CN104611452B - Identification or the primer set of auxiliary identification banana blight bacteria - Google Patents
Identification or the primer set of auxiliary identification banana blight bacteria Download PDFInfo
- Publication number
- CN104611452B CN104611452B CN201510084410.3A CN201510084410A CN104611452B CN 104611452 B CN104611452 B CN 104611452B CN 201510084410 A CN201510084410 A CN 201510084410A CN 104611452 B CN104611452 B CN 104611452B
- Authority
- CN
- China
- Prior art keywords
- pcr primer
- fusarium oxysporum
- specialized form
- identification
- banana blight
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses the primer set of identification or auxiliary identification banana blight bacteria.Identification provided by the present invention or the primer set of auxiliary identification banana blight bacteria, by entitled A PCR primer to the PCR primer of entitled B to forming；Two single stranded DNAs shown in SEQ ID No.1 in sequence table and SEQ ID No.2 for the described A form；Two single stranded DNAs shown in SEQ ID No.3 in sequence table and SEQ ID No.4 for the described B form.It is demonstrated experimentally that the primer set of the identification of the present invention or auxiliary identification banana blight bacteria can specifically identify Fusarium oxysporum Cuba specialized form and No. 4 biological strains of Fusarium oxysporum Cuba specialized form in banana blight bacteria.
Description
Technical field
The present invention relates to identifying or assist the primer set of identification banana blight bacteria in biological technical field.
Background technology
Fusarium oxysporum (Fusarium oxysporum) is a kind of universal soil-borne disease fungal pathogenses, host range
Extensively, the generation of the 100 various plants droops such as melon, Solanaceae, Fructus Musae, cotton, pulse family and flowers can be caused.Although sharp spore reaping hook
Bacterium has extensive host range on the whole, but single bacterial strain is only capable of infecting one kind or a few floristics.In difference
Host upper be divided into different physiological specialization types again, the physiological specialization type of report has kind more than 150 at present, some specialized form foundations
Different biological strains are further divided into the specificity of different cultivars, most of specialized forms comprise 2 or more give birth to
Reason microspecies, and sub-fraction is monotype.Certain physiological specialization type may cause disease on specific floristics, but is belonging to it
The bacterial strain of his specialized form may be harmless or even favourable to it to same this specified plant species.
Banana blight, also known as research of fusarium wilt disesase of banana, Panama disease, yellowtop, is special by Fusarium oxysporum Cuba
What change type (Fusarium oxyporum f.sp.Cubense, Foc) caused destroys plant vascular bundle and leads to plant death
A kind of destructive disease, at present, in addition to Mediterranean, the Indian Ocean, some island countries of the South Pacific Ocean, nearly all banana plantation
All have and reported by this disease hazard.According to Fusarium oxysporum Cuba specialized form (Foc) spy is infected to different cultivars Fructus Musae
The opposite sex is divided into 4 biological strains (race)：Wherein No. 1 biological strain (Foc1) infects " honey is breathed out greatly " [Gros michel
(AAA)], Silk (AAB), Taiwan Latundan (AAB), IC2 (AAAA) and dwarf banana (ABB)；No. 2 biological strains (Foc2)
The correlation only infecting Triploid induction Bluggoe and ABB genotype is cooked any of several broadleaf plants class；No. 3 biological strains are infected and wild take off tail any of several broadleaf plants and belong to
(Heliconia spp.) rather than Fructus Musae class, thus it is divided into Foc；No. 4 biological strains (Foc4) are then infected all of
Cavendish class Fructus Musae (AAA) and other to No. 1 any of several broadleaf plants class sensitive with No. 2 biological strains.Whether can be in tropical ring based on Foc4
Under the conditions of border, Cavendish class Fructus Musae is caused a disease, and Foc4 is further divided into " the Fusarium oxysporum Cuba specialized form torrid zone 4
Number biological strain " (TR4) and " Fusarium oxysporum Cuba specialized form subtropical zones 4 biological strain " (ST4), Fusarium oxysporum Cuba
Biological strain only infects Cavendish class Fructus Musae under the conditions of subtropical zones in specialized form subtropical zones 4.China Guangdong, Guangxi, good fortune
Build, Hainan, the main banana plantation such as Yunnan and Taiwan also all have been found that banana blight, and the morbidity of banana blight increases
Trend is obvious.It is badly in need of the method whether a set of Rapid identification Fructus Musae infects banana blight bacteria at present, fragrant for producing safety and Health
Any of several broadleaf plants seedling escorts.
Content of the invention
The technical problem to be solved is how to identify that the Fusarium oxysporum Cuba in banana blight bacteria specially changes
Type and/or No. 4 biological strains of Fusarium oxysporum Cuba specialized form.
For solving above-mentioned technical problem, the invention provides the primer set of identification or auxiliary identification banana blight bacteria,
Its entitled primer set first.
Primer set first provided by the present invention, by entitled A PCR primer to the PCR primer with entitled B to group
Become；
Two single stranded DNAs shown in SEQ ID No.1 in sequence table and SEQ ID No.2 for the described A form；Described B by
Two single stranded DNA compositions shown in SEQ ID No.3 and SEQ ID No.4 in sequence table.
Another technical problem to be solved by this invention is how to identify that the Fusarium oxysporum in banana blight bacteria is ancient
Bar specialized form.
For solving above-mentioned technical problem, the invention provides the PCR primer pair of identification or auxiliary identification banana blight bacteria.
Identification provided by the present invention or the PCR primer pair of auxiliary identification banana blight bacteria, are described B.
Another technical problem to be solved by this invention is how to identify that the Fusarium oxysporum in banana blight bacteria is ancient
No. 4 biological strains of bar specialized form.
For solving above-mentioned technical problem, the invention provides the PCR primer pair of identification or auxiliary identification banana blight bacteria.
Identification provided by the present invention or the PCR primer pair of auxiliary identification banana blight bacteria, are described A.
For solving above-mentioned technical problem, present invention also offers the system of identification or auxiliary identification banana blight bacteria.
Provided by the present invention identify or assist any one that the system identifying banana blight bacteria is in following Ll-Nn：
Ll, the system containing described primer set first；
Mm, the system containing described B；
Nn, the system containing described A.
Above-mentioned identification or the system of auxiliary identification banana blight bacteria, it may include identify or assist identification Fructus Musae by PCR
Reagent needed for wilt and instrument.Specifically, described in the system of identification or auxiliary identification banana blight bacteria may include
Other reagent required for primer set first, described B or described A and PCR and instrument.
Above-mentioned identification or auxiliary identification banana blight bacteria system also can only include described primer set first, described B or
Described A.
Each primer pair in described primer set first and the other reagent required for PCR all can independent packagings.Described B with
And the other reagent required for PCR all can independent packaging.Other reagent required for described A and PCR all can independent packaging.
Other reagent required for PCR may include archaeal dna polymerase (DNA Polymerase) and/or 10 × PCR buffer
And/or dNTPs.Instrument required for PCR can be PCR instrument.
