CN104651358B - Separated tissue-specific promoter and its application from corn - Google Patents

Abstract

The invention discloses separated tissue-specific promoter and its application from corn, belong to separation and the application field of plant tissue specificity promoter.The present invention is separated from corn obtains the tissue-specific promoter that nucleotides sequence is classified as SEQ ID NO.1, and the present invention is further truncated acquisition SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, still has the function of the sequence of tissue-specific promoter shown in SEQ ID NO.5 and SEQ ID NO.6.The invention also discloses recombinant plant expression vectors and recombinant host cell containing the tissue-specific promoter.The present invention further discloses the tissue-specific promoters to improve crop seed quality, Crop Improvement character and the application for cultivating genetically modified plants new varieties etc..

Description

Separated tissue-specific promoter and its application from corn

Technical field

Invention is related to a kind of promoter separated from plant more particularly to the separated tissue from corn (Zea mays) Specificity promoter, the invention further relates to the recombinant plant expression vector containing the tissue-specific promoter and host are thin Born of the same parents, the invention further relates to them to improve crop seed quality, Crop Improvement character, cultivate new variety of plant etc. Using belonging to separation and its application field of plant tissue specificity promoter.

Background technology

Promoter is the DNA sequence dna of RNA polymerase specific recognition and combination, is important cis-acting elements, generally Upstream is held positioned at structural gene 5 '.Higher plant gene regulation and control are mainly carried out in transcriptional level, and promoter controls gene table The initial time and expression degree reached, while decisive role is also played to used RNA polymerase type, so promoter It is the key that understand gene expression pattern and transcription regulation mechanism, is the center of plant gene transcription regulation and control.

According to the transcriptional profile and function of promoter, three classes can be classified as：Constitutive promoter, tissue or organ are special Property promoter and inducible promoter.At present, what is used in plant genetic engineering is most of for constitutive promoter, makes external source Target gene is in each tissue site high level expression of plant, but constitutive promoter also has shortcomings, for example, cannot from when Between and spatially effectively regulate and control target gene expression, consume excessively intracellular matter and energy (Gittins JR, Pellny TK,Hiles ER,Rosa C,Biricolti S,et al.(2000)Transgene expression driven by heterologous ribulose-1,5-bisphosphate carboxylase/oxygenase small-subunit gene promoters in the vegetative tissues of apple(Malus pumila mill.).Planta 210:232-240.)；A large amount of heterologous proteins or metabolite are broken the metabolic balance of plant, are unfavorable in plant interior accumulation Plant growth (Robinson DJ (1996) Environmental risk assessment of releases of transgenic plants containing virus-derived inserts.Transgenic research 5:359- 362.)；Easily cause gene silencing or co-suppression phenomenon (Kumpatla SP, Chandrasekharan MB, Iyer LM, Guofu L,Hall TC(1998)Genome intruder scanning and modulation systems and transgene silencing.Trends in Plant Science 3:97-104；Mette MF,Aufsatz W,van der Winden J,Matzke MA,Matzke AJ(2000)Transcriptional silencing and promoter methylation triggered by double-stranded RNA.EMBO J 19:5194-5201.).Therefore, science Family constantly look for more efficiently tissue or organ specific promoters replace constitutive promoter, to more accurate tune Control the expression of foreign gene.

Gene transcription process under tissue or organ specific promoters regulation and control generally only occurs in some specific tissues Or in organ.Tissue or Organ specific expression promoter more economically can effectively regulate and control the expression of foreign gene, special Strange land plays a role at the position of specific needs, so can not only improve the gene expression abundance of foreign gene, but also by biological energy source Consumption is preferably minimized, so as to not influence the normal growth of plant.

Corn (Zea mays) is the cereal crops of Largest In China and important genetically modified crops.Corn tissue is special Property promoter can be divided into the tissues such as root, stem, leaf, flower, embryo, endosperm, fruit, xylem, chlorenchyma or organ specificity and start Son, the tissue-specific promoter of each type all have some special function element.Separation obtains tissue spy from corn Specific Promoters can drive target gene to carry out the efficient of specificity in plant tissue using the tissue-specific promoter Expression, this, which carries out corn the new corn variety of molecular improvement or production with specific use etc., important meaning.

The content of the invention

One of the object of the invention is to provide the separated tissue-specific promoter from corn (Zea mays).

The two of the object of the invention are to provide the recombinant expression carrier containing above-mentioned tissue-specific promoter and contain this The host cell of recombinant expression carrier.

The three of the object of the invention are by the tissue-specific promoter and containing the tissue-specific promoter It is new that recombinant expression carrier is applied to structure genetically modified plants, improvement crop seeds character, plant of the cultivation with merit Kind etc..

To achieve the above object, present invention firstly provides one kind from corn (Zea mays) separated tissue specificity Promoter, polynucleotide sequence is shown in (a), (b), (c) or (d):

(a), the polynucleotide sequence shown in SEQ ID NO.1；Or

(b), the polynucleotides that can be hybridized in stringent hybridisation conditions with the complementary series of SEQ ID NO.1, this is more Nucleotide still has the function of tissue-specific promoter or activity；Or

(c), with the polynucleotide sequence of the polynucleotide sequence of SEQ ID NO.1 at least more than 60% homology, and The polynucleotides have the function of tissue-specific promoter or activity；Preferably, with the polynucleotide sequence of SEQ ID NO.1 At least polynucleotide sequence of more than 80% homology, and the polynucleotides have the function of tissue-specific promoter or work Property；It is furthermore preferred that the polynucleotide sequence with polynucleotide sequence at least more than 90% homology of SEQ ID NO.1, and The polynucleotides have the function of tissue-specific promoter or activity；Most preferably, with the polynucleotides sequence of SEQ ID NO.1 Arrange at least more than 90% homology polynucleotide sequence, and the polynucleotides have the function of tissue-specific promoter or Activity；Or

(d), carried out on the basis of SEQ ID NO.1 one or more bases missing, substitution or insertion obtain it is more Nucleotide variants, which includes sequence shown in SEQ ID NO.2, and the polynucleotides variant still has tissue spy The function or activity of Specific Promoters.

