CN104630273A - Preparation method and application of K562 cell strain for stably expressing human cytomegalovirus pp65 protein in nucleus - Google Patents
Preparation method and application of K562 cell strain for stably expressing human cytomegalovirus pp65 protein in nucleus Download PDFInfo
- Publication number
- CN104630273A CN104630273A CN201510016175.6A CN201510016175A CN104630273A CN 104630273 A CN104630273 A CN 104630273A CN 201510016175 A CN201510016175 A CN 201510016175A CN 104630273 A CN104630273 A CN 104630273A
- Authority
- CN
- China
- Prior art keywords
- cell
- gene
- virus
- hcmv
- nls
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a new establishment method and application of a cell strain for stably human cytomegalovirus (HCMV) pp65 protein in nucleus. A nucleus localization signal (pp65-NLS) is added to the 3' end of the HCMV pp65 gene, so that the endonuclear expressed pp65 gene transfected by the gene has the same cellular localization as the host-cell-infected HCMV; and the pp65-NLS is integrated into the K562 cell under the mediation of slow virus, thereby establishing the K562 cell strain for stably expressing 9965-NLS. The cell strain can be used as a positive reference substance of an HCMV 9965 antigenemia detection kit, thereby implementing the reliable application of the kit in clinical diagnosis.
Description
Technical field
The present invention relates to recombinant gene expression system, specifically, the present invention relates to after cell inner stablity expression is artificial reconstructed, there is human macrocell virus pp 65 gene and the application thereof of nuclear localization signal.
Background technology
The infection of human cytomegalic inclusion disease virus (human cytomegalovirus, HCMV) in crowd is very general, and in worldwide distribution, domestic about 90% adult can detect HCMV antibody.Within the HCMV primary infection (also known as primary infection) of the known mankind usually occurs in 2 years old, and once infect, virus is difficult to be eliminated external, mostly hides all the life in host body.The normal crowd of immunologic function, this virus and host is in " balance " state, when body causes hypoimmunity due to a variety of causes (HIV, transplanting and aging etc.), this " balance " will be broken and cause HCMV reactivation to infect, and virus now also can derive from other the infecteds from host itself.Primary infection and reactivation infect is referred to as Active infection, and in AIDS patient, transplanting receptor and the elderly, HCMV Active infection can cause various diseases, even causes death; Immunologic function not yet fully-developed fetus then have teratogenecity, cause inborn defect.
Also do not have the vaccine that HCMV can be prevented to infect at present, but clinical study finds, earlier antiviral treatment can alleviate the damage of congenital infection nervous system in children, saves hearing; Transplant patient's case fatality rate can be reduced, avoid excessive immune suppression therapy; And patient's retinopathy capable of preventing AIDS, contribute to the quality of life improving patient.Therefore, urgent clinical needs HCMV Active infection detection means fast and accurately.Though conventional viral separation and Culture is HCMV diagnosis " gold standard ", needs just can obtain positive findings in 4 weeks, be difficult to the requirement meeting quick diagnosis.ELISA method detects the diagnosis that HCMV specific IgM antibody can be used for the normal HCMV Active infection of immunologic function or HCMV disease, but its positive rate is low, suppresses patient also can for want of antibody response or antibody postpone to occur and " mistaken diagnosis " at sever immune.HCMV pp65 is envelope protein, and between the capsid and its coating of this virus, belong to low matrix phosphorylated protein, molecular weight is 65kD, accounts for 15% of viral total protein, is the major viral proteins of excitating organism cellular immunization.Because HCMV mainly hides in human peripheral blood single nucleus cell, when there is reactivation infection, first virus copy propagation in mononuclearcell, then cause humoral immune reaction with flow propagation.Therefore, the time that in mononuclearcell, pp65 antigen occurs comparatively specific IgM antibodies occur early, and can not express because patient immune function is low and reduce.Detect that pp65 antigenemia not only can illustrate that there is HCMV reactivation infects, alternatively patient's disappearance is for the cellular immunity of HCMV simultaneously.Therefore, be recently by " the new gold standard " of the clinical detection HCMV Active infection accepted extensively by detecting patient HCMV pp65 antigenemia.Given this, set up pp65 antigenemia detection kit and effectively will help clinical solution HCMV Active infection diagnosis problem.