For solving above-mentioned technical problem, present invention also offers the method for identification or auxiliary identification banana blight bacteria.
Identification provided by the present invention or the method for auxiliary identification banana blight bacteria, are following L1) or L2)：
L1) following L11) and L12)：
L11) with the nucleic acid of biological sample to be measured (DNA or RNA or the cDNA being obtained for template transcription with RNA) as template,
Enter performing PCR amplification with described A and obtain PCR primer A1；Obtain with the RNA of described biological sample to be measured or with RNA for template transcription
CDNA be template, with described B enter performing PCR amplification obtain PCR primer B1；
L12) detect L11) size of described PCR primer A1 and described PCR primer B1, if contained in described PCR primer B1
There are the DNA fragmentation (i.e. the DNA fragmentation of 699bp) of 500bp-750bp, the DNA containing 500bp-750bp in described PCR primer A1
Fragment (i.e. the DNA fragmentation of 699bp), described testing sample contains or candidate contains No. 4 physiology of Fusarium oxysporum Cuba specialized form
Microspecies；If the DNA fragmentation containing 500bp-750bp (i.e. the DNA fragmentation of 699bp) in described PCR primer B1, described PCR produces
The DNA fragmentation (not containing the DNA fragmentation of 699bp) of 500bp-750bp is not contained, described testing sample contains or candidate contains in thing A1
There is Fusarium oxysporum Cuba specialized form, described Fusarium oxysporum Cuba specialized form is not No. 4 lifes of Fusarium oxysporum Cuba specialized form
Reason microspecies；If not containing the DNA fragmentation (not containing the DNA fragmentation of 699bp) of 500bp-750bp in described PCR primer B1, described
Testing sample does not contain or candidate does not contain Fusarium oxysporum Cuba specialized form；
L2) following L21) and L22)：
L21) with the nucleic acid of biological sample to be measured (DNA or RNA or the cDNA being obtained for template transcription with RNA) as template,
Enter performing PCR amplification with described A and obtain PCR primer A2；With the DNA of described biological sample to be measured as template, enter performing PCR with described B
Amplification obtains PCR primer B2；
L22) detect L21) size of described PCR primer A2 and described PCR primer B2, if contained in described PCR primer B2
There are the DNA fragmentation (i.e. the DNA fragmentation of 730bp) of 500bp-750bp, the DNA containing 500bp-750bp in described PCR primer A2
Fragment (i.e. the DNA fragmentation of 699bp), described testing sample contains or candidate contains No. 4 physiology of Fusarium oxysporum Cuba specialized form
Microspecies；If the DNA fragmentation containing 500bp-750bp (i.e. the DNA fragmentation of 730bp) in described PCR primer B2, described PCR produces
The DNA fragmentation (not containing the DNA fragmentation of 699bp) of 500bp-750bp is not contained, described testing sample contains or candidate contains in thing A2
There is Fusarium oxysporum Cuba specialized form, described Fusarium oxysporum Cuba specialized form is not No. 4 lifes of Fusarium oxysporum Cuba specialized form
Reason microspecies；If not containing the DNA fragmentation (not containing the DNA fragmentation of 730bp) of 500bp-750bp in described PCR primer B2, described
Testing sample does not contain or candidate does not contain Fusarium oxysporum Cuba specialized form.
In said method, described banana blight bacteria can be Fusarium oxysporum Cuba specialized form and/or Fusarium oxysporum is ancient
No. 4 biological strains of bar specialized form.
In said method, entering annealing temperature during performing PCR amplification with described B can be 54 DEG C.Enter performing PCR amplification with described A
When annealing temperature can be 56 DEG C.
For solving above-mentioned technical problem, present invention also offers the method for identification or auxiliary identification banana blight bacteria.
Identification provided by the present invention or the method for auxiliary identification banana blight bacteria, are following M or N：
The following M1 of M) or M2)：
M1) following M11) and M12)：
M11) transcribe the cDNA obtaining as template with the RNA of biological sample to be measured or with RNA for template, carried out with described B
PCR amplification obtains PCR primer B1；
M12) detect M11) described PCR primer B1 size, if containing 500bp-750bp's in described PCR primer B1
DNA fragmentation (i.e. the DNA fragmentation of 699bp), described testing sample contains or candidate contains Fusarium oxysporum Cuba specialized form；If
The DNA fragmentation (not containing the DNA fragmentation of 699bp) of 500bp-750bp is not contained, described testing sample is not in described PCR primer B1
Contain or candidate does not contain Fusarium oxysporum Cuba specialized form；
M2) following M21) and M22)：
M21) with the DNA of biological sample to be measured as template, enter performing PCR amplification with described B and obtain PCR primer B2；
M22) detect M21) described PCR primer B2 size, if containing 500bp-750bp's in described PCR primer B2
DNA fragmentation (i.e. the DNA fragmentation of 730bp), described testing sample contains or candidate contains Fusarium oxysporum Cuba specialized form；If
The DNA fragmentation (not containing the DNA fragmentation of 730bp) of 500bp-750bp is not contained, described testing sample is not in described PCR primer B2
Contain or candidate does not contain Fusarium oxysporum Cuba specialized form；
The following N1 of N) and N2)：
N1) with the nucleic acid of biological sample to be measured (DNA or RNA or the cDNA being obtained for template transcription with RNA) as template, use
Described A enters performing PCR amplification and obtains PCR primer A1；
N2) detect N1) described PCR primer A1 size, if the DNA containing 500bp-750bp in described PCR primer A1
Fragment (i.e. the DNA fragmentation of 699bp), described testing sample contains or candidate contains No. 4 physiology of Fusarium oxysporum Cuba specialized form
Microspecies；If not containing the DNA fragmentation DNA fragmentation of 699bp (do not contain) of 500bp-750bp in described PCR primer A1, described treat
Test sample product do not contain or candidate does not contain No. 4 biological strains of Fusarium oxysporum Cuba specialized form.
In said method, described banana blight bacteria can be Fusarium oxysporum Cuba specialized form and/or Fusarium oxysporum is ancient
No. 4 biological strains of bar specialized form.
In said method, entering annealing temperature during performing PCR amplification with described B can be 54 DEG C.Enter performing PCR amplification with described A
When annealing temperature can be 56 DEG C.
For solving above-mentioned technical problem, present invention also offers described primer set or described B or described A or described
The application in identification banana blight bacteria of system or methods described；
Described banana blight bacteria is Fusarium oxysporum Cuba specialized form and/or Fusarium oxysporum Cuba specialized form subtropical zones
No. 4 biological strains.
Above, with the reaction system that described B enters performing PCR amplification can be：Taq DNA polymerase(5U/μL)0.2μ
L, 10 × PCR buffer 2.5 μ L, the dNTPs 2 μ L containing each 2.5mM of dATP, dTTP, dCTP and dGTP, DNA or RNA or
The cDNA 1 μ L being obtained for template transcription with RNA, the single stranded DNA shown in SEQ ID No.3, single-stranded shown in SEQ ID No.4
DNA, adds water and complements to 25 μ L.Single stranded DNA shown in SEQ ID No.3 described in described reaction system and described SEQ ID
The concentration of the single stranded DNA shown in No.4 is 0.4 μm of ol/L.The response procedures of described PCR amplification are as follows：94℃5min；94℃
30s, 54 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72℃10min.