Polynucleotide sequence shown in SEQ ID NO.1 is gradually deleted the SEQ of partial sequence acquisition by the present invention from 5 ' ends The promoter deletion segment of 181bp shown in ID NO.2 (for the segment between-181 -+1).

The present invention by the polynucleotides shown in SEQ ID NO.1 or SEQ ID NO.2 and the operable connection of gus gene, Structure obtains recombinant plant expression vector respectively；Using corn as acceptor material, using the Transient Expression System pair of via Particle Bombardment Transformation Promoter carries out functional verification, and result of the test shows the gus gene of SEQ ID NO.1 or SEQ ID NO.2 drivings only in corn Carried out in the embryo of seed it is specific expressed, do not have in other tissue sites such as corn seed endosperm, root, stem, leaf GUS expression live Property；Result of the test confirmation, the nucleotides sequence shown in present invention SEQ ID NO.1 or SEQ ID NO.2 separated from corn It is classified as tissue-specific promoter.

Overall length promoter shown in SEQ ID NO.1 further since holding 5 ' is gradually deleted and obtains four sections by the present invention Short promoter fragment P_85502-4(SEQ ID NO.3)、P_85502-0(SEQ ID NO.4)、P_85502-2(SEQ ID NO.5)、 P_85502-6(SEQ ID NO.6)；Four sequences after truncation are connected respectively on the expression vector with reporter gene and are built Obtain stable expressed vector p85502-4G3, p85502-0G3, p85502-2G3 and p85502-6G3；By stable expressed vector P85502-0G3 and stable expressed vector p85502-2G3 has converted corn material respectively using agriculture bacillus mediated method, will be steady Determine expression vector p85502-4G3 and stable expressed vector p85502-6G3 has converted plan respectively according to agriculture bacillus mediated method Southern mustard has obtained the transfer-gen plant of stable conversion；Functional verification the result shows that, promoter deletion segment P_85502-0Still have Start the function of reporter gene expression, promoter deletion segment P in embryo tissue_85502-0Be promoter activity reduce just Embryo tissue-specific promoter under normal physiological condition, but under mechanical damage induction induced expression is shown in leaf sheath tissue Characteristic.From transgenic arabidopsis coloration result is respectively organized to can be seen that shorter P₈₅₅₀₂Deletion fragment still has promoter activity, Simply P_85502-4With P_85502-6Comparatively speaking the characteristic of induced expression is still maintained.

The result of Reporter gene GUS expression is driven to can be seen that this four promoters in transgenic corns/arabidopsis to lack Losing segment still has the activity of promoter, but it starts intensity and some changes occur for tissue specificity.Therefore, the present invention carries A kind of deletion fragment of the tissue specific promoter shown in SEQ ID NO.2 is supplied, polynucleotide sequence is (a), (b), (c) Or shown in (d):

(a), the polynucleotide sequence shown in SEQ ID NO.2；Or

(b), the polynucleotides that can be hybridized in stringent hybridisation conditions with the complementary series of SEQ ID NO.2, this is more Nucleotide still has the function of promoter or activity；Or

(c), with the polynucleotide sequence of the polynucleotide sequence of SEQ ID NO.2 at least more than 60% homology, and The polynucleotides have the function of promoter or activity；Preferably, with the polynucleotide sequence of SEQ ID NO.2 at least 80% The polynucleotide sequence of more than homology, and the polynucleotides have the function of promoter or activity；It is furthermore preferred that with SEQ ID The polynucleotide sequence of the polynucleotide sequence of NO.2 at least more than 90% homology, and the polynucleotides have promoter Function or activity；Most preferably, with the polynucleotides of the polynucleotide sequence of SEQ ID NO.2 at least more than 95% homology Sequence, and the polynucleotides have the function of promoter or activity；Or

(d), carried out on the basis of SEQ ID NO.2 one or more bases missing, substitution or insertion obtain it is more Nucleotide variants, the polynucleotides variant contain the 6bp bases of 47-53 in SEQ ID NO.2, and the polynucleotides variant Still there is promoter or activity.

The present invention provides the promoter deletion segment shown in SEQ ID NO.3, polynucleotide sequence is (a), (b), (c) or shown in (d):

(a), the polynucleotide sequence shown in SEQ ID NO.3；Or

(b), the polynucleotides that can be hybridized in stringent hybridisation conditions with the complementary series of SEQ ID NO.3, this is more Nucleotide still has the function of promoter or activity；Or

(c), with the polynucleotide sequence of the polynucleotide sequence of SEQ ID NO.3 at least more than 60% homology, and The polynucleotides have the function of promoter or activity；Preferably, with the polynucleotide sequence of SEQ ID NO.3 at least 80% The polynucleotide sequence of more than homology, and the polynucleotides have the function of promoter or activity；It is furthermore preferred that with SEQ ID The polynucleotide sequence of the polynucleotide sequence of NO.3 at least more than 90% homology, and the polynucleotides have promoter Function or activity；Most preferably, with the polynucleotides of the polynucleotide sequence of SEQ ID NO.3 at least more than 95% homology Sequence, and the polynucleotides have the function of promoter or activity；Or

(d), carried out on the basis of SEQ ID NO.3 one or more bases missing, substitution or insertion obtain it is more Nucleotide variants, and the polynucleotides variant still has the function of promoter or activity.