But needing positive control accurately and reliably as the HCMV pp65 antigenemia detection kit that clinical diagnosis uses, HCMV is difficult to infect monocyte in vitro, and the mode of external sense monocyte transfect cell therefore can not be adopted to prepare positive control; The cell number less (being less than 1%) of the HCMV pp65 antigenemia positive in Most patients body, therefore direct being also difficult to using the monocyte of known positive patient as positive control realizes; If by pp65 gene direct transfection cell, pp65 albumen can be expressed with cytoplasm, this and HCMV infects time pp65 express with nucleus in there is notable difference, therefore can not be in contrast.
Summary of the invention
The object of the invention is to set up the K562 cell of stably express HCMV pp65 gene in core, as HCMV pp65 antigenemia detection kit positive control.
The object of the invention is to be realized by following scheme:
The preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in a kind of core: comprise the following steps:
A) gene SOEing is adopted to obtain the human macrocell virus pp 65 gene of 3-' end increase nuclear localization signal;
B) by this gene clone in Lentiviral PLVX-puro, and the slow virus of packaging expression pp65-NLS gene;
C) with the slow virus infection K562 cell of expressing pp65-NLS gene; Tetracycline is adopted to filter out the K562 cell strain of stably express pp65-NLS gene.
The preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in described a kind of core, is characterized in that: pp65-NLS gene holds increase nuclear localization signal NLS by gene SOEing at normal people's macrocell virus pp 65 gene 3-'.
The preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in described a kind of core, is characterized in that: the amino acid residue sequence of nuclear localization signal is DPKKKRKVDPDPKKKRKVDPKRKVGSTGSRGT.
The preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in described a kind of core, it is characterized in that: wherein pp65 genetic expression is in nucleus, consistent with the location of pp65 albumen in infected cell during human cytomegalovirus infection's cell, and only can express in cytoplasm different from direct transfection pp65 gene.
The preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in described a kind of core, is characterized in that:
Preparation method comprises the following steps:
(1) the pp65 gene that 3 ' end connects nuclear localization signal is prepared
According to the HCMVAD169 pnca gene sequence announced in Genebank, determine HCMV pp 65 gene coded sequence, be designed for the PCR primer of amplification HCMV pp 65, with HCMV AD169 DNA for template, by three-wheel gene SOEing, obtain the pp65 gene that 3 ' end carries nuclear localization signal, be connected to PLVX-Puro plasmid, construction recombination plasmid PLVX-Puro-pp65-NLS, transformation of E. coli DH5 α, extract plasmid, obtain the correct recombinant vectors of sequence by DNA sequencing;
(2) slow virus packaging
By recombinant vectors PLVX-Puro-pp65-NLS plasmid correct for sequence and slow virus packaging plasmid PSP and Δ G, mix in the ratio of 2:3:3, transfection is to 293FT cell, collecting cell culture supernatant after 48h, detect p24 protein concentration by ELISA method and judge packaged slow virus drop degree, according to the slow virus titre measured, if titre does not reach 10
7pFU/ml, be then concentrated into titre by ultracentrifugation by slow virus and reach 10
7more than PFU/ml;
(3), slow virus infection and resistant cell screening
Slow virus liquid is pressed MOI=10 and infect K562 cell, continue cultivation 7 with the perfect medium containing 2 μ g/ml tetracyclines, filter out the cell with puromycin-resistant;
(4), colonized culture
The K562 cell with puromycin-resistant is cultivated by limiting dilution culture method, thus obtains the clone of individual cells formation, the single clone's enlarged culturing of picking, and observe with indirect immunofluorescence, select the cell of expressing pp65 in nucleus.
