related molecular marker primer is developed to functional site 1.2-Kb PAV and S23 of KRN4 gene, for differentiating excellent KRN4 allelotype, carry out the genetic improvement of molecular marker assisted selection for corn simultaneously.
Applicant provide a kind of preparation method controlling the pleiotropy QTL of mealie line number and grain number per spike, its step is as described below:
Extract H21 (from national farm crop preserving seed center) and KRN4QTL near isogenic line H21
nX531(this material designation is Zea maize seed Zea mays L. corn inbred line H21-NX531 by we, China is delivered on January 6th, 2015. Wuhan. Wuhan University's China typical culture collection center preservation, preserving number is CCTCC NO:P201504) plant leaf STb gene, according to the gene scope of the 3Kb of the KRN4 obtained KRN4 Fine Mapping, utilize corn B73 to design the primer KRN4primer of primer extension KRN4 with reference to genome RefGen_v2, concrete sequence is as follows:
Left end primer: 5 ' AATGTAGCCCATAGTACACTCTATGA 3 '
Right-hand member primer: 5 ' AGTGGAGATAGAAAAGTTGCATTAGCCA 3 '
In addition, an insertion and deletion S23 of gene ZmSBP30 (GRMZM2G460544) promoter region of KRN4 regulation and control significantly associates with tassel row number, and the concrete sequence of this zmSBP30p3-3 labeled primer is as follows:
Left end primer: 5 ' TTGTAGACGCCAGGTACTTGCGCTTGT 3 '
Right-hand member primer: 5 ' GTCATGTATACCGTTTGGTTCTAGTG 3 '
Utilize KRN4primer labeled primer and zmSBP30p3-3 labeled primer pcr amplification maize leaf DNA H21 and H21
nX531, pcr amplification program: 94 DEG C of denaturation 5min, then with 94 DEG C of sex change 40s, 55 DEG C of annealing 40s, 72 DEG C extend 2min, carry out 35 circulations, and last 72 DEG C extend 5min.Amplification system is as table 1:
Table 1 corn H21 and H21
nX531leaf DNA amplification system
| Component | Volume (μ L) |
| 10×Buffer | 2 |
| MgCl 2 | 1.5 |
| dNTP(10mM) | 0.4 |
| Taq(5U/μL) | 0.2 |
| Left end primer (5 μMs) | 1 |
| Right-hand member primer (5 μMs) | 1 |
| DNA(10ng/μL) | 2 |
| ddH2O | 11.9 |
| Total | 20 |
Wherein KRN4primer primer can amplify the nucleotide sequence of 1.8Kb in H21, and at H21
nX531in can obtain the nucleotide sequence of 3Kb.ZmSBP30p3-3 labeled primer can obtain the nucleotide sequence of 500bp in H21, at H21
nX531in can obtain the nucleotide sequence of 1.2Kb, the nucleotide sequence of 800bp can be obtained in self-mating system W138.By increasing, the PCR primer obtained carries out agarose gel electrophoresis, object band is cut glue to reclaim, be connected to pGEM-T Easy carrier (purchased from Promega company, pGEM-T Easy carrier figure is shown in Fig. 6), screening positive clone is delivered to Invitrogen company and is checked order, and obtains the sequence shown in SEQ IDNO:1-SEQ ID NO:5.
Applicant provide one based on KRN4 at H21 and H21
nX531between the difference of nucleotide sequence carry out the method for design of PCR molecule marker, concrete steps are as follows:
According to KRN4 at H21 and H21
nX531between the difference of nucleotide sequence, for the insertion and deletion in 1.2-Kb PAV and S23 site, design specific primers amplify target fragment, described primer sequence is as follows:
M7 labeled primer for 1.2-Kb PAV:
Left end primer: 5 ' TTAATACTTGCGTCATCTCTATTCTACG 3 ',
Right-hand member primer: 5 ' ATCTCTAAGCACTCTTGCGCAAATCAAT 3 ',
For the primer in S23 site as above-mentioned disclosed zmSBP30p3-3 labeled primer.