The present invention also provides the promoter deletion segment shown in SEQ ID NO.4, polynucleotide sequence is (a), (b), shown in (c) or (d):

(a), the polynucleotide sequence shown in SEQ ID NO.4；Or

(b), the polynucleotides that can be hybridized in stringent hybridisation conditions with the complementary series of SEQ ID NO.4, this is more Nucleotide still has the function of promoter or activity；Or

(c), with the polynucleotide sequence of the polynucleotide sequence of SEQ ID NO.4 at least more than 60% homology, and The polynucleotides have the function of promoter or activity；Preferably, with the polynucleotide sequence of SEQ ID NO.4 at least 80% The polynucleotide sequence of more than homology, and the polynucleotides have the function of promoter or activity；It is furthermore preferred that with SEQ ID The polynucleotide sequence of the polynucleotide sequence of NO.4 at least more than 90% homology, and the polynucleotides have promoter Function or activity；Most preferably, with the polynucleotides of the polynucleotide sequence of SEQ ID NO.4 at least more than 95% homology Sequence, and the polynucleotides have the function of promoter or activity；Or

(d), carried out on the basis of SEQ ID NO.4 one or more bases missing, substitution or insertion obtain it is more Nucleotide variants, and the polynucleotides variant still has the function of promoter or activity.

Invention further provides the promoter deletion segment shown in SEQ ID NO.5, polynucleotide sequence is (a), shown in (b), (c) or (d):

(a), the polynucleotide sequence shown in SEQ ID NO.5；Or

(b), the polynucleotides that can be hybridized in stringent hybridisation conditions with the complementary series of SEQ ID NO.5, this is more Nucleotide still has the function of promoter or activity；Or

(c), with the polynucleotide sequence of the polynucleotide sequence of SEQ ID NO.5 at least more than 60% homology, and The polynucleotides have the function of promoter or activity；Preferably, with the polynucleotide sequence of SEQ ID NO.5 at least 80% The polynucleotide sequence of more than homology, and the polynucleotides have the function of promoter or activity；It is furthermore preferred that with SEQ ID The polynucleotide sequence of the polynucleotide sequence of NO.5 at least more than 90% homology, and the polynucleotides have promoter Function or activity；Most preferably, with the polynucleotides of the polynucleotide sequence of SEQ ID NO.5 at least more than 95% homology Sequence, and the polynucleotides have the function of promoter or activity；Or

(d), carried out on the basis of SEQ ID NO.5 one or more bases missing, substitution or insertion obtain it is more Nucleotide variants, and the polynucleotides variant still has the function of promoter or activity.

The present invention provides the promoter deletion segment shown in SEQ ID NO.6, polynucleotide sequence is (a), (b), (c) or shown in (d):

(a), the polynucleotide sequence shown in SEQ ID NO.6；Or

(b), the polynucleotides that can be hybridized in stringent hybridisation conditions with the complementary series of SEQ ID NO.6, this is more Nucleotide still has the function of promoter or activity；Or

(c), with the polynucleotide sequence of the polynucleotide sequence of SEQ ID NO.6 at least more than 60% homology, and The polynucleotides have the function of promoter or activity；Preferably, with the polynucleotide sequence of SEQ ID NO.6 at least 80% The polynucleotide sequence of more than homology, and the polynucleotides have the function of promoter or activity；It is furthermore preferred that with SEQ ID The polynucleotide sequence of the polynucleotide sequence of NO.6 at least more than 90% homology, and the polynucleotides have promoter Function or activity；Most preferably, with the polynucleotides of the polynucleotide sequence of SEQ ID NO.6 at least more than 95% homology Sequence, and the polynucleotides have the function of promoter or activity；Or

(d), carried out on the basis of SEQ ID NO.6 one or more bases missing, substitution or insertion obtain it is more Nucleotide variants, and the polynucleotides variant still has the function of promoter or activity.

Heretofore described " replacement " refers to substitute other base with different bases respectively；" missing " be Hypodactylia one or more base；" insertion " refers to the change of nucleotide, and for natural molecule, the change is Caused by the one or more bases of addition.

Invention further provides the recombinant plant expression vector containing the tissue-specific promoter and contain The host cell of the recombinant plant expression vector.

Tissue-specific promoter of the present invention and heterologous DNA sequence dna to be transcribed are subjected to operable connection, Obtain the recombinant plant expression vector of the specific expressed heterologous DNA sequence dna in crop seeds embryo.

Selectable marker gene can also be contained in the recombinant plant expression vector.

Furthermore it is possible to by the tissue-specific promoter of the present invention with the operable connection of flag sequence with definite mark sequence The activity of row, the flag sequence generally include to provide the gene of antibiotic resistance or Herbicid resistant, such as：Tetracycline resists Property gene, hygromycin gene, careless glycosides phosphine or glufosinate-resistant gene etc..

Any methods for plant transformation may be employed, the recombinant plant expression vector constructed by the present invention is introduced into target plant In the cell of object, tissue or organ, transformant is obtained；It regenerates to obtain by method for plant tissue culture by transformant again complete Plant and its clone or its offspring；The method for transformation includes：Agrobacterium-medialed transformation, protoplast transformation, Ti matter Grain, Ri plasmids, plant viral vector, microinjection, electroporation, microparticle bombardment etc.；The target plant includes unifacial leaf Plant, dicotyledon；Preferably, the target plant be grass, for example, it may be corn, rice, barley, The crops such as wheat, sorghum.

The separated tissue-specific promoter of the present invention is improving the quality of crop seed, improvement plant trait, is cultivating New variety of plant etc. is widely used.

By the present invention tissue-specific promoter it is operable be connected with purpose heterologous DNA sequence dna to be transformed, It can instruct or regulate and control purpose heterologous gene to be transformed to be transcribed or expressed in embryo of a plant seed, obtain having and be expected The genetically modified plants of character or new variety of plant；For example, by the present invention tissue-specific promoter it is operable with it is to be transformed Purpose heterologous DNA sequence dna be connected (wherein, the allogeneic dna sequence to be transformed also with the operable company of 3 ' noncoding regions It connects, described 3 ' noncoding regions can include terminator sequence, mRNA cutting sequences etc..) obtain can be in embryo of plant seed Express the recombinant plant expression vector of the purpose heterologous DNA sequence dna.Purpose heterologous DNA sequence dna to be transformed is unrestricted, It can be tiny RNA for adjusting gene, adjusting the antisense gene of gene or endogenous gene expression being disturbed etc.；Described is to be transformed Allogeneic dna sequence can be nucleic acid molecules from non-target gene species or gene or originate from or be present in and is identical Species in by it is artificial reconstructed or modification nucleic acid molecules or gene.