The application of stably express human macrocell virus pp 65 albumen K562 cell strain in described core, is characterized in that: it can be used as the positive reference substance that Human Cytomegalovirus Antigen mass formed by blood stasis detects.
Beneficial effect of the present invention is:
In the core that the present invention sets up, to have the location of pp65 in host cell when infecting with HCMV consistent for the K562 cell of stably express pp65 albumen, the feature of applicable large-scale production.
The present invention adds nuclear localization signal at 3 ' end of HCMV pp65 gene, makes to express pp65 gene in the nucleus of this gene of transfection, the same with cellular localization during HCMV host cells infected.The slow virus of packaging expression HCMV pp65-NLS gene again, infects K562 cell, filters out the clone being stabilized in and expressing pp65 albumen in core, in this, as the positive control of HCMV pp65 antigenemia detection kit.This positive control mainly contains following characteristics: 1., in pp65 protein expression and nucleus, when infecting with HCMV, the location of pp65 in host cell is consistent; 2. eliminate the operation that virus infection or plasmid transfection etc. are more loaded down with trivial details, only need culturing cell, more adapt to scale operation.
Accompanying drawing explanation
Fig. 1 is the expression of indirect immunofluorescene assay pp65-NLS in K562 cell;
Wherein, the K562 cell DAPI of A: transfection HCMV pp65 gene dyes (showed cell core); The K562 cell pp65 monoclonal antibody dyeing (display pp65 mainly expresses in cytoplasm) of B: transfection HCMV pp65 gene; C: the K562 cell DAPI that stably express increases the HCMV pp65 gene (pp65-NLS) of nuclear localization signal dyes (showed cell core); The K562 cell pp65 monoclonal antibody dyeing (display pp65 mainly expresses at nucleus) of D: stably express pp65-NLS.
Embodiment
embodiment 1,
The preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in described a kind of core, is characterized in that:
Preparation method comprises the following steps:
(1) the pp65 gene that 3 ' end connects nuclear localization signal is prepared
According to the HCMVAD169 pnca gene sequence announced in Genebank, determine HCMV pp 65 gene coded sequence, be designed for the PCR primer of amplification HCMV pp 65, with HCMV AD169 DNA for template, by three-wheel gene SOEing, obtain the pp65 gene that 3 ' end carries nuclear localization signal, be connected to PLVX-Puro plasmid, construction recombination plasmid PLVX-Puro-pp65-NLS, transformation of E. coli DH5 α, extract plasmid, obtain the correct recombinant vectors of sequence by DNA sequencing;
(2) slow virus packaging
By recombinant vectors PLVX-Puro-pp65-NLS plasmid correct for sequence and slow virus packaging plasmid PSP and Δ G, mix in the ratio of 2:3:3, transfection is to 293FT cell, collecting cell culture supernatant after 48h, detect p24 protein concentration by ELISA method and judge packaged slow virus drop degree, according to the slow virus titre measured, if titre does not reach 10
7pFU/ml, be then concentrated into titre by ultracentrifugation by slow virus and reach 10
7more than PFU/ml.
(3), slow virus infection and resistant cell screening
Slow virus liquid is pressed MOI=10 and infect K562 cell, continue cultivation 7 with the perfect medium containing 2 μ g/ml tetracyclines, filter out the cell with puromycin-resistant;
(4), colonized culture
The cell with puromycin-resistant is cultivated by limiting dilution culture method, thus obtains the clone of individual cells formation, the single clone's enlarged culturing of picking, and identify expression and the cellular localization of pp65 albumen with indirect immunofluorescence, to obtain final product.