Above, with the reaction system that described A enters performing PCR amplification can be：Taq DNA polymerase(5U/μL)0.2μ
L, 10 × PCR buffer 2.5 μ L, the dNTPs 2 μ L containing each 2.5mM of dATP, dTTP, dCTP and dGTP, DNA or RNA or
The cDNA 1 μ L being obtained for template transcription with RNA, the single stranded DNA shown in SEQ ID No.1, single-stranded shown in SEQ ID No.2
DNA, adds water and complements to 25 μ L.Single stranded DNA shown in SEQ ID No.1 described in described reaction system and described SEQ ID
The concentration of the single stranded DNA shown in No.2 is 0.4 μm of ol/L.The response procedures of described PCR amplification are as follows：94℃5min；94℃
30s, 56 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72℃10min.
For solving above-mentioned technical problem, present invention also offers the preparation method of described primer set first.
The preparation method of described primer set first provided by the present invention, methods described is included in described primer set first
The step that two single stranded DNAs of each primer pair are individually packed.
For solving above-mentioned technical problem, present invention also offers the preparation method of described PCR primer pair.
The preparation method of described PCR primer pair provided by the present invention, methods described is included the two of described B or described C
The step that bar single stranded DNA is individually packed.
In the present invention, two single stranded DNAs in every kind of primer pair of described B and described A all can independent packaging.
In the present invention, when the described B and described A of described primer set first are used together, the mol ratio of described B and described A
Can be 1:1.
In the present invention, the mol ratio of two single stranded DNAs in every kind of primer pair can be all 1：1.
In the present invention, described DNA Polymerase can be Taq DNA Polymerase.Described Taq DNA
Polymerase concretely precious biological engineering (Dalian) company limited product, article No. is DR001A.Described 10 × PCR
Buffer concretely precious biological engineering (Dalian) company limited product, article No. is DR001A.Described dNTPs is concretely precious raw
Thing engineering (Dalian) company limited product, article No. is DR001A.
It is demonstrated experimentally that B and A in the primer set first of the identification of the present invention or auxiliary identification banana blight bacteria is all permissible
Specifically identify purpose bacterial strain, sensitivity is high：Fusarium oxysporum Cuba in the identification banana blight bacteria of the present invention specially changes
The PCR primer of type can specifically amplify in the nucleic acid of the Fusarium oxysporum Cuba specialized form from banana blight bacteria to B
Purpose band, sensitivity is up to 5pg/25 μ L；Fusarium oxysporum Cuba specialized form 4 in the identification banana blight bacteria of the present invention
The PCR primer of number biological strain can specifically from banana blight bacteria to A No. 4 physiology of Fusarium oxysporum Cuba specialized form
Purpose band is amplified, sensitivity is up to 50fg/25 μ L in the nucleic acid of microspecies.
It is demonstrated experimentally that the primer set first of the identification of the present invention or auxiliary identification banana blight bacteria can specifically be identified
Fusarium oxysporum Cuba specialized form in banana blight bacteria and No. 4 biological strains of Fusarium oxysporum Cuba specialized form；The present invention
Identification banana blight bacteria in Fusarium oxysporum Cuba specialized form PCR primer B can specifically be identified Fructus Musae wither
Fusarium oxysporum Cuba specialized form in pathogenic bacteria；Fusarium oxysporum Cuba specialized form in the identification banana blight bacteria of the present invention
The PCR primer of No. 4 biological strains can specifically identify the Fusarium oxysporum Cuba specialized form 4 in banana blight bacteria to A
Biological strain.During the primer set identification banana blight bacteria of the identification of the present invention or auxiliary identification banana blight bacteria, template
Do not limited by originating, template used for test strains nucleic acid be alternatively plant tissue nucleic acid.
Brief description
Fig. 1 is the PCR testing result of the STb gene using primer pair ITS1 and ITS4 to each bacterial strain.
Fig. 2 is the PCR testing result of the STb gene to B to each bacterial strain using PCR primer.
Fig. 3 is the PCR testing result of the cDNA to B to part bacterial strain using PCR primer.Wherein, swimming lane M is DL2000
marker；The strain name of different swimming lanes is as follows：1 is B2；2 is TR4；3 is STR4；4 is N2；5 is negative control.
Fig. 4 is the PCR testing result of the STb gene to A to each bacterial strain using PCR primer.Wherein, A and B is respectively and utilizes
The PCR testing result of PCR primer STb gene to part bacterial strain to A.In figure A, swimming lane M is DL2000 marker；Different swimming lanes
Strain name as follows：1：BW4；2：TR4；3：STR4；4：3#①；5：3#②；6：5#①；7：5#②；8：6#①；9：6#②；
10：7#①；11：7#②；12：9#①；13：9#②；14：34#①；15：34#②；16：36#①；17：36#②；18：37#①；
19：37#②；20：QWXZ b-2；21：NXXZ；22：NBXZ a；23：DTXZ-1a-1；24：DTXZ-2 ties up a；25：DTXZ-3 ties up；
26：LDXZ a；27：LGXD-5 ties up；28：LGXD-6 ties up；29：ZJXD；30：ZJB1b1；31：ZJB2b2；32：XNB2a；33：
XNB5a；34：XNB6a；35：XSBN；36：HH；37：HZ；38：ZJ；39：NX-27；40：PB3-15；41：N2；42：11#②；
43：40#①；44：40#②；45：42#①；46：BXFZ-1b-1；47：BXFZ-2a-2；48：FOC1；49：Foc1e2；50：
Race1；51：BW1；52：Race2；53：Race3；54：Fom；55：Fob；56：Fou；57：Foh；58：Foe；59：FOL；60：
oxy-2；61：oxy-3；62：oxy-4；63：FGL-01；64：FGL-12-48；65：FGL-13-1；66：FGL-13-8；67：
FCH-12-9；68：22；69：75；70：624；71：Fon1；72：H2O.In figure B, swimming lane M is DL2000 marker；Different swimming
The strain name in road is as follows：1：B2；2：N2；3：AB-2-8；4：AB-11-5-2；5：FJAT-9241；6：FJAT-9245；7：
FJAT-3752；8：FJAT-3756；9：XJLJ4；10：FJAT-772；11：CH0001；12：CH0099；13：SX-02；14：XF-
08；15：Pn006；16：CH001；17：b；18：HC-1；19：HC-2；20：HBHN01；21：1；22：Tail 1；23：MYD3；24：
H2O.