The band of 700bp can be obtained, amplification H21 with M7 primer amplification H21 genomic dna
nX531genomic dna can obtain the band of 1.9Kb.With the band that can obtain 426bp in zmSBP30p3-3 primer amplification H21 genomic dna, at H21
nX531in can obtain the band of 1120bp.Band by amplified production electrophoresis (voltage of 5V/cm) 20min on the sepharose of 1%, then by after ethidium bromide staining 5min, can clearly separate by above-mentioned two kinds of bands under ultraviolet lamp, and distinguishes from H21 and H21
nX531different allelotypes.Show according to KRN4 at H21 and H21
nX531between nucleotide sequence difference design molecule marker there is convenient, reliable and practical feature.
The present invention controls the thick and single fringe yield QTL of mealie line number, grain number per spike, axle and can apply in increasing crop yield, and embody rule method is as described below:
Molecule marker primer M7 and zmSBP30p3-3 utilizing KRN4 to design is the allelic screening of excellent KRN4 for handing over from corn.Step is: with corn inbred line genomic dna for template, pcr amplification is carried out with molecule marker primer M7 and zmSBP30p3-3 of KRN4, to amplified production with 1% sepharose carry out electrophoresis (voltage be 5V/cm, electrophoresis time is 20min), then detect under ultraviolet lamp after ethidium bromide staining, wherein M7 labeled primer can amplify 1.9Kb fragment, zmSBP30p3-3 labeled primer can amplify 1120bp fragment, and the self-mating system material of screening gained carries KRN4 superior allelic.
By the corn inbred line carrying KRN4 superior allelic chosen, hybridize with the self-mating system allelic to be improved with KRN4 inferior position, by filial generation by and self-mating system to be improved backcross, and utilize molecule marker primer M7 and zmSBP30p3-3 to detect in each offspring, choose the material carrying superior allelic to carry out backcross progeny and material to be improved and backcross, by more than 4 generations that backcrossed the effect that self-mating system molecule marker assists improvement can be reached.
Compared with prior art, the present invention has the following advantages:
(1) the present invention clones and confirms a main effect QTL KRN4 gene controlling the thick and single fringe of tassel row number, grain number per spike, axle and produce in corn, confirms that the thick and single fringe of tassel row number in corn, grain number per spike, axle produces and is correlated with the different allelotypes of KRN4.
(2) the present invention is that corn yield improvement provides new natural variation site.
(3) the present invention is that corn with high yield breeding provides functional label primer, and molecule marker provided by the invention is efficient, convenient, economical.
Accompanying drawing explanation
Sequence table SEQ ID NO:1 is the partial nucleotide sequence of the KRN4 gene in H21.
Sequence table SEQ ID NO:2 is H21
nX531in the partial nucleotide sequence of KRN4 gene.
Sequence table SEQ ID NO:3 is the partial nucleotide sequence of the S23 gene in H21.
Sequence table SEQ ID NO:4 is H21
nX531in the partial nucleotide sequence of S23 gene.
Sequence table SEQ ID NO:5 is the partial nucleotide sequence of the S23 gene in W138.
Fig. 1: the Manhattan figure of the association analysis of mealie line number main effect QTL KRN4 and utilize linkage analysis to verify KRN4 site.
Description of reference numerals: in Fig. 1 A figure: x-axis is the physical location of corn tetrasome 4.08bin KRN4 site SNP, y-axis be utilize mixed linear model and with group structure control under calculate tassel row number association-log10 (P-value).The thermal map of below indicates the state of the linkage disequilibrium between 9 SNP being associated with.B figure in Fig. 1: utilize chain colony NX531 × YE107, TY6 × Mo17 and TY6 × W138 carries out chain checking to KRN4 site, multiple years result confirms, KRN4 site exists main effect tassel row number main effect QTL.
Fig. 2: the Fine Mapping of mealie line number main effect QTL.
Description of reference numerals: the A figure in Fig. 2 is the genotype of the pure and mild restructuring individual plant in KRN4 site and the phenotype of restructuring individual plant tassel row number Progeny test and significance level.KRN4 can be positioned within the scope of the 3Kb between M6-M8 according to pure and mild restructuring individual plant Progeny test result.What the B figure in Fig. 2 represented is that M6-M8 section is at Fine Mapping colony parent H21 and H21
nX531between the diversity of nucleotide sequence, relative to H21, H21
nX531between there is the insertion that two fragments amount to 1.2Kb.