embodiment 2
(1) the pp65 gene of 3 ' end containing nuclear localization signal is built
1) according to the HCMVAD169 pnca gene sequences Design gene SOEing primer announced in Genebank
F: 5’-CTCGAGATGGAGTCGCGCGGT-3’；
R1：5’-TGGATCTACCTTTCTCTTCTTTTTTGGATCACCTCGGTGCTTTTTG-3’；
R2：5’-TGGATCTACCTTTCTCTTCTTTTTTGGATCTGGATCTACCTTTC-3’；
R3：5’-GGTACC TCTAGATCCGGTGGATCCTACCTTTCTCTT TGGATCTACCTTTCTC-3’
2) from the MRC-5 cell that HCMV AD169 strain is infected, phenol is adopted: chloroform: primary isoamyl alcohol method extracts DNA as PCR masterplate;
3) with HCMV AD169 strain virus DNA for masterplate, carry out pcr amplification with primers F and R1;
4) get 2 μ l PCR primer as masterplate, carry out pcr amplification with primers F and R2;
5) get 2 μ l PCR primer again as masterplate, carry out pcr amplification with primers F and R3;
6) by 3 PCR, pp65 gene 3 ' is held and add nuclear localization signal DPKKKRKVDPDPKKKRKVDPKRKVGSTGSRGT.
7) PLVX-Puro-pp65-NLS plasmid is built by the PCR primer of acquisition insertion PLVX-Puro carrier.
(2) slow virus packaging
1) employing goes intracellular toxin plasmid extraction kit to extract PLVX-Puro-pp65-NLS plasmid, PSP plasmid and Δ G plasmid;
2) get 1.5 μ g PSP plasmids, 1.5 μ g Δ G plasmids and 1 μ gPLVX-Puro-pp65-NLS plasmid to be respectively placed in 1.5ml aseptic EP pipe Opti MEM substratum and to supply volume to 500 μ l, softly mix, incubated at room 5min;
3) get 1.5ml sterilizing EP to manage, add 18 μ l liposomes 2000 and be dissolved in 500 μ l serum-free Opti-MEM substratum, softly mix, incubated at room 5min;
4) DNA solution and liposome solutions are softly mixed, incubated at room 20min;
5) simultaneously with trysinization and the 293FT cell that counts, with containing serum but antibiotic-free DMEM substratum re-suspended cell;
6) in 60mm plate, 5 × 10 are added
6individual 293FT cell, then add DNA-liposome complex, in 37 DEG C containing 5%CO
2overnight incubation in incubator;
7) next day, the substratum removed containing DNA-liposome complex removes, and replaces DMEM(containing Sodium.alpha.-ketopropionate and nonessential amino acid) perfect medium continuation cultivation;
8) collect culture supernatant after changing liquid cultivation 48h and be slow virus, the centrifugal 20min of 3000 rpm, remove precipitation;
9) p24 ELISA method is carried out to supernatant and detect slow virus titre, in-80 DEG C of storages.
(3) slow virus infection and resistant cell screening
1) in several K562 of Secondary Culture a few days ago cell of slow virus infection test, in good condition;
2) K562 cell concn is adjusted to 2 × 10
5/ ml, adds the slow virus liquid that final concentration is polybrene and MOI=10 of 6 μ g/ml, the centrifugal 4h of 150 × g room temperature in nutrient solution;
3) fresh cell medium adding equivalent in substratum eliminates cytotoxicity to dilute polybrene;
4) continue culturing cell 3 ~ 4 days, Intermediate View cell growth status can go down to posterity or change liquid;
5) use the perfect medium screening and culturing 7 days containing 2 μ g/ml tetracyclines after instead, within every 2 days, change once fresh substratum;
6) during, visual cell's growing state can go down to posterity;
7) cell of surviving afterwards for 7th in tetracycline effect is the K562 cell of stable transfection pp65-NLS.
(4) colonized culture
1) having the K562 cell of puromycin-resistant to be diluted to concentration with the perfect medium containing 0.25 μ g/ml tetracycline screening acquisition is 20/ml;
2) in 96 orifice plates, every hole adds 0.1ml, in 37 DEG C containing 5%CO
2cultivate in incubator;
3) observe every day, select the hole of single clone, when being cultured to cell coverage hole surface-area 1/3, cell is transferred to enlarged culturing in 6 orifice plates, frozen conservation;
4) by the expression of indirect immunofluorescene assay pp65 in cell and location.