Usually, allogeneic dna sequence to be transformed be mostly Crop Improvement seed quality, improve crop environment-stress is resisted Property, improve the related gene of crop character or metabolism, for example, it may be：Improve plant physiology, the dependency basis of growth and development Cause, improves the related gene of yield, and enriched nutritive is improved to tolerance to environmental stress (disease and insect resistance, saline-alkali tolerant, drought-resistant, resistance to height It is warm, freeze proof etc.) etc. related genes, these genes either for plant provide beneficial character or improve or improve Crop Species Sub- quality promotes seed embryonic development or improves crop seed to pest and disease damage resistance.Can also will promote crop seed in iron, zinc, The accumulation of the trace element such as potassium has the operable structure afterwards that is connected with tissue-specific promoter of the invention of correlation gene Recombinant plant expression vector is obtained, after which is transformed into recipient plant tissue or cell, the present invention Tissue-specific promoter can drive promote the accumulation of the trace element such as iron, zinc, potassium in crop seed to have correlation gene making The high efficient expression of specificity is carried out in object seed embryo, effectively improves the accumulation of the trace element such as iron in crop seed, zinc, potassium, most Achieve the purpose that improve crop seed quality eventually.

Heretofore described purpose heterologous DNA sequence dna to be transformed can also include the sequence with RNA activity or production Sequence of raw polypeptide product etc., for example, it may be antisense sequences, RNAi sequences, ribozyme sequence, spliceosome, amino acid encoding sequence Row and their segment.

The term definition involved in the present invention arrived

Unless otherwise defined, otherwise all technologies used herein and scientific terminology all have with it is of the art Those of ordinary skill usually understands identical meaning.Although the usable and described herein in the practice or test of the present invention Similar or equivalent any method, apparatus and material, but preferred method, device and material will now be described.

Term " stringent hybridisation conditions " means known low ionic strength in the art and the condition of high temperature.In general, Under high stringency conditions, the detectable degree of probe and its target sequence hybridization is than the detectable degree higher that hybridizes with other sequences (such as more than at least 2 times of background.Stringent hybridisation conditions are sequence dependents, will be different under different environmental conditions, compared with Long sequence specific hybrid at relatively high temperatures.By control hybridization preciseness or wash conditions can identify and probe 100% complementary target sequence.Related document (Tijssen, Techniques in is can refer to for the detailed guidance of nucleic acid hybridization Biochemistry and Molecular Biology-Hybridization with Nucleic Probes," Overview of principles of hybridization and the strategy of nucleic acid assays.1993).More specifically, the high stringency conditions are typically selected to be less than distinguished sequence under regulation ionic strength pH Heat fusion joint (T_m) about 5-10 DEG C.T_mIt is residing when hybridizing to target sequence with the probe of target complementation in the state of the equilibrium 50% Temperature (under specified ionic strength, pH and nucleic acid concentration) (because target sequence is present in excess, in T_mUnder in equilibrium-like 50% probe is occupied under state).High stringency conditions can be the following conditions：Wherein it is below about in the lower salinity of pH 7.0 to 8.3 1.0M Na ion concentrations, typically about 0.01 to 1.0M Na ion concentrations (or other salt), and temperature for short probe (including 10 to 50 nucleotide of (but not limited to)) for at least about 30 DEG C, and for long probe (including but not limited to more than 50 Nucleotide) for be at least about 60 DEG C.High stringency conditions can also be realized by adding in the destabilizing agent of such as formamide.For choosing For selecting property or specific hybrid, positive signal can be the background hybridization of at least twice, be optionally 10 times of background hybridizations.It is illustrative Stringent hybridisation conditions can be as follows：50% formamide, 5 × SSC and 1%SDS are cultivated at 42 DEG C；Or 5 × SSC, 1%SDS, It is cultivated at 65 DEG C, washs and washed at 65 DEG C in 0.1%SDS in 0.2 × SSC.The washing can carry out 5,15,30, 60th, 120 minutes or longer time.

Term " host cell " or " recombinant host cell " mean to include the cell of polynucleotides of the present invention, but regardless of using Which kind of method is inserted into generate recombinant host cell, such as directly known in intake, transduction, f pairings or fields Other methods.Exogenous polynucleotide can remain the non-integrated vector of such as plasmid or can be integrated into host genome.

Term " polynucleotides " or " nucleotide " mean the deoxyribonucleotide of sub-thread or bifilar form, deoxyribose core Glycosides, ribonucleotide or ribonucleotide and its polymer.Except nonspecific limitation, otherwise the term is covered containing natural nucleotide Known analog nucleic acid, the analog has similar to the binding characteristic of reference nucleic acid and naturally-produced to be similar to The mode of nucleotide is metabolized.Unless in addition specific limitation, otherwise the term also mean oligonucleotide analogs, including PNA (peptide nucleic acid), DNA analogs (thiophosphate, phosphamide acid esters etc.) used in antisense technology.Unless in addition refer to Fixed, otherwise specific nucleic acid sequence also impliedly covers its conservative variant modified and (includes but is not limited to degenerate codon to take Generation) and complementary series and the sequence clearly specified.Particularly, can by generate one of them or more than one selected by (or It is all) the 3rd of codon realize that degenerate codon substitutes through mixing the sequence of base and/or deoxyinosine residue substitution (Batzer et al., Nucleic Acid Res.19:5081(1991)；Ohtsuka et al., J.Biol.Chem.260:2605- 2608(1985)；With Cassol et al., (1992)；Rossolini et al., Mol Cell.Probes 8:91-98(1994)).