Fig. 3: KRN4 site controls tassel row number by affecting the expression of ZmSBP30 gene.
Description of reference numerals: the A figure in Fig. 3 is at H21 and H21
nX531between, be positioned at the Differential expression analysis of two candidate genes at tassel row number developmental stage of KRN4 both sides.B figure in Fig. 3 utilizes pure and mild restructuring family to carry out Differential expression analysis to ZmSBP30 and GRM541.Namely and H21 C figure in Fig. 3 is random selecting 38 corn inbred lines, and the genotype according to KRN4 is divided into groups,
nX531the self-mating system (H group, N=12) that KRN4 is consistent and the self-mating system consistent with H21KRN4 (L group, N=26), carry out to its small ear at head progeny row developmental stage the detected result that ZmSBP30 gene expression amount carries out.D figure in Fig. 3 is the correlation analysis of ZmSBP30 gene expression amount and tassel row number in 38 self-mating systems.
*P<0.05；**P<0.01
Fig. 4: KRN4 and the association analysis result of ZmSBP30 constant gene segment C.
Description of reference numerals: the A figure in Fig. 4 is by sequence and the gene type assay of resurveying, in associate with tassel row number 4 sites that KRN4 and ZmSBP30 gene region detects, and the haplotype be made up of S23 with 1.2-Kb PAV associate situation.B figure in Fig. 4 is the tassel row number of six kinds of haplotypes forming in corn inbred line colony of S23 site and 1.2-Kb PAV and haplotype.
The gel figure of the different self-mating system of Fig. 5: KRN4 site Markers for Detection.
Description of reference numerals: the A figure in Fig. 5 is at H21 and H21 according to S23 site and KRN4
nX531between Nucleotide difference site exploitation molecule marker zmSBP30p3-3; B figure in Fig. 5 is at H21 and H21 according to S23 site and KRN4
nX531between Nucleotide difference site exploitation molecule marker primer M7; Utilize the agarose gel electrophoresis figure of Markers for Detection 24 parts of corn inbred lines.Wherein Marker is DL2000Marker, and indicated stripe size is followed successively by 2Kb, 1Kb, 750bp, 500bp, 250bp and 100bp from top to bottom.
Fig. 6: be the pGEM-T Easy carrier figure (display multiple clone site, carrier is purchased from Promega company) that the present invention applies.
Embodiment
Following embodiment defines the present invention further, describes the Fine Mapping of KRN4, clone, the method for the mechanism of action and molecular markers development and application.According to following description and example, those skilled in the art can determine essential characteristic of the present invention, and when not departing from spirit and scope of the invention, can make suitable improving and amendment, to make its applicable various uses and condition to the present invention.Technical scheme of the present invention, if not otherwise specified, is conventional molecular biological technology.
The Fine Mapping of embodiment 1:KRN4
513 parts that utilize the State Key Laboratory of Crop Genetic Improvent at applicant place the to build inbred line populations with extensive heritable variation, and the SNP marker information of full-length genome (48962 and 557893) and 2 years tassel row number phenotypes of 5, mixed linear model under adopting group structure to control, carries out whole-genome association to mealie line number.The 513 parts of association colonies that the present invention relates to and label information can see Li, Q 2012 in " PLoS ONE " (Public science Library) the 5th phase the 7th volume e36807 pages deliver " Genome-Wide Association Studies Identified Three Independent Polymorphisms Associated with α-Tocopherol Content in Maize Kernels " (whole-genome association detect three independently pleomorphism site significantly associate with the alpha-tocopherol of corn kernel) literary composition, and Li, the people such as H are published in " Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels " (utilizing whole-genome association to resolve the hereditary basis of corn kernel oil content content) literary composition of " Nature Genetic " (naturally heredity) the 1st phase 43 ~ 50 pages in 2013.In the site that tetrasome 4.08bin position detection significantly associates to tassel row number, as shown in the A figure in Fig. 1, we are by this site called after KRN4, and this site KRN4 is positioned at corn tetrasome 198.8Mb-200.1Mb.Select self-mating system NX531 (national farm crop preserving seed center) and the TY6 (national farm crop preserving seed center) of 2 high tassel row numbers, and the self-mating system YE107 of three low tassel row numbers (national farm crop preserving seed center), Mo17 (national farm crop preserving seed center) and W138 (national farm crop preserving seed center), set up three cover F
2chain colony: NX531 × YE107, TY6 × Mo17 and TY6 × W138, be chosen at respectively and have the mark zmSBP30p3-3 of polymorphism to carry out gene type assay, to F to the three chain colonies of cover in KRN4 interval
2:3family is carried out tassel row number phenotype and is carried out the mensuration of phenotype Baoding, Wuhan, Hubei in 2012 and Xingtai in 2012 in 2011 respectively, pass through One marker analysis, three colonies all detect main effect QTL at KRN4, additive effect reaches as high as 1.01, as shown in the B figure in Fig. 1, show that this site is tassel row number main effect QTL.