Fig. 5 is the PCR testing result of the cDNA to A to part bacterial strain using PCR primer.Wherein, swimming lane M is DL2000
marker；Swimming lane 1 is B2；Swimming lane 2 is B2R1；Swimming lane 3 is B2gfp；Swimming lane 4 is N2；Swimming lane 5 is negative control.
Fig. 6 is the PCR testing result of the STb gene to C to each bacterial strain using PCR primer.
Fig. 7 is the PCR testing result of the cDNA to C to part bacterial strain using PCR primer.Wherein, swimming lane M is DL2000
marker；The strain name of different swimming lanes is as follows：1 is B2；2 is TR4；3 is STR4；4 is N2；5 is negative control.
Fig. 8 is the PCR testing result to B and C to plant tissue STb gene using PCR primer.Wherein, swimming lane M is DL2000
marker；The title of the bacterial strain of different swimming lanes or plant tissue is as follows：1：STR4；2：B2；3：N2；4：The Brazilian any of several broadleaf plants of infection STR4
Bulb；5：The Brazilian any of several broadleaf plants bulb of infection B2；6：The dwarf banana bulb of infection N2；7：It is uninfected by health Brazil any of several broadleaf plants ball of any bacterial strain
Stem；8：It is uninfected by the healthy dwarf banana bulb of any bacterial strain；9：Negative control.
In Fig. 1, Fig. 2 and Fig. 6, swimming lane M is DL2000 marker；The strain name of different swimming lanes is as follows：1 is B2；2 are
B2R1；3 is B2gfp；4 is BW4；5 is TR4；6 is STR4；7 for 3# 1.；8 for 3# 2.；9 for 5# 1.；10 for 5# 2.；11 is 6#
①；12 for 6# 2.；13 for 7# 1.；14 for 7# 2.；15 for 9# 1.；16 for 9# 2.；17 for 34# 1.；18 for 34# 2.；19 is 36#
①；20 for 36# 2.；21 for 37# 1.；22 for 37# 2.；23 is QWXZ b-2；24 is NXXZ；25 is NBXZ a；26 is DTXZ-
1a-1；27 tie up a for DTXZ-2；28 is DTXZ-3 dimension；29 is LDXZ a；30 is LGXD-5 dimension；31 is LGXD-6 dimension；32 are
ZJXD；33 is ZJB1b1；34 is ZJB2b2；35 is XNB2a；36 is XNB5a；37 is XNB6a；38 is XSBN；39 is HH；40 are
HZ；41 is ZJ；42 is NX-27；43 is PB3-15；44 for 11# 2.；45 for 40# 1.；46 for 40# 2.；47 for 42# 1.；48 are
N2；49 is BXFZ-1b-1；50 is BXFZ-2a-2；51 is FOC1；52 is Foc1e2；53 is Race1；54 is BW1；55 are
Race2；56 is Race3；57 is Fom；58 is Fob；59 is Fou；60 is Foh；61 is Foe；62 is FOL；63 is oxy-2；64
For oxy-3；65 is oxy-4；66 is FGL-01；67 is FGL-12-48；68 is FGL-13-1；69 is FGL-13-8；70 is FCH-
12-9；71 is 22；72 is 75；73 is 624；74 is Fon1；75 is AB-11-5-2；76 is AB-2-8；77 is FJAT-9241；78
For FJAT-9245；79 is FJAT-3752；80 is FJAT-3756；81 is XJLJ4；82 is FJAT-772；83 is CH0001；84
For CH0099；85 is SX-02；86 is XF-08；87 is Pn006；88 is CH001；89 is b；90 is HC-1；91 is HC-2；92 are
HBHN01；93 is 1；94 is tail 1；95 is MYD3；96 is negative control.
Fig. 9 is that the PCR primer of the Fusarium oxysporum Cuba specialized form in identification banana blight bacteria is identified to the sensitivity of B
Result.
Figure 10 is the PCR primer of Fusarium oxysporum Cuba No. 4 biological strains of specialized form in identification banana blight bacteria to A
Sensitivity qualification result.
Figure 11 is the PCR of No. 4 biological strains in Fusarium oxysporum Cuba specialized form subtropical zones in identification banana blight bacteria
The sensitivity qualification result of primer pair C.
In Fig. 9-Figure 11, swimming lane M is DL2000 marker, and swimming lane 1 is 50ng/25 μ L reaction system, and swimming lane 2 is 5ng/
25 μ L reaction systems, swimming lane 3 is 500pg/25 μ L reaction system, and swimming lane 4 is 50pg/25 μ L reaction system, and swimming lane 5 is 5pg/25
μ L reaction system, swimming lane 6 is 500fg/25 μ L reaction system, and swimming lane 7 is 50fg/25 μ L reaction system, and swimming lane 8 is 5fg/25 μ L
Reaction system, swimming lane 9 is negative control.
Specific embodiment
With reference to specific embodiment, the present invention is further described in detail, the embodiment being given is only for explaining
The bright present invention, rather than in order to limit the scope of the present invention.Experimental technique in following embodiments, if no special instructions, is
Conventional method.Material used, reagent etc. in following embodiments, if no special instructions, all commercially obtain.
Taq DNA Polymerase in following embodiments is precious biological engineering (Dalian) company limited product, and article No. is
DR001A；10 × PCR buffer is precious biological engineering (Dalian) company limited product, and article No. is DR001A；DNTPs is precious raw
Thing engineering (Dalian) company limited product, article No. is DR001A.
Bacterial strain in following embodiments as shown in table 1, table 2 and table 3, the public can from Chinese Academy of Tropical Agricultural Sciences's environment with
Plant Protection Institute obtain, these biomaterials only attach most importance to duplicate invention related experiment used by, can not be used as other purposes
Use.