Term " promoter " refers to the upstream for being present in target gene coded sequence, provides RNA polymerase and correctly transcribes The recognition site of other factors necessary to beginning starts or target gene is instructed to be transcribed into mRNA.

Term " tissue-specific promoter "：Target gene is specific expressed in tissue or organ opens for regulation and control or driving Mover.

Term " heterologous DNA sequence dna " refer to the DNA sequence dna belong to for the specific host cell external source or If modify or transformed from identical primary source but to the original series.

Gene of the term " endogenous gene " from host in itself, including DNA or RNA sequence.

Term " selectable marker gene "：The cell selective advantage is given in expression of the gene in plant cell, uses these Selective advantage possessed by these cells that selected marker is converted can be the life with non-transformed cell due to them Long compare has in negative selection agent (such as：Antibiotic or herbicide) in the presence of the ability that grows.Selectable marker gene also refers to The combination of several genes, their expression in plant cell give the cell negative and positive selective advantage.

Term " operable connection " refers to functional connection between two or more elements, the member of operable connection Part can be adjacent or non-adjacent.

Term " conversion "：Heterologous DNA sequence dna is introduced into the method for host cell or organism.

Term " expression "：The transcription and/or translation of endogenous gene or transgenosis in plant cell.

Term " coded sequence "：It is transcribed into the nucleotide sequence of RNA.

Term " plant expression vector "：One or more are used to implement the DNA vector of Plant Transformation；These in this field carry Body is commonly referred to as binary vector.Binary vector is to be usually used in agrobacterium-mediated conversion mostly together with the carrier with helper plasmid 's.Binary vector generally includes：T-DNA shifts required cis acting sequence, is handled through engineering so as in plant The selectable marker expressed in cell, heterologous DNA sequence dna to be transcribed etc..

Description of the drawings

Fig. 1 RNA quality testing electrophoretograms；R：Root；S1,S2,S3：4th, 3,2 segment stems；L1, L2, L3：2nd, 4,6 Leaf；SH1, SH2, SH3：The leaf sheath of 2nd, 4,6 leaf；SA：ST:Stem；Stem apex；T：Male flower；EN：Endosperm；E：Embryo；K：Seed.

The schematic diagram of Fig. 2 origin authentication carriers pCAMBIA3301.

The schematic diagram of Fig. 3 p85502-EZ.

The schematic diagram of Fig. 4 pUM3G intermediate carriers.

The schematic diagram of Fig. 5 expression vectors p85502G3.

The transient expression result of Fig. 6 embryo-specific promoters；The development time of embryo is 20 days.

Fig. 7 embryos specific promoter starts expression of the gus gene in seed；1,2,3,4 and 5 represent not respectively in figure Same corn seed.

The GUS colored graphs that the T1 of Fig. 8 p85502G3 stable conversions is respectively organized for transgenic corns, (a)：Blade；(b)：Root； (c)：Leaf sheath.

Fig. 9 different lengths promoter drives the transient expression result of reporter gene expression.

Figure 10 p85502-4G3 stable expressed vector figures.

Figure 11 p85502-0G3 stable expressed vector figures.

Figure 12 p85502-2G3 stable expressed vector figures.

Figure 13 p85502-6G3 stable expressed vector figures.

The GUS colored graphs that each deletion fragment of Figure 14 promoters is respectively organized in T1 for transgenic corns；(a)-(e):p85502- The GUS colored graphs that the T1 of 0G3 stable conversions is respectively organized for transgenic corns；(f)-(k):The T1 generations of p85502-2G3 stable conversions The GUS colored graphs that transgenic corns are respectively organized；(l)-(n):The T1 of p85502-4G3 stable conversions is for each of transgenic arabidopsis The GUS colored graphs of tissue；(o)-(q):The T1 of p85502-6G3 stable conversions is dyed for the GUS respectively organized of transgenic arabidopsis Figure；(a)/(b)/(f)/(g)：The seed rip cutting of 30 days after pollination, (b)/(g) are negative control；(c)/(i):Leaf sheath；(d)/(j): Leaf；(e)/(k):Root；(h):Scheme (i) coloured part cross section and amplify 25 times；(l)/(o):Inflorescence；(m)/(p):Silique；(n)/ (q):Blade.

Specific embodiment

The invention will now be further described with reference to specific embodiments, the advantages and features of the present invention will be with description and It is apparent.But these embodiments are only exemplary, do not form any restrictions to the scope of the present invention.People in the art Member it should be understood that without departing from the spirit and scope of the invention can to the details of technical solution of the present invention and form into Row modifications or substitutions, but these modifications and replacement are each fallen in protection scope of the present invention.

The Cloning and sequence analysis of 1 corn tissue's specific promoter of embodiment

1st, the promoter of driving corn seed specific expression gene is screened using microarray data

The preparation of genetic chip material：It takes between root, leaf, stem and the stem of corn B73 typhon mouth phases, the maturity period but does not pollinate Young fringe and filigree, 10 days after pollination, 15 days, 20 days, totally 14 samples, each sample type set 3 for the embryo of 25 days and endosperm etc. A repetition, using genetic chip (the Maize GenomeArray of Affymetrix companies) to the gene expression profile of 42 samples It is analyzed.

Bioinformatic analysis：Data analysis is carried out to 42 samples using the method for bioinformatics, is found that respectively One gene Zm85502 (promoter sequence of the gene is shown in SEQ ID NO.1) is specific in the middle and later periods of embryonic development Great expression.

Expression quantity of the table 1 using gene microarray analysis gene Zm85502 in different tissues

2nd, the promoter of quantitative RT-PCR screening driving embryo specific expression gene

Self-mating system B73 draws materials:Take after the root of typhon mouth phase, stem, leaf, leaf sheath, stem apex and pollination 10 days, 15 days, 20 My god, the embryo and endosperm of 25 days.Wherein stem takes three segments of morphology upper end, and leaf is taken respectively with corresponding leaf sheath from form Learn the 2nd, 4 that lower end number rises, 6 leaves and leaf sheath, each sample set 3 repetitions.