The KRN4 site detected according to association analysis and the genotype of this site SNP select to have that tassel row number is high and to have the allelic corn inbred line NX531 of KRN4 synergy be donor parents, tassel row number low and have KRN4 subtract effect allelic self-mating system H21 be receptor parent, by backcross four generations build KRN4 site near isogenic line H21
nX531.Utilize H21
nX531and the segregating population more than 10000 strains that H21 builds screens 31 the restructuring individual plants obtained in KRN4 site, wherein 13 representational restructuring individual plants have developed pure and mild restructuring family and have developed the segregating population of pure and mild restructuring family and pure and mild non-recombinant family for each restructuring individual plant, and at Sanya, Hainan in 2013, the phenotypic evaluation of 3 has been carried out in Wuhan, Hubei in 2014 and Baoding in 2014, and develop new molecule marker primer for target section, KRN4 Fine Mapping is in the section of a 3KB of ZmSBP30 downstream ~ 60Kb the most at last, as shown in the A figure in Fig. 2.At H21 and H21
nX531between, there is the insertion and deletion (1.2-Kb PAV) that two fragments are total to 1.2Kb in KRN4 site, as shown in the B figure in Fig. 2.
Embodiment 2:KRN4 affects mealie line number by the expression of regulation and control ZmSBP30 gene
By meticulous intergenic region section KRN4 being narrowed down to 3Kb, be positioned between GRM541 (GRMZM2G001541) and ZmSBP30 (GRMZM2G460544) gene.To H21 and H21
nX531the small ear of female fringe head progeny row developmental stage, be respectively inflorescence meristem and paired little floral meristem developmental stage (Ear S1) and little floral meristem developmental stage (Ear S1) to sample, and adopt TRIZOL reagent (purchased from Invitrogen company) to extract total serum IgE, reverse transcription synthesis cDNA.Take cDNA as template, carry out relative expression's flow measurement to by GRM541 and ZmSBP30, result display is relative to H21
nX531, in H21 children fringe, ZmSBP30 expression amount significantly improves 3 times, and does not show considerable change to GRM541 expression amount, as shown in the A figure in Fig. 2.Show that KRN4 does not does not regulate and control the expression of GRM541, but affect the expression of ZmSBP30.For verifying that KRN4 regulates and controls ZmSBP30 further, choose restructuring family RL4, RL5, RL6, RL7, RL8 and RL12 and H21 and H21
nX531the expression analysis of young fringe, result shows, when restructuring family carries KRN4
h21time, ZmSBP30 expression amount significantly raises relative to the material carrying KRN4NX531, and tassel row number reduces, and the not consistence change of the expression amount of GRM541 gene, as shown in the B figure in Fig. 3, confirm that KRN4 has regulated and controled the expression of ZmSBP30 as effect original paper of taking advantage of a situation.And the expression amount of ZmSBP30 and tassel row number are negative correlation.For confirming the impact that the different allelotype in KRN4 site is expressed ZmSBP30 further, random selecting 38 inbreds, can be divided into containing KRN4 according to KRN4 loci gene type
h21(L) self-mating system and containing KRN4
nX531(H) self-mating system, measure 38 self-mating system Ear S1 ZmSBP30 in period relative expression quantities, result shows KRN4
h21the expression amount of the ZmSBP30 of the self-mating system of (L, N=26) is significantly higher than KRN4
nX531the self-mating system of (H, N=12), as the C figure in Fig. 3, and the expression amount of ZmSBP30 and tassel row number are remarkable negative correlation, as shown in the D figure in Fig. 3.