Wherein, B2, N2,3# 2., 5# 1., 6# 2., 11# 2., 36# 1., 40# 1., ZJXD, STR4, TR4 and Race1 record
Document (Yang Laying, Guo Lijia, Mao Chao, Liu Lei, Wang Feiyan, Xie Yuping, Huang Junsheng. using Fructus Musae water planting system measurement wither
Sick pathogen pathogenicity .2014,44 (6):In 671-678.)；
XSBN, HH, HZ, ZJ, FOC1 and FOL be documented in document (Tang Qi, Ji Chunyan, Li Yunfeng, Wang Zhenzhong. different regions
Banana wilt germina number-four biological strain biological characteristicses and ITS sequence analysis. guangdong agricultural science, 2012,01:In 1-5.)；
Fom, Fob, Fou, Foh and Foe are documented in document (the many polygalacturonics of Li Jianxiang, Wang Zhenzhong .5 kind mellon plant
The abduction delivering of sour enzyme level albumen and determination of activity. guangdong agricultural science, 2013,1:In 143-146.)；
BW1, BW4, Race2, Race3, AB-11-5-2 and AB-2-8 are documented in document, and (Lu is suitable, Zeng Lisha, Liu Wenqing, king
Virtue, Zhao Zhihui, Zhou Jiankun, Li Hongbo, Du Caixian, Chen Shi, Han Xiuxiang, Xiang Xinye. the identification of plantain Pathogen of Fusarium Wilt and TEF-1
α sequence analysis. Plant Pathology, 2014,04:In 337-348.)；
1 be documented in document (Xie Yixian, Zhang Xin, model swan goose, Huang Yanlan, Yang Laying. Hainan banana sigatoka leaf spot disease opportunistic pathogen
Foranalysis of nucleic acids is identified. tropical crops journal, 2004,02:24-27.) in；
HC-1 and HC-2 be documented in document (Cai Jimiao, Chen Yao, Pan Xianxin, Huang Guixiu. hainan rubber tree rod the mould defoliation of spore
Disease investigation and Pathogen identification. tropical agricultural science, 2008,05:In 1-7+10.)；
HBHN01 is documented in document, and (Huang Gui repaiies .9 kind hot-zone and plants for Liu Xianbao, Gao Honghua, Cai Jimiao, Zhang Xinchun, woods spring flower
The rDNA-ITS sequence of thing Powdery Mildew and Phylogenetic Analysis. tropical crops journal, 2013,01:98-104.) in；
B be documented in document (Zheng Xiaolan, Liang Yanqiong, Wu Weihuai, Li Rui, Lin Weixiong, He Chunping. the genetic diversity of anthrax
Property preliminary analyses. Chinese Plants pathology meeting. Chinese Plants pathology can Annual Conference collection of thesis in 2012. Chinese Plants pathology
Association:2012:9. in)；
CH001 be documented in document (historiography group, Song Haichao, Zhang Xin, Yi Kexian. Hainan and Guangdong and Guangxi Provinces area khuskhuss anthrax
The RAPD analysis of genetic polymorphism. BULLETIN OF BOTANY Vol., 2007,2:In 173-180.)；
SX-02 and XF-08 is documented in document (Liu Qiaolian, Zhu Jun, Zheng Jinlong, Chen Helong, Gao Jianming, Zhang Shiqing, Yi Ke
Virtuous. the research of 6 Pathogen Biologic Characteristic of Folium Agaves Sisalanae stem rot. China's fiber crops industry science, 2014,01:23-27+32.) in；
CH0001 and CH0099 be documented in document (Zheng Jinlong, Liu Qiaolian, Chen Hong, Huang Guixiu, Yi Kexian. Folium Agaves Sisalanae zebra-stripe
Sick Pathogen Biologic Characteristic preliminary study. tropical agricultural science, 2008,06:15-18.) in；
Pn006 is documented in document (He Chunping, Li Rui, Wu Weihuai, Zheng Xiaolan, Wuchuan grain husk, beam gorgeous fine jade .12 kind antibacterial pair
The toxicity test of rubber tree brown root pathogenic bacteria. tropical crops journal, 2013,10:1987-1990.) in；
FJAT-9241, FJAT-9245, FJAT-3752 and FJAT-3756 are documented in document (Yang Yingying, Liu Bo, Xiao Rong
Phoenix, Zhu Yujing. Fructus Lycopersici esculenti, Fructus Solani melongenae and Fusarium oxysporum Molecular Identification and its Pathogenicity. tropical crops journal, 2012,
05:In 906-912.)；
Fon1 be documented in document (Zeng Fanyun, Pei Yueling, Peng Jun, Longhai City's ripple, Guo Jianrong. withered germ of water-melon T-DNA insert
The structure in body storehouse and the screening of phenotype abnormal sudden change body. Chinese Plants protection association. in " innovation drives and modern plant protection "
Plant protection association of state the tenth once national member representative assembly and Annual Conference collection of thesis in 2013. Chinese Plants protection is learned
Meeting, 2013:1. in)；
FGL-01 be documented in document (Zhang Jixiang. 1, No. 2 biological strain specific genes of cabbage oxysporum identification and applying.
The Chinese Academy of Agricultural Sciences, plant protection, 2014, master's thesis .) in.
Table 1, strains tested details table (1)
Table 2, strains tested details table (2)
Table 3, strains tested details table (3)
The preparation of the primer of embodiment 1, identification or auxiliary identification banana blight bacteria
The PCR primer pair of the Fusarium oxysporum Cuba specialized form in identification banana blight bacteria, its entitled B, can be from perfume (or spice)
The DNA fragmentation that size is 730bp is amplified in the DNA of Fusarium oxysporum Cuba specialized form in any of several broadleaf plants wilt, can be from Fructus Musae
Size is amplified in the RNA of Fusarium oxysporum Cuba specialized form in the wilt or cDNA that obtains for template transcription with RNA
DNA fragmentation for 699bp；Two single stranded DNA groups shown in SEQ ID No.3 in sequence table and SEQ ID No.4 for the described B
Become.
The PCR primer pair of Fusarium oxysporum Cuba No. 4 biological strains of specialized form in identification banana blight bacteria, its title
For A, can DNA or RNA of Fusarium oxysporum Cuba No. 4 biological strains of specialized form from banana blight bacteria or with RNA as mould
The DNA fragmentation that size is 699bp is amplified in the cDNA that plate transcription obtains；Described A is by SEQ ID No.1 and SEQ in sequence table
Shown in ID No.2 two single stranded DNA forms.
The PCR primer pair of No. 4 biological strains in Fusarium oxysporum Cuba specialized form subtropical zones in identification banana blight bacteria,
Its entitled C, can No. 4 biological strains in Fusarium oxysporum Cuba specialized form subtropical zones from banana blight bacteria DNA or RNA
Or amplify the DNA fragmentation as 663bp for the size in RNA for the template cDNA that obtains of transcription；Described C is by SEQ ID in sequence table
Two single stranded DNA compositions shown in No.5 and SEQ ID No.6.
The primer set 1 of identification or auxiliary identification banana blight bacteria is made up of A, B and C, and primer set 1 can be used to identify
Fusarium oxysporum Cuba specialized form in banana blight bacteria, No. 4 biological strains of Fusarium oxysporum Cuba specialized form and sharp spore sickle
Dao Jun Cuba specialized form subtropical zones 4 biological strain；The primer set 2 of identification or auxiliary identification banana blight bacteria is by A and C group
Become, primer set 2 can be used to identify No. 4 biological strains of Fusarium oxysporum Cuba specialized form in banana blight bacteria and sharp spore sickle
Dao Jun Cuba specialized form subtropical zones 4 biological strain；The primer set 3 of identification or auxiliary identification banana blight bacteria is by B and C group
Become, primer set 3 can be used to identify Fusarium oxysporum Cuba specialized form and Fusarium oxysporum Cuba specialized form subtropical zones 4 physiology
Microspecies；The primer set first of identification or auxiliary identification banana blight bacteria is made up of A and B, and primer set first can be used to identify perfume (or spice)
Fusarium oxysporum Cuba specialized form in any of several broadleaf plants wilt and No. 4 biological strains of Fusarium oxysporum Cuba specialized form.