The extraction of RNA and cDNA are obtained：By tissue sample after being clayed into power with the mortar of Liquid nitrogen precooler, take general TRIzol reagents extracting method extraction RNA.The quality of RNA is detected with 1.5% agarose gel electrophoresis, and electrophoretogram is shown in Fig. 1.It presses The RNA dosages of the requirement of reverse transcription reagent box (Promega companies) are first except DNA, and then reverse transcription is into cDNA.Reverse transcription is in PCR After when 42 DEG C of incubations 1 are small on instrument, add 25mM EDTA to termination reaction in each reaction system.The cDNA samples of each tissue are female Liquid uses after diluting 25 times, and each reaction uses the cDNA after 5 microlitres of dilution.Reference gene uses actin, target gene It is each reacted with reference gene and does three parallel points.Verification primer is shown in Table 2.

Table 2 verifies primer

Using real-time quantitative RT-PCR come further verify gene microarray analysis as a result, and verify gene Zm85502 (should The promoter sequence of gene is SEQ ID NO.1) expression specificity and expression intensity in embryo.It was found that the knot of quantitative RT-PCR The experimental result of fruit and gene microarray analysis is basically identical, which is mainly expressed in embryo.

Expression quantity of the table 3 using RT-PCR analyses gene Zm85502 in different tissues

3rd, the clone of promoter

Using the 2.0kb sequences shown in SEQ ID NO.1 as the sequence for including " the high expression of tissue specificity " promoter overall length Row design cloning primer, designed cloning primer are as follows：

85502f 5-cccgggAGAGCACAGTAACATCAACACT-3；

85502r 5-ctgcagCTCGGCTCCACTACCGCGCGCGTT-3；

Using self-mating system B73 genomic DNAs template, expanded by high-fidelity DNA polymerase KOD and obtain purpose promoter gram Grand, PCR amplification program is as follows：1st, 94 DEG C of 4min, 2,98 DEG C of 10sec, 3,61 DEG C of 30sec, 4,68 DEG C of 2min, 2-4 are cycled part 30 times, then 68 DEG C of 10mi.PCR cloned sequences are loaded into cloning vector pEASY-Blunt (purchased from the full formula gold biotechnology in Beijing Co., Ltd) on, it is errorless through sequence verification sequence, new support is named as p85502-EZ.

1 alternate promoters of test example drive reporter gene specific expressed experiment in maize

Plant expression vector construction：In order to verify whether the segment of the 2.0kb shown in SEQ ID NO.1 or so has tissue Segment shown in SEQ ID NO.1 is cloned into plant expression vector pCAMBIA3301 and (is purchased from by specificity promoter function Cambia companies, http://www.cambia.org) (Fig. 2) verify the function of promoter.For the ease of clone, this experiment The multiple cloning sites of pCAMBIA3301 carriers are transformed, double digestion is carried out to it with EcoR I and Bgl II, and is inserted herein Enter synthesis containing multiple restriction enzyme site small fragments (sequence is as follows), formed to substitute original multiple cloning sites Intermediate carrier pUM3G：

5-GAATTC GGTACCCGGG(EcoR Ⅰ/Hind III/Kpn Ⅰ/Sma Ⅰ) ctattgcggtgcaggctgccagagcggcggctgtgacgctgtctttgccggcgccatcaccgccaactccactcttc tcgcagaatgatgatagatccaccatggttaacctagacttgtccatcttctggattggccaacttaattaatgtat gaaataaaaggatgcacacatagtgacatgctaatcactataatgtgggcatcaaagttgtgtgttatgtgtaatta ctagttatctgaataaaagagaaagagatcatccatatttcttatcctaaatgaatgtcacgtgtctttataattct ttgatgaaccagatgcatttcattaaccaaatccatatacatataaatattaatcatatataattaatatcaattgg gttagcaaaacaaatctagTCTAGACTGCAGCCATGGTAGATCT(Xba Ⅰ/Pst Ⅰ/Nco Ⅰ/BglⅡ)-3；

Digestion processing is carried out to p85502-EZ (Fig. 3) using Sma I and Pst I, promoter fragment is connected into Sma I Digestion and the pUM3G intermediate carriers (Fig. 4) of Pst I digestions processing, obtain expression vector p85502G3 (Fig. 5), reporter gene is GUS。

The acquisition of converting material：Transcript in view of most candidate genes is 20 days or so after corn pollination Reach peak, therefore take the young fringe of 20 days after corn pollination, remove bract and filigree, with 5% sodium hypochlorite soaking disinfection Sterilizing 30 minutes, then with sterile water wash three times.In superclean bench, rataria is stripped with scalpel under aseptic condition, and Rataria concentration is immersed in liquid MS medium to remove the starch on embryo surface and keeps the vigor of embryo.Take enough embryos It is cleaned once, is then transferred to spare when high osmotic treatment 4 is small in the hypertonic culture of solid with liquid MS medium again afterwards.It is placed per ware 9-12 rataria, three embryo a line place 3-4 rows.

Conversion：The making of micro- bullet and biolistic bombardment method bibliography (Rumei Chen et.al., 2008, Transgenic Res.17(4):633-43), simply film can will be split change into the specification of 1100psi.It is bombarded once per ware, each It is a parallel to build 2-3, plasmid dosage is 1 microgram/rifle.It has bombarded latter hour, then rataria has been transferred to 28 on recovery media When DEG C light culture 24 is small.