Therefore confirm according to expression analysis, KRN4 affects the expression of ZmSBP30 gene, and according to Chuck, in GS etc. are published in " Proc Natl Acad Sci USA " (institute of NAS periodical) " Maize SBP-box transcription factors unbranched2and unbranched3affect yield traits by regulating the rate of lateral primordia initiation " (the SBP-box transcription factor unbranched2 of corn and unbranched3 is by initial effects yield traits of regulation and control side direction former base) in 2014, the tassel row number of the corn of ZmSBP30 negative regulation.Therefore confirm that KRN4 is the important natural variation site affecting mealie line number, its regulation and control model is the expression amount by regulation and control downstream gene ZmSBP30, and then the head progeny row affecting corn is grown.
Embodiment 3:S23 site significantly associates with tassel row number with the haplotype of 1.2-Kb PAV Sites Combination, and instruction can be used for distinguishing the excellent haplotype in KRN4 site and inferior position haplotype
For detect further KRN4 site and ZmSBP30 section may with the natural variation site of mealie line number significant correlation, we design primer amplification KRN4 section and ZmSBP30 site, carry out PCR to the association analysis colony described in " embodiment 1 " to resurvey sequence, according to the sequence of obtained different self-mating system, carry out the extracting of SNP and InDel, and utilize mixed linear model to carry out association analysis, result display has 4 sites and significantly associates with tassel row number, the 1.2-Kb PAV in the full section of KRN4 respectively, the insertion and deletion S23 of ZmSBP30 gene promoter area, SNP S35 and ZmSBP303 ' of ZmSBP30 the 3rd exon holds the SNP S45 of non-translational region, as shown in the A figure in Fig. 4.And S35 and S45 height linkage disequilibrium, therefore can replace S45 with more significant S35.Choose 1.2-Kb PAV, S23, S35 and carry out haplotype analysis, result shows: the haplotype that S23 with 1.2-Kb PAV (S23-1.2-Kb PAV) forms significantly associates (P-value=2.37E with tassel row number
-13, N=441), and significance is far above S23-S35 (P-value=2.28E
-08, N=430), S35-1.2-Kb PAV (P-value=2.41E
-09, N=430) and S23-S35-1.2-Kb PAV (P-value=8.64E
-11, N=410).And S23-1.2-Kb PAV and S23-S35, S35-1.2-Kb PAV, S23-S35-1.2-Kb PAV, S35 present the linkage disequilibrium (R of height
2>0.74), as shown in the A figure in Fig. 4.Therefore, S23-1.2-Kb PAV in inbred line population widely, fully can represent KRN4 high row haplotype (i.e. superior allelic) and low row haplotype (i.e. inferior position allelotrope).To with corn inbred line colony, utilize S23-1.2-Kb PAV to combine, six kinds of haplotypes (Hap1-Hap6) can be detected, wherein only have the self-mating system comprising Hap1 to present higher tassel row number (P=6.4E
-18, Student ' s t-test), therefore Hap1 is the excellent haplotype in KRN4 site, i.e. H21
nX531or the haplotype entrained by NX531, as shown in the B figure in Fig. 4.
Embodiment 4: by molecular marker assisted selection KRN4 superior allelic, carries out the genetic improvement of corn inbred line tassel row number
Visible according to the result of above-described embodiment 3, the 1.2-KB PAV in KRN4 site and the S23 site of ZmSBP30 promoter region are the site with tassel row number significant correlation.Therefore the present invention develops molecule marker M7 and zmSBP30p3-3 to these two pleomorphism sites, by random selecting 24 self-mating system materials, utilize M7 and zmSBP30p3-3 carry out pcr amplification go forward side by side row agarose gel electrophoresis detect, the allelotrope of 24 self-mating system KRN4 well can be divided, if the A figure in Fig. 5 is that zmSBP30p3-3 marks gel electrophoresis figure, the B figure in Fig. 5 is M7 gel electrophoresis figure.Wherein corn inbred line NX531-TY7 carries as KRN4 superior allelic, and as shown in Figure 5, M7 mark stripe size is 1.9Kb, zmSBP30p3-3 stripe size is 1.1Kb to its mark stripe size.24 self-mating systems that this example is chosen are as shown in table 1.