(5) positive control of HCMV pp65 antigenemia detection kit is prepared
1) the K562 cell of stable transfection pp65-NLS and the K562 cell of untransfected are adjusted to 2 × 10
6mix in the ratio of 1:4 after/ml;
2) get 20 μ l cell suspensions, be applied in the circular scope of slide glass diameter 6mm, natural evaporate to dryness, make cell attachment on slide glass;
3) in Fume Hoods, on the slide glass of evaporate to dryness, drip cell stationary liquid, cover the position scribbling cell completely, incubated at room 15min;
4) wash 3 times with PBS, each 3min, dry;
5) on slide glass, drip permeable membrane liquid and cover the position scribbling cell completely, incubated at room 15min;
6) PBS washs 3 times, each 3min, and room temperature is dried, frozen with-80 DEG C of refrigerators.
(6) application of positive control
1) contrast slide PBS is soaked 1min, dry, test together with sample;
2) there is the region of cell to drip the pp65 antibody application liquid of 35 μ l to slide, in 37 DEG C of wet boxes, hatch 60min;
3) washings washs 3 times, each 3min, dries;
4) have the region of cell to drip the anti-application liquid of fluorescence two of 35 μ l to slide, in 37 DEG C of wet boxes, lucifuge hatches 30min;
5) 0. 1% Azo-Blue dye liquor is dripped to covering cell, room temperature lucifuge effect 5min;
6) washings washs 3 times, each 3min, dries;
7) drip appropriate mountant, use cover glass mounting, immediately fluorescent microscope 400 × read result (also can with 1000 × improve resolving power), preservation of taking a picture;
8) positive control should show yellow-green colour nuclear targeting, and the number of positive cell can not exceed 20% of whole cell number, if occur in positive control, full result that is positive or full feminine gender illustrates test failure, needs revision test.
The preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain and application thereof in a kind of core; Bo Rui bio tech ltd, Wang Mingli Anhui
The amino acid residue sequence of nuclear localization signal:
DPKKKRKVDPDPKKKRKVDPKRKVGSTGSRGT
PCR primer:
F: 5’-CTCGAGATGGAGTCGCGCGGT-3’
R1：5’-TGGATCTACCTTTCTCTTCTTTTTTGGATCACCTCGGTGCTTTTTG-3’
R2：5’-TGGATCTACCTTTCTCTTCTTTTTTGGATCTGGATCTACCTTTC-3’
R3：5’-GGTACC TCTAGATCCGGTGGATCCTACCTTTCTCTT TGGATCTACCTTTCTC-3’
Claims (6)
1. the preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in a core: comprise the following steps:
Gene SOEing is adopted to obtain the human macrocell virus pp 65 gene of 3-' end increase nuclear localization signal;
By this gene clone in Lentiviral PLVX-puro, and the slow virus of packaging expression pp65-NLS gene;
With the slow virus infection K562 cell of expressing pp65-NLS gene; Tetracycline is adopted to filter out the K562 cell strain of stably express pp65-NLS gene.
2. the preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in a kind of core according to claim 1, is characterized in that: pp65-NLS gene to be held at normal people's macrocell virus pp 65 gene 3-' by gene SOEing to increase nuclear localization signal NLS.
3. the preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in a kind of core according to claim 2, is characterized in that: the amino acid residue sequence of nuclear localization signal is DPKKKRKVDPDPKKKRKVDPKRKVGSTGSRGT.
4. the preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in a kind of core according to claim 1, it is characterized in that: wherein pp65 genetic expression is in nucleus, consistent with the location of pp65 albumen in infected cell during human cytomegalovirus infection's cell, and only can express in cytoplasm different from direct transfection pp65 gene.