GUS histochemical stains:In superclean bench by the corn transformation material of light culture be transferred to sterile 2 milliliters from In heart pipe (1 rifle/pipe), often pipe plus 400 microlitres of GUS dye liquors, detain upper tube cap, centrifuge tube are lain in a horizontal plane in 37 DEG C of insulating boxs and is protected When temperature at least 8 is small.The presence or absence of coloring spot of observation analysis rataria and the depth verify that the candidate shown in SEQ ID NO.1 starts The function of son.Visible (Fig. 6) from result of the test, the driving gus reporter gene of promoter shown in SEQ ID NO.1 has in maize There is the expression of high intensity.

Stable conversion corn further identifies the function of embryo-specific promoter：By stable conversion carrier p85502G3 (figures 5) corn material Hi II has been converted in agriculture bacillus mediated method, has obtained the plant of stable conversion, maize stable conversion process It is as follows：

(1), take the young fringe of Hi II of 10 days after pollination, prepared first with sterile water 5% liquor natrii hypochloritis to young fringe into Row impregnates sterilizing 15min, then with sterile water soaking and washing three times.

(2), the rataria for aseptically, stripping length in 1.5mm-2.0mm or so is placed in added with acetosyringone Liquid infects culture medium, and (culture medium prescription refers to paper Molecular Breeding, 2001, volume 8, the page number:323– 333) in.

(3), 4 days contain will be cultivated at 28 DEG C on the YEB solid mediums with corresponding resistant in advance purposefully to express The liquid that the recombinant clone thalline scraping of carrier is resuspended in right amount added with acetosyringone is infected in culture medium, 28 DEG C of constant-temperature tables Low speed renewal cultivation is to OD₂₆₀To 0.4-0.6.

(4), infect culture medium with liquid and clean the rataria that strips twice, cleaning solution is abandoned in suction, adds in OD₂₆₀=0.4-0.6's Thalline overturns mixing 20 times, is placed under dark condition and stands 5min.

(5), inhale and abandon bacterium solution, and infect culture medium with liquid and clean the rataria of dip dyeing twice, related second of cleaning solution with Rataria be poured over together without screening pressure solidified co-cultivation medium (culture medium prescription refers to paper Molecular Breeding, 2001, volume 8, the page number:323-333) on, rataria is evenly distributed on culture medium, and the even surface of rataria is close to train It supports, arc is face-up.

(6), inhale and abandon cleaning solution, culture is placed under 25 DEG C of insulating box dark conditions and is cultivated 3 days.After co-culturing 3 days Rataria be aseptically transferred to without screening pressure solid recovery media on, cultivated 7-10 days under 28 DEG C of dark conditions.

(7), renewal cultivation is grown fine and sterile rataria derivative is transferred to the screening with basta screening pressures and trains It supports to screen on base and cultivates 1-2 months under 28 DEG C of dark conditions, subculture is once every 2 weeks.

(8), after thering is the speed of growth to be significantly higher than the kanamycin-resistant callus tissue appearance of general callus, bred certain Afterwards, a certain amount of kanamycin-resistant callus tissue is transferred to the differential medium with a variety of hormones (culture medium prescription refers to paper Molecular Breeding, 2001, volume 8, the page number:323-333) cultivate 2 weeks or so, induce under upper 28 DEG C of dark conditions Form embryoid.

(9), embryoid is transferred in solid root media, is cultivated 1 week or so under 28 DEG C of illumination conditions.It takes root into Seedling is transferred in the cylindric culture tube for filling solid root media by seedling, is cultivated 1 week or so under 28 DEG C of illumination conditions.

(10), the test tube seedling that 2-3 piece spires are unfolded is transferred in the nutritive cube of nutritious soil again and is trained in illumination box Greenhouse is can be transferred to after supporting 1 week or so further to cultivate and be finally transplanted to big Tanaka.

Fig. 7 is the situation that promoter shown in SEQ ID NO.1 drives gus gene expression in corn seed, can be with from Fig. 7 It was found that promoter shown in SEQ ID NO.1 can drive gus gene high expression specific in maize,.

Fig. 8 is overall length promoter P₈₅₅₀₂(SEQ ID NO.1) is in T1 for each tissue in three leaf of transgenic corns wholeheartedly period GUS colored graphs；Fig. 8 (a)-(c) right half parts are same time negative control materials, it can be clearly seen that transgenic leaf section Edge (left and right sides) have coloring, but the edge (upper and lower both sides) grown naturally of blade does not colour, and compares blade and appoint What equal non-coloring in position.Illustrate P₈₅₅₀₂₂(SEQ ID NO.1) overall length promoter is to be in nutritive issue under normal physiological conditions It does not express, but under mechanical damage inductive condition, the characteristic of induced expression is shown in nutritive issue.

Separation and its functional verification experiment of the most short promoter of test example 2

Promoter shown in SEQ ID NO.1 since holding 5 ' is gradually deleted and obtains multiple truncated promoter fragments, Length is respectively 1.4kb, 0.81kb, 0.31kb, 0.18kb and 0.14kb；Then each truncated segment is connected into wink respectively again When checking carrier pCAMBIA3301 (purchased from Cambia companies, http://www.cambia.org), it is each truncated to verify Whether segment still has the function of promoter, to determine the most short promoter sequence with expressive function.

From fig. 9, it can be seen that by promoter shown in SEQ ID NO.1 since 5 ' hold gradually delete obtained 1.4kb, The truncated sequence of 0.81kb, 0.31kb and 0.18kb can drive gus gene to be expressed in corn seed embryo,；Wherein 0.18kb (shortest promoter fragment) is the segment (SEQ ID NO.2) between-181 -+1：

-181CTGACGCGCC ACGTCCCGCG CCACCGCCGA GCCGCTTCT-138

-139GTAC TACACCGCAG CCGGCGCAGC GGAATACACG CCAGAAACTA ATCCAGATAG

-81CTAGCCTTTG ATTTCTCACT TCAATCTGAC GAAGTGCACA CCTAGGCAAC AAACTCGAAC

-21GCGCGCGGTA GTGGAGCCGAG+1

- 181 -+1 is the functional minimal segment of tool；

- 138 -+1 is not have functional maximum segment；The two differs 43bp, and a TATAbox is included in this 43bp.