The PCR primer of the Fusarium oxysporum Cuba specialized form in embodiment 2, the identification banana blight bacteria of embodiment 1 is to B
Specificity and sensitivity experiment
First, the preparation of template
According to document (Yang Laying, yellow Warburg Pincus, Tang Furun, etc. Plant Pathology .2006,36 (3)：219-225.)
Method extracts and obtains the STb gene of following each bacterial strains：
1：B2；2：B2R1；3：B2gfp；4：BW4；5：TR4；6：STR4；7：3#①；8：3#②；9：5#①；10：5#②；
11：6#①；12：6#②；13：7#①；14：7#②；15：9#①；16：9#②；17：34#①；18：34#②；19：36#①；
20：36#②；21：37#①；22：37#②；23：QWXZ b-2；24：NXXZ；25：NBXZ a；26：DTXZ-1a-1；27：
DTXZ-2 ties up a；28：DTXZ-3 ties up；29：LDXZ a；30：LGXD-5 ties up；31：LGXD-6 ties up；32：ZJXD；33：ZJB1b1；34：
ZJB2b2；35：XNB2a；36：XNB5a；37：XNB6a；38：XSBN；39：HH；40：HZ；41：ZJ；42：NX-27；43：PB3-
15；44：11#②；45：40#①；46：40#②；47：42#①；48：N2；49：BXFZ-1b-1；50：BXFZ-2a-2；51：
FOC1；52：Foc1e2；53：Race1；54：BW1；55：Race2；56：Race3；57：Fom；58：Fob；59：Fou；60：Foh；
61：Foe；62：FOL；63：oxy-2；64：oxy-3；65：oxy-4；66：FGL-01；67：FGL-12-48；68：FGL-13-1；
69：FGL-13-8；70：FCH-12-9；71：22；72：75；73：624；74：Fon1；75：AB-11-5-2；76：AB-2-8；77：
FJAT-9241；78：FJAT-9245；79：FJAT-3752；80：FJAT-3756；81：XJLJ4；82：FJAT-772；83：
CH0001；84：CH0099；85：SX-02；86：XF-08；87：Pn006；88：CH001；89：b；90：HC-1；91：HC-2；92：
HBHN01；93：1；94：Tail 1；95：MYD3.
The concentration adjusting above-mentioned STb gene, all to 20ng/ μ L, is placed in -20 DEG C of refrigerators and saves backup.Using primer pair
ITS1：TCCGTAGGTGAACCTGCGG (5 ' -3 ') and ITS4：TCCTCCGCTTATTGATATGC (5 ' -3 ') is to above-mentioned STb gene
Enter performing PCR detection (using sterilized water as negative control), result is shown and all can be amplified for template with the STb gene of above-mentioned each bacterial strain
The band of 546bp, shows that the STb gene of above-mentioned each bacterial strain all can carry out next step experiment (Fig. 1).
Extract and obtain the total serum IgE of following bacterial strains using guanidine isothiocyanate method：B2；B2R1；B2gfp；TR4；STR4；N2.
Using TaKaRa RNA PCR Kit and according in the description in test kit, above-mentioned total serum IgE is carried out reverse transcription, respectively obtain
B2 cDNA, B2 R1 cDNA, B2gfp cDNA, TR4 cDNA, STR4 cDNA and N2 cDNA.
2nd, the specificity experiments to B for the PCR primer of the Fusarium oxysporum Cuba specialized form in identification banana blight bacteria
The template being expanded for PCR with the cDNA of the STb gene of bacterial strain and bacterial strain respectively is withered to the identification Fructus Musae of embodiment 1 respectively
The PCR primer of the Fusarium oxysporum Cuba specialized form in pathogenic bacteria of withering carries out specificity identification to B, and experiment in triplicate, weighs every time
That tests again comprises the following steps that：
1st, the template being expanded for PCR with the STb gene of bacterial strain
With embodiment 1 identification banana blight bacteria in Fusarium oxysporum Cuba specialized form PCR primer to B to step
The STb gene of one each bacterial strain enters performing PCR amplification, and the reaction system of PCR amplification is：Taq DNA polymerase(5U/μL)
0.2 μ L, 10 × PCR buffer 2.5 μ L, the dNTPs 2 μ L containing each 2.5mM of dATP, dTTP, dCTP and dGTP, STb gene
(a kind of DNA in each reaction system) 1 μ L, the single stranded DNA shown in SEQ ID No.3, the single stranded DNA shown in SEQ ID No.4,
Add water and complement to 25 μ L.Using sterilized water as negative control, the single stranded DNA shown in SEQ ID No.3 and SEQ in reaction system
The concentration of the single stranded DNA shown in ID No.4 is 0.4 μm of ol/L.
The program of PCR amplification is as follows：94℃5min；94 DEG C of 30s, 54 DEG C of DEG C of 30s, 72 DEG C of 45s, 35 circulations；72℃
10min.
The PCR primer that PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in Figure 2.Result shows, in Fig. 2
The template of swimming lane 1-55 be the STb gene of Fusarium oxysporum Cuba specialized form, each swimming lane strain name is as follows：1 is B2；2 are
B2R1；3 is B2gfp；4 is BW4；5 is TR4；6 is STR4；7 for 3# 1.；8 for 3# 2.；9 for 5# 1.；10 for 5# 2.；11 is 6#
①；12 for 6# 2.；13 for 7# 1.；14 for 7# 2.；15 for 9# 1.；16 for 9# 2.；17 for 34# 1.；18 for 34# 2.；19 is 36#
①；20 for 36# 2.；21 for 37# 1.；22 for 37# 2.；23 is QWXZ b-2；24 is NXXZ；25 is NBXZ a；26 is DTXZ-
1a-1；27 tie up a for DTXZ-2；28 is DTXZ-3 dimension；29 is LDXZ a；30 is LGXD-5 dimension；31 is LGXD-6 dimension；32 are
ZJXD；33 is ZJB1b1；34 is ZJB2b2；35 is XNB2a；36 is XNB5a；37 is XNB6a；38 is XSBN；39 is HH；40 are
HZ；41 is ZJ；42 is NX-27；43 is PB3-15；44 for 11# 2.；45 for 40# 1.；46 for 40# 2.；47 for 42# 1.；48 are
N2；49 is BXFZ-1b-1；50 is BXFZ-2a-2；51 is FOC1；52 is Foc1e2；53 is Race1；54 is BW1；55 are
Race2, all has in swimming lane 1-55 that (sequencing result shows, these 500bp-750bp to band between 500bp-750bp for the size
The size of band be 730bp)；Other bacterial strains (swimming lane 56-95 in Fig. 2) of non-Fusarium oxysporum Cuba specialized form and feminine gender
Comparison (swimming lane 96 in Fig. 2) all expands less than any band.Result shows, the point in the identification banana blight bacteria of embodiment 1
The PCR primer of fusarium oxysporum Cuba specialized form is good to B specificity, does not have cross reaction with other bacterial strains, does not have non-specific miscellaneous
Band produces, and specifically can amplify size in the STb gene of Fusarium oxysporum Cuba specialized form from banana blight bacteria and be
The band of 730bp, this primer pair can be used to identify the Fusarium oxysporum Cuba specialized form in banana blight bacteria.