5. the preparation method of stably express human macrocell virus pp 65 albumen K562 cell strain in a kind of core according to claim 1, is characterized in that:
Preparation method comprises the following steps:
(1) the pp65 gene that 3 ' end connects nuclear localization signal is prepared
According to the HCMVAD169 pnca gene sequence announced in Genebank, determine HCMV pp 65 gene coded sequence, be designed for the PCR primer of amplification HCMV pp 65, with HCMV AD169 DNA for template, by three-wheel gene SOEing, obtain the pp65 gene that 3 ' end carries nuclear localization signal, be connected to PLVX-Puro plasmid, construction recombination plasmid PLVX-Puro-pp65-NLS, transformation of E. coli DH5 α, extract plasmid, obtain the correct recombinant vectors of sequence by DNA sequencing;
(2) slow virus packaging
By recombinant vectors PLVX-Puro-pp65-NLS plasmid correct for sequence and slow virus packaging plasmid PSP and Δ G, mix in the ratio of 2:3:3, transfection is to 293FT cell, collecting cell culture supernatant after 48h, detect p24 protein concentration by ELISA method and judge packaged slow virus drop degree, according to the slow virus titre measured, if titre does not reach 10
7pFU/ml, be then concentrated into titre by ultracentrifugation by slow virus and reach 10
7more than PFU/ml;
(3), slow virus infection and resistant cell screening
Slow virus liquid is pressed MOI=10 and infect K562 cell, continue cultivation 7 with the perfect medium containing 2 μ g/ml tetracyclines, filter out the cell with puromycin-resistant;
(4), colonized culture
The K562 cell with puromycin-resistant is cultivated by limiting dilution culture method, thus obtains the clone of individual cells formation, the single clone's enlarged culturing of picking, and observe with indirect immunofluorescence, select the cell of expressing pp65 in nucleus.
6. the application of stably express human macrocell virus pp 65 albumen K562 cell strain in core as claimed in claim 1, is characterized in that: it can be used as the positive reference substance that Human Cytomegalovirus Antigen mass formed by blood stasis detects.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510016175.6A CN104630273A (en) | 2015-01-13 | 2015-01-13 | Preparation method and application of K562 cell strain for stably expressing human cytomegalovirus pp65 protein in nucleus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510016175.6A CN104630273A (en) | 2015-01-13 | 2015-01-13 | Preparation method and application of K562 cell strain for stably expressing human cytomegalovirus pp65 protein in nucleus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN104630273A true CN104630273A (en) | 2015-05-20 |
Family
ID=53209519
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510016175.6A Pending CN104630273A (en) | 2015-01-13 | 2015-01-13 | Preparation method and application of K562 cell strain for stably expressing human cytomegalovirus pp65 protein in nucleus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104630273A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108977498A (en) * | 2018-06-19 | 2018-12-11 | 潍坊医学院 | A kind of the Inhibiting enzyme activity measuring method and application of aminopeptidase N inhibitor |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060233356A1 (en) * | 2004-12-15 | 2006-10-19 | Lin Lu | Stack-up configuration for a wireless communication device |
-
2015
- 2015-01-13 CN CN201510016175.6A patent/CN104630273A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060233356A1 (en) * | 2004-12-15 | 2006-10-19 | Lin Lu | Stack-up configuration for a wireless communication device |
Non-Patent Citations (3)
| Title |
|---|
| BODO PLACHTER ET AL: "Nuclear Targeting of the Tegument Protein pp65 (UL83) of Human Cytomegalovirus: an Unusual Bipartite Nuclear Localization Signal Functions with Other Portions of the Protein To Mediate Its Efficient Nuclear Transport", 《JOURNAL OF VIROLOGY》 * |
| PIERRE S，ET AL: "Use of a lentiviral vector encoding a HCMV-Chimeric IE1-pp65 protein for epitope identification in HLA-Transgenic mice and for ex vivo stimulation and expansion of CD8+ cytotoxic T cells from human peripheral blood cells", 《HUMAN IMMUNOLOGY》 * |