Choose the low self-mating system H21 of tassel row number as improvement object, choose that tassel row number is high and the self-mating system NX531 carrying excellent KRN4 is donor material.Backcrossed by continuous after H21 × NX531 and H21, and each generation M7 and zmSBP30p3-3 identifies, chooses and carries KRN4
nX531backcross progeny to continue and H21 backcrosses, continuous backcross four generation, and selfing is to BC
4f
2, in segregating population, compare and carry pure and mild KRN4
nX531individual plant and pure and mild KRN4
h21the yield traits phenotype of individual plant, obtains the result as shown in table 2 and table 3.
The tassel row number of the stripe size that table 2 molecule marker M7 and zmSBP30p3-3 detects and corresponding self-mating system
Above-mentioned self-mating system material is the self-mating system of open release, can obtain from national farm crop preserving seed center (Beijing).
Table 3 is by the allelic hereditary effect of the excellent KRN4 of molecule marker Backcross introgression
Result show, import excellent KRN4 allelotrope can significantly improve H21 tassel row number, fringe is thick, axle is thick, grain number per spike, single fringe output.And 100-grain weight is not affected while increase tassel row number.Therefore by importing excellent KRN4 allelotrope, there is the effect improving corn yield, such as, by tassel row number is improved 2 row, can increase by single fringe output of 25.7%.
Leading reference
Li Q,Yang X,Xu S,Cai Y,Zhang D,Han Y,Li L,Zhang Z,Gao S,Li J,Yan J.Genome-Wide Association Studies Identified Three Independent Polymorphisms Associated withα-Tocopherol Content in Maize Kernels.PLoS ONE,2012,7(5):e36807.
Li H,Peng Z,Yang X,Wang W,Fu J,Wang J,Han Y,Chai Y,Guo T,Yang N,Liu J,Warburton ML,Cheng Y,Hao X,Zhang P,Zhao J,Liu Y,Wang G,Li J,Yan J.Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels.Nat Genetics,2013,45(1):43-50.
Chuck GS,Brown PJ,Meeley R,Hake S.Maize SBP-box transcription factors unbranched2 and unbranched3 affect yield traits by regulating the rate of lateral primordia initiation.Proc Natl Acad Sci USA,2014,111(52):18775-18780。
Claims (8)
1. one controls the main effect QTL KRN4 gene of mealie line number, and its nucleotide sequence is as shown in SEQ ID NO:1.
2. the allelotrope of the main effect QTL KRN4 gene of a control mealie line number as claimed in claim 1, their nucleotide sequence is respectively as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5.
3. main effect QTL KRN4 gene according to claim 1 controlling mealie line number, grain number per spike, fringe is thick, axle is thick and application in single fringe output.
4. the allelotrope of main effect QTL KRN4 gene as claimed in claim 2 controlling mealie line number, grain number per spike, fringe is thick, axle is thick and application in single fringe output.
5. be separated the molecule marker combination of primers M7 from corn, its DNA sequence dna is as follows:
Left end primer: TTAATACTTGCGTCATCTCTATTCTACG,
Right-hand member primer: ATCTCTAAGCACTCTTGCGCAAATCAAT.
6. be separated the molecule marker combination of primers zmSBP30p3-3 from corn, its DNA sequence dna is as follows:
Left end primer: TTGTAGACGCCAGGTACTTGCGCTTGT,
Right-hand member primer: GTCATGTATACCGTTTGGTTCTAGTG.
7. the application of molecule marker combination of primers M7 in corn marker assisted selection as claimed in claim 5.