Result of the test confirms that the truncated promoter fragment shown in SEQ ID NO.2 can drive gus gene in maize Middle carry out high efficient expression, it was demonstrated that the truncated segment shown in SEQ ID NO.2 still has promoter function.

Test example 3 truncates the functional verification experiment of promoter stable conversion corn

Overall length promoter shown in SEQ ID NO.1 since holding 5 ' is gradually deleted and obtains four truncated startup sub-pieces Section P_85502-4(SEQ ID NO.3)、P_85502-0(SEQ ID NO.4)、P_85502-2(SEQ ID NO.5)、P_85502-6(SEQ ID NO.6)；With reference to the construction method of stable conversion carrier p85502G3 in test example 1, build obtain stable expressed vector respectively P85502-4G3 (Figure 10), p85502-0G3 (Figure 11), p85502-2G3 (Figure 12) and p85502-6G3 (Figure 13)；

Stable expressed vector p85502-0G3 and stable expressed vector p85502-2G3 is situated between according to Agrobacterium in test example 1 The method led has converted corn material Hi II respectively, has obtained the plant of stable conversion, the same test example of maize stable conversion process 1。

By stable expressed vector p85502-4G3 and stable expressed vector p85502-6G3 according to agriculture bacillus mediated method Arabidopsis has been converted respectively, has obtained the transfer-gen plant of stable conversion, and the method that transgenic arabidopsis obtains is as follows：

1st, the Agrobacterium bacterium solution of conversion is prepared, Kan and Rif resistances will be inoculated into for the Agrobacterium strain of conversion It is activated in liquid YEP medium, 28 DEG C, 200rpm shakes overnight.Then press 1:The strain of 400 volume ratio switching activation arrives 200mL, which has in the liquid YEP medium of Kan and Rif resistances, to be cultivated, 28 DEG C, 200rpm.When bacterium solution reach OD600 for 1.5~ When within 3.0,4 DEG C, 4000g centrifugations 10min collects thalline.With 10% sucrose L-77 containing 0.02%silwet, (GE companies give birth to Production) to be diluted to OD600 be about 0.8--1.0 or so spare.

2nd, water：Needs are done the wildtype Arabidopsis thaliana young plant converted and irrigated by conversion the previous day.

3rd, the silique that pollination has been completed on plant is cut with scissors, takes some pallets, blotting paper is spread into simultaneously in its bottom It is drenched with water spare.

4th, plant is lain in by a big plate, inflorescence part concentration is placed in ware.

5th, spare Agrobacterium bacterium solution is poured into, disposable glove is taken and is gently pressed into inflorescence in bacterium solution, timing 30 seconds.

6th, after converting, plant is quickly transferred in spare pallet, and is buckled to a pallet again on pallet top By all transformed plant shading treatments 24 it is small when.

7th, the plant of shading treatment is replaced under the conditions of normal illumination cultivation and cultivated.

8th, above-mentioned step of converting is repeated week about, but cannot again be cut emerging teach.Each structure is general Conversion 2-3 times.

From Figure 13 (a) it can be seen that promoter deletion segment P_85502-0Still have and start reporter gene expression in embryo tissue Function, but its activity compared with overall length promoter P₈₅₅₀₂(SEQ ID NO.1) is decreased obviously.And from Figure 13 (c) it can be seen that starting Sub- deletion fragment P_85502-0The characteristic of the induced expression in leaf sheath is maintained, Figure 13 (d) and (e) illustrate that it loses in blade and root Lost overall length promoter nutritive issue in induced expression characteristic.In summary each result can be seen that promoter deletion Segment P_85502-0It is the embryo tissue-specific promoter under normal physiological conditions that a promoter activity reduces, but in machinery The characteristic of induced expression is shown under wound inducement in leaf sheath tissue.

From Figure 13 (f) it can be seen that promoter deletion segment P_85502-2It loses and starts reporter gene expression in embryo tissue Function.But from (h)-(k) it can be seen that P_85502-2Maintain the characteristic of the induced expression in nutritive issue.In summary each knot Fruit can be seen that promoter deletion segment P_85502-2It is one and does not have promoter in each tissue under normal physiological conditions Activity, but show in nutritive issue under mechanical damage induction the characteristic of induced expression.

From transgenic arabidopsis coloration result is respectively organized to can be seen that shorter P₈₅₅₀₂Deletion fragment is still active ((l)/(o)/(m)/(p)) is P_85502-4With P_85502-6Comparatively speaking characteristic (n)/(q) of induced expression is still maintained.

The result for from above four deletion fragments Reporter gene GUS being driven to express in transgenic corns/arabidopsis can be with Find out, this four deletion fragments still have promoter activity, but it starts intensity and some changes occur for tissue specificity.

Claims (6)

1. the separated tissue-specific promoter from corn (Zea mays), which is characterized in that its polynucleotides is SEQ ID Shown in NO.1.

2. the tissue-specific promoter after tissue-specific promoter's truncation described in claim 1, polynucleotide sequence For shown in SEQ ID NO.2.

3. the recombinant plant expression vector containing the tissue-specific promoter described in claim 1 or 2.

4. the tissue-specific promoter described in claim 1 or 2 is regulating and controlling or is starting purpose heterologous gene in corn seed Specific expressed application is carried out in embryo.

5. crop seed quality, improvement plant trait or cultivation turn are improving in the tissue-specific promoter of claim 1 or 2 Application in gene plant new varieties；The crop or plant is corn.

6. according to the application described in claim 4, which is characterized in that including：By the tissue-specific promoter and wait to turn Operable be ligated and transformed into maize cell, tissue or organ of the purpose heterologous gene sequence of change obtains transformant；It will Transformant regenerates to obtain complete plant or clone by tissue cultures.