| 张文卿等: "HCMV pp150表达及E1-pp65慢病毒载体刺激T细胞免疫应答的研究", 《中国博士学位论文全文数据库》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108977498A (en) * | 2018-06-19 | 2018-12-11 | 潍坊医学院 | A kind of the Inhibiting enzyme activity measuring method and application of aminopeptidase N inhibitor |
| CN108977498B (en) * | 2018-06-19 | 2022-09-20 | 潍坊医学院 | Method for determining enzyme inhibition activity of aminopeptidase N inhibitor and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103555746B (en) | Recombinant porcine circovirus type 2 virus-like particle, and preparation method and application thereof | |
| CN104450620B (en) | A kind of replied immortalized hepatocyte strain carrying double independent variable and its construction method | |
| CN102153656B (en) | Vaccine for chimeric virus-like particles and preparation method thereof | |
| WO2019228108A1 (en) | Reagent composition used for increasing cell transfection efficiency | |
| JP2022535039A (en) | RECOMBINANT ONCOLYTIC VIRUSES AND THEIR PREPARATION, USE AND MEDICINES | |
| Shapiro et al. | Infection of normal human epithelial cells by Epstein-Barr virus | |
| WO2016086576A1 (en) | Vector expressing poliomyelitis virus-like granule protein and method for preparing poliomyelitis virus-like granules | |
| CN108753726A (en) | A kind of excretion body and its preparation method and application containing ECRG4 mRNA | |
| US20150259387A1 (en) | Production of a hcmv based vaccine in human amniocyte cell lines | |
| CN109207429A (en) | α -1,3- galactosyl transferase gene knock-out pig hepatic cell line of immortalization and its preparation method and application | |
| CN104630273A (en) | Preparation method and application of K562 cell strain for stably expressing human cytomegalovirus pp65 protein in nucleus | |
| US20220267713A1 (en) | Method for producing virus and harvest liquid composition | |
| CN105039411A (en) | Attached type lentiviral vector as well as preparation method and application thereof | |
| CN102552897A (en) | Prophylactic VLP (Virus-like Particle) vaccine for cervical carcinoma | |
| Kimura | Establishment of new cell lines from leafhopper vector and inoculation of its cell monolayers with rice dwarf virus | |
| CN113248577B (en) | Coronavirus vaccine using adenovirus as carrier and its preparing method | |
| CN114672460B (en) | Preparation method and application of CD 44-targeted heterogeneous CIC cell model | |
| CN107488677A (en) | One plant of vaccinia virus recombinant for carrying the latent gene of membranous antigen 2 of Epstein-Barr virus and its application | |
| CN112048477B (en) | Method for establishing EBV virus infection artificial respiratory tract epithelial model | |
| CN113896773A (en) | Recombinant FCV antigen and feline calicivirus genetic engineering subunit vaccine | |
| CN108373997B (en) | pMKRN1 gene knockout pig somatic cell and preparation method and application thereof | |
| CN112980801A (en) | Preparation method of NAMPT gene modified mesenchymal stem cell exosome | |
| CN104634976A (en) | Human cytomegalovirus active infection rapid detection method and reagent kit for detection method | |
| CN112079905A (en) | Avian influenza virus-like particle antigen, vaccine, preparation method and application thereof | |
| CN116410991B (en) | Recombinant nucleic acid molecules, recombinant vectors and recombinant viruses of vesicular stomatitis virus and novel coronavirus and application of recombinant nucleic acid molecules, recombinant vectors and recombinant viruses |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20161228 Address after: Hefei City, Anhui province 230022 Wangjiang Road, No. 800 Hefei Innovation Industrial Park building D9 Applicant after: Will Europe Han Biotechnology (Hefei) Co., Ltd. Address before: 230032 Medical University Of Anhui, Hefei, Anhui No. 81 Applicant before: Wang Mingli Applicant before: ANHUI BORUI BIOLOGICAL TECHNOLOGY CO., LTD. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20150520 |