8. the application of molecule marker combination of primers zmSBP30p3-3 in corn marker assisted selection as claimed in claim 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510021578.XA CN104651494B (en) | 2015-01-15 | 2015-01-15 | Control corncob line number and the DNA fragmentation of grain number per spike, molecular marker and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510021578.XA CN104651494B (en) | 2015-01-15 | 2015-01-15 | Control corncob line number and the DNA fragmentation of grain number per spike, molecular marker and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104651494A true CN104651494A (en) | 2015-05-27 |
| CN104651494B CN104651494B (en) | 2016-08-24 |
Family
ID=53243133
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510021578.XA Expired - Fee Related CN104651494B (en) | 2015-01-15 | 2015-01-15 | Control corncob line number and the DNA fragmentation of grain number per spike, molecular marker and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104651494B (en) |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063201A (en) * | 2015-08-06 | 2015-11-18 | 中国农业大学 | Molecular marker of corn chromosome 9 ear row number major QTL and application thereof |
| CN106636083A (en) * | 2016-12-28 | 2017-05-10 | 六盘水师范学院 | Maize single panicle weight main effect QTL, as well as acquisition method and application thereof |
| CN106906301A (en) * | 2017-04-26 | 2017-06-30 | 江苏省农业科学院 | Molecular labeling and its application with corn row grain number main effect QTL compact linkage |
| CN107058542A (en) * | 2017-04-26 | 2017-08-18 | 江苏省农业科学院 | The method and its application of many head progeny row corns of the main effect QTL molecular labeling of corn rice chromosome tassel row number, assisted Selection |
| CN108203737A (en) * | 2018-04-10 | 2018-06-26 | 四川农业大学 | The SNP marker of corn tassel row number related gene GRMZM2G098557 and application |
| CN109735549A (en) * | 2019-01-15 | 2019-05-10 | 华中农业大学 | Application of the corn gene in control corn tassel row number |
| CN109825639A (en) * | 2019-04-24 | 2019-05-31 | 鲁东大学 | Molecular labeling and its application with wheat grains per spike main effect QTL compact linkage |
| CN110577964A (en) * | 2019-08-28 | 2019-12-17 | 华南农业大学 | Application of UB2/UB3 gene in regulation and control of multiple-ear development of corn |
| CN110628937A (en) * | 2019-10-28 | 2019-12-31 | 华中农业大学 | Application of corn gene KRN5 in improving corn yield |
| CN112646913A (en) * | 2020-12-25 | 2021-04-13 | 华中农业大学 | A pair of molecular marker primers closely linked with corncob coarse QTL ZmED3 and application thereof |
| CN115786563A (en) * | 2022-08-19 | 2023-03-14 | 华中农业大学 | Molecular marker closely linked with high-temperature response character of corn, and amplification primer and application thereof |
-
2015
- 2015-01-15 CN CN201510021578.XA patent/CN104651494B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| BOMMERT P: "Quantitative variation in maize kernel row number is controlled by FASCIATED EAR2 locus", 《NAT GENET》 * |
| LI H: "Genome-wide association study dissects the genetic architecture of oil biosynthesis in maize kernels", 《NAT GENET》 * |
| LIU L: "ZmSBP30 is closely associated with the number of rows of kernels and strongly selected during domestication and improvement of Zea mays", 《MAIZE GENETICS CONFERENCE ABSTRACTS》 * |
| 焦付超: "特异玉米种质四路糯的穗行数遗传解析", 《中国农业科学》 * |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105063201B (en) * | 2015-08-06 | 2018-02-23 | 中国农业大学 | The molecular labeling of corn Chromosome 9 tassel row number main effect QTL and its application |
| CN105063201A (en) * | 2015-08-06 | 2015-11-18 | 中国农业大学 | Molecular marker of corn chromosome 9 ear row number major QTL and application thereof |
| CN106636083B (en) * | 2016-12-28 | 2020-01-21 | 六盘水师范学院 | Corn single-plant spike weight major QTL, and obtaining method and application thereof |
| CN106636083A (en) * | 2016-12-28 | 2017-05-10 | 六盘水师范学院 | Maize single panicle weight main effect QTL, as well as acquisition method and application thereof |
| CN106906301A (en) * | 2017-04-26 | 2017-06-30 | 江苏省农业科学院 | Molecular labeling and its application with corn row grain number main effect QTL compact linkage |
| CN107058542A (en) * | 2017-04-26 | 2017-08-18 | 江苏省农业科学院 | The method and its application of many head progeny row corns of the main effect QTL molecular labeling of corn rice chromosome tassel row number, assisted Selection |
| CN108203737A (en) * | 2018-04-10 | 2018-06-26 | 四川农业大学 | The SNP marker of corn tassel row number related gene GRMZM2G098557 and application |