2nd, the template being expanded for PCR with the cDNA of bacterial strain
With embodiment 1 identification banana blight bacteria in Fusarium oxysporum Cuba specialized form PCR primer to B to step
One B2 cDNA, TR4 cDNA, STR4 cDNA and N2 cDNA enter performing PCR amplification, and the reaction system of PCR amplification is：Taq
DNA polymerase (5U/ μ L) 0.2 μ L, 10 × PCR buffer 2.5 μ L, each containing dATP, dTTP, dCTP and dGTP
The dNTPs 2 μ L of 2.5mM, cDNA (a kind of cDNA in each reaction system) 1 μ L, the single stranded DNA shown in SEQ ID No.3, SEQ
Single stranded DNA shown in ID No.4, adds water and complements to 25 μ L.Using sterilized water as negative control, SEQ ID in reaction system
The concentration of the single stranded DNA shown in No.3 and the single stranded DNA shown in SEQ ID No.4 is 0.4 μm of ol/L.
The program of PCR amplification is as follows：94℃5min；94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72℃
10min.
The PCR primer that PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in Figure 3.Result shows, B2 (swimming
Road 1), TR4 (swimming lane 2), STR4 (swimming lane 3) and N2 (swimming lane 4) all can expand band between 500bp-750bp for the size
(sequencing result shows, the size of the band of these 500bp-750bp is 699bp), no any in negative control (swimming lane 5)
Band.Result shows, the PCR primer of the Fusarium oxysporum Cuba specialized form in the identification banana blight bacteria of embodiment 1 is permissible to B
The band that size is 699bp is amplified in the cDNA of Fusarium oxysporum Cuba specialized form from banana blight bacteria.
3rd, the sensitivity experiments to B for the PCR primer of the Fusarium oxysporum Cuba specialized form in identification banana blight bacteria
Carry out gradient dilution with the STb gene of the BW4 bacterial strain to step one for the sterilized water, obtain concentration be respectively 50ng/ μ L,
5ng/ μ L, 500pg/ μ L, 50pg/ μ L, the BW4 STb gene solution of 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and 5fg/ μ L.
Respectively with concentration be 50ng/ μ L, 5ng/ μ L, 500pg/ μ L, 50pg/ μ L, 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and
Nucleic acid in the BW4 STb gene solution of 5fg/ μ L is template, with the Fusarium oxysporum in the identification banana blight bacteria of embodiment 1
The PCR primer of Cuba's specialized form enters performing PCR amplification to B, and PCR amplification, all using the reaction system of 25 μ L, will be 50ng/ to concentration
In μ L, 5ng/ μ L, 500pg/ μ L, 50pg/ μ L, the BW4 STb gene solution of 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and 5fg/ μ L
The reaction system that nucleic acid enters performing PCR amplification is respectively designated as 50ng/25 μ L reaction system, 5ng/25 μ L reaction system, 500pg/
25 μ L reaction systems, 50pg/25 μ L reaction system, 5pg/25 μ L reaction system, 500fg/25 μ L reaction system, 50fg/25 μ L
Reaction system and 5fg/25 μ L reaction system.
The compound method of 50ng/25 μ L reaction system is：Taq DNA polymerase (5U/ μ L) 0.2 μ L, 10 × PCR
Buffer 2.5 μ L, the dNTPs 2 μ L containing each 2.5mM of dATP, dTTP, dCTP and dGTP, concentration is that the BW4 of 50ng/ μ L is total
DNA solution 1 μ L, the single stranded DNA shown in SEQ ID No.3, the single stranded DNA shown in SEQ ID No.4, add water and complement to 25 μ L.
In reaction system, the concentration of the single stranded DNA shown in SEQ ID No.3 and the single stranded DNA shown in SEQ ID No.4 is 0.4 μ
mol/L.
According to the method described above, by concentration, the BW4 STb gene solution for 50ng/ μ L replaces with above-mentioned concentration respectively and is respectively
5ng/ μ L, 500pg/ μ L, 50pg/ μ L, the BW4 STb gene solution of 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and 5fg/ μ L, other steps
Rapid all constant, respectively obtain 5ng/25 μ L reaction system, 500pg/25 μ L reaction system, 50pg/25 μ L reaction system, 5pg/25
μ L reaction system, 500fg/25 μ L reaction system, 50fg/25 μ L reaction system and 5fg/25 μ L reaction system.
Performing PCR amplification is entered as negative control using sterilized water, the program of PCR amplification is：94℃5min；94 DEG C of 30s, 54
DEG C 30s, 72 DEG C of 45s, 35 circulations；72℃10min.
The PCR primer that PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in Figure 9.Result shows, 50ng/
The reaction system (swimming lane 1) of 25 μ L, the reaction system (swimming lane 2) of 5ng/25 μ L, the reaction system (swimming lane 3) of 500pg/25 μ L,
The reaction system (swimming lane 4) of 50pg/25 μ L, the reaction system (swimming lane 5) of 5pg/25 μ L all can expand size in 500bp-
Band (sequencing result shows, the size of the band of these 500bp-750bp is 730bp) between 750bp, 500fg/25 μ L's
Reaction system (swimming lane 6), the reaction system (swimming lane 7) of 50fg/25 μ L, the reaction system (swimming lane 8) of 5fg/25 μ L and feminine gender are right
Any band all can not be obtained according to (swimming lane 9).Result shows, the Fusarium oxysporum in the identification banana blight bacteria of embodiment 1
The PCR primer of Cuba's specialized form to B identify banana blight bacteria in Fusarium oxysporum Cuba specialized form sensitivity up to
5pg/25μL.
No. 4 biological strains of Fusarium oxysporum Cuba specialized form in embodiment 3, the identification banana blight bacteria of embodiment 1
PCR primer to the specificity of A and sensitivity experiment
First, the PCR of Fusarium oxysporum Cuba No. 4 biological strains of specialized form in the identification banana blight bacteria of embodiment 1
The specificity experiments of primer pair A
The template being expanded for PCR with the cDNA of the STb gene of bacterial strain and bacterial strain respectively is withered to the identification Fructus Musae of embodiment 1 respectively
The PCR primer of Fusarium oxysporum Cuba No. 4 biological strains of specialized form in pathogenic bacteria of withering carries out specificity identification to A, and experiment repeats
Three times, repeat comprising the following steps that of experiment every time：
1st, the template being expanded for PCR with the STb gene of bacterial strain
Drawn with the PCR of Fusarium oxysporum Cuba No. 4 biological strains of specialized form in the identification banana blight bacteria of embodiment 1
To A, the STb gene of each bacterial strain to embodiment 2 step one enters performing PCR amplification to thing, and the reaction system of PCR amplification is：Taq DNA
Polymerase (5U/ μ L) 0.2 μ L, 10 × PCR buffer 2.5 μ L, containing each 2.5mM's of dATP, dTTP, dCTP and dGTP
DNTPs 2 μ L, bacterial strain STb gene (a kind of DNA in each reaction system), the single stranded DNA shown in SEQ ID No.1, SEQ ID
Single stranded DNA shown in No.2, adds water and complements to 25 μ L.Using sterilized water as negative control, SEQ ID No.1 institute in reaction system
The concentration of the single stranded DNA shown in the single stranded DNA showing and SEQ ID No.2 is 0.4 μm of ol/L.