| CN108203737B (en) * | 2018-04-10 | 2021-02-26 | 四川农业大学 | SNP molecular marker of corn ear row number related gene GRMZM2G098557 and application |
| CN109735549A (en) * | 2019-01-15 | 2019-05-10 | 华中农业大学 | Application of the corn gene in control corn tassel row number |
| CN109825639A (en) * | 2019-04-24 | 2019-05-31 | 鲁东大学 | Molecular labeling and its application with wheat grains per spike main effect QTL compact linkage |
| CN110577964A (en) * | 2019-08-28 | 2019-12-17 | 华南农业大学 | Application of UB2/UB3 gene in regulation and control of multiple-ear development of corn |
| CN110628937A (en) * | 2019-10-28 | 2019-12-31 | 华中农业大学 | Application of corn gene KRN5 in improving corn yield |
| CN112646913A (en) * | 2020-12-25 | 2021-04-13 | 华中农业大学 | A pair of molecular marker primers closely linked with corncob coarse QTL ZmED3 and application thereof |
| CN115786563A (en) * | 2022-08-19 | 2023-03-14 | 华中农业大学 | Molecular marker closely linked with high-temperature response character of corn, and amplification primer and application thereof |
| CN115786563B (en) * | 2022-08-19 | 2024-05-07 | 华中农业大学 | Molecular marker closely linked with corn high-temperature response character, amplification primer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104651494B (en) | 2016-08-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104651494B (en) | Control corncob line number and the DNA fragmentation of grain number per spike, molecular marker and application | |
| Li et al. | A Brassica rapa linkage map of EST-based SNP markers for identification of candidate genes controlling flowering time and leaf morphological traits | |
| CN112351679B (en) | Methods for identifying, selecting and producing southern corn rust resistant crops | |
| Chai et al. | Validation of DGAT1-2 polymorphisms associated with oil content and development of functional markers for molecular breeding of high-oil maize | |
| Sun et al. | The contribution of intersubspecific hybridization to the breeding of super-high-yielding japonica rice in northeast China | |
| US11032986B2 (en) | Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof | |
| Bisht et al. | Fine mapping of loci involved with glucosinolate biosynthesis in oilseed mustard (Brassica juncea) using genomic information from allied species | |
| Jakobson et al. | Fine mapping, phenotypic characterization and validation of non-race-specific resistance to powdery mildew in a wheat–Triticum militinae introgression line | |
| CN108486276A (en) | Capsicum maturity SNP marker and its application | |
| CN104152450B (en) | The InDel molecular labelings isolated with cucumber powdery mildew resistance main effect gene | |
| CN103898228B (en) | A kind of molecule marker identifying tobacco PVY resistance | |
| Laosatit et al. | A class II KNOX gene, KNAT7-1, regulates physical seed dormancy in mungbean [Vigna radiata (L.) Wilczek] | |
| Zhou et al. | Identification of novel alleles of the rice blast-resistance gene Pi9 through sequence-based allele mining | |
| CN106222262B (en) | Primer pair and its identify rice nitrogen efficiently utilize the application in gene NRT1.1B genotype | |
| CN101487056B (en) | Method for assistantly screening anti-stripe rust wheat, and special primer therefor | |
| Cheng-Lai et al. | Analysis of genetic structure and relationships of maize inbred lines in China | |
| Ibrahim et al. | Comparison of QTLs for drought tolerance traits between two advanced backcross populations of spring wheat. | |
| Nishiyama et al. | Comparative mapping of the ASTRINGENCY locus controlling fruit astringency in hexaploid persimmon (Diospyros kaki Thunb.) with the diploid D. lotus reference genome | |
| CN104878018B (en) | Pleiotropic gene and its application of a kind of control corn row grain number and grain number per spike | |
| CN110468229A (en) | Rice wide spectrum high resistance to hoja blanca gene Xa45's (t) isolates molecular labeling Hxjy-1 | |
| CN110358861A (en) | R13I14 is marked with rice wide spectrum high resistance to hoja blanca gene Xa45 (t) compact linkage molecule | |
| Kubo et al. | Classification of “nabana”(Brassica rapa) cultivars and landraces based on simple sequence repeat markers | |
| CN104762298A (en) | Rice seedling-stage salt-tolerant gene qST11 and molecular marker method thereof | |
| CN103834647A (en) | SSR marker Xgwm537 in close linkage with wheat dwarf gene RhtDC20 and application thereof | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160824 Termination date: 20170115 |