The program of PCR amplification is as follows：94℃5min；94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72℃
10min.
The PCR primer that PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in Figure 4.Result shows, Fig. 4's
The template of the swimming lane 1-40 in A is the STb gene of Fusarium oxysporum Cuba No. 4 biological strains of specialized form, the bacterial strain of swimming lane 1-40
Title is as follows：1：BW4；2：TR4；3：STR4；4：3#①；5：3#②；6：5#①；7：5#②；8：6#①；9：6#②；10：7#
①；11：7#②；12：9#①；13：9#②；14：34#①；15：34#②；16：36#①；17：36#②；18：37#①；19：
37#②；20：QWXZ b-2；21：NXXZ；22：NBXZ a；23：DTXZ-1a-1；24：DTXZ-2 ties up a；25：DTXZ-3 ties up；26：
LDXZ a；27：LGXD-5 ties up；28：LGXD-6 ties up；29：ZJXD；30：ZJB1b1；31：ZJB2b2；32：XNB2a；33：XNB5a；
34：XNB6a；35：XSBN；36：HH；37：HZ；38：ZJ；39：NX-27；40：The template of the swimming lane 1 in the B of PB3-15, Fig. 4 is
The STb gene of Fusarium oxysporum Cuba No. 4 biological strains of specialized form, strain name is B2.The swimming lane of swimming lane 1-40 and B of the A of Fig. 4
All have in 1 that (sequencing result shows, the size of the band of these 500bp-750bp is equal to band between 500bp-750bp for the size
For 699bp).Other bacterial strains (swimming of swimming lane 41-71 and B of the A of Fig. 4 of non-Fusarium oxysporum Cuba No. 4 biological strains of specialized form
Road 2-23) and negative control (swimming lane 72 of the A of Fig. 4 and the swimming lane 24 of B) all expand less than any band.Result shows, implements
The PCR primer of Fusarium oxysporum Cuba No. 4 biological strains of specialized form in the identification banana blight bacteria of example 1 is good to A specificity,
There is no cross reaction with other bacterial strains, do not have non-specific miscellaneous band to produce, sharp spore that can specifically from banana blight bacteria
The band that size is 699bp is amplified, this primer pair can be used in the STb gene of Fusarium spp. Cuba No. 4 biological strains of specialized form
No. 4 biological strains of Fusarium oxysporum Cuba specialized form in identification banana blight bacteria.
2nd, the template being expanded for PCR with the cDNA of bacterial strain
Drawn with the PCR of Fusarium oxysporum Cuba No. 4 biological strains of specialized form in the identification banana blight bacteria of embodiment 1
Thing enters performing PCR amplification to A to the B2 cDNA of embodiment 2 step one, B2 R1 cDNA, B2gfp cDNA and N2 cDNA, and PCR expands
The reaction system increasing is：Taq DNA polymerase (5U/ μ L) 0.2 μ L, 10 × PCR buffer 2.5 μ L, contain
The dNTPs 2 μ L of each 2.5mM of dATP, dTTP, dCTP and dGTP, bacterial strain cDNA (a kind of cDNA in each reaction system), SEQ
Single stranded DNA shown in ID No.1, the single stranded DNA shown in SEQ ID No.2, add water and complement to 25 μ L.Using sterilized water as feminine gender
Comparison, in reaction system, the concentration of the single stranded DNA shown in SEQ ID No.1 and the single stranded DNA shown in SEQ ID No.2 is
0.4μmol/L.
The program of PCR amplification is as follows：94℃5min；94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72℃
10min.
The PCR primer that PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in Figure 5.Result shows, B2 (swimming
Road 1), B2R1 (swimming lane 2) and B2gfp (swimming lane 3) all can expand band (sequencing result between 500bp-750bp for the size
Show, the size of the band of these 500bp-750bp is 699bp), N2 (swimming lane 4) and negative control (swimming lane 5) all can not obtain
To any band.Result shows, No. 4 physiology of Fusarium oxysporum Cuba specialized form in the identification banana blight bacteria of embodiment 1
The PCR primer of microspecies does not have cross reaction to A with other bacterial strains, does not have non-specific miscellaneous band to produce, can be specifically from Fructus Musae
The band that size is 699bp is amplified in the cDNA of Fusarium oxysporum Cuba No. 4 biological strains of specialized form in wilt.
2nd, the PCR of Fusarium oxysporum Cuba No. 4 biological strains of specialized form in the identification banana blight bacteria of embodiment 1
The sensitivity experiment of primer pair A
Carry out gradient dilution with the STb gene of the BW4 bacterial strain to embodiment 2 step one for the sterilized water, obtain concentration and be respectively
50ng/ μ L, 5ng/ μ L, 500pg/ μ L, 50pg/ μ L, 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and 5fg/ μ L BW4 STb gene molten
Liquid.
Respectively with concentration be 50ng/ μ L, 5ng/ μ L, 500pg/ μ L, 50pg/ μ L, 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and
Nucleic acid in the BW4 STb gene solution of 5fg/ μ L is template, with the Fusarium oxysporum in the identification banana blight bacteria of embodiment 1
The PCR primer of No. 4 biological strains of Cuba's specialized form enters performing PCR amplification to A, and PCR amplification, will be right all using the reaction system of 25 μ L
Concentration be 50ng/ μ L, 5ng/ μ L, 500pg/ μ L, 50pg/ μ L, 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and 5fg/ μ L BW4 total
The reaction system that nucleic acid in DNA solution enters performing PCR amplification is respectively designated as 50ng/25 μ L reaction system, 5ng/25 μ L reaction
System, 500pg/25 μ L reaction system, 50pg/25 μ L reaction system, 5pg/25 μ L reaction system, 500fg/25 μ L reactant
System, 50fg/25 μ L reaction system and 5fg/25 μ L reaction system.
The compound method of 50ng/25 μ L reaction system is：Taq DNA polymerase (5U/ μ L) 0.2 μ L, 10 × PCR
Buffer 2.5 μ L, the dNTPs 2 μ L containing each 2.5mM of dATP, dTTP, dCTP and dGTP, concentration is that the BW4 of 50ng/ μ L is total
DNA solution 1 μ L, the single stranded DNA shown in SEQ ID No.1, the single stranded DNA shown in SEQ ID No.2, add water and complement to 25 μ L.
In reaction system, the concentration of the single stranded DNA shown in SEQ ID No.1 and the single stranded DNA shown in SEQ ID No.2 is 0.4 μ
mol/L.
According to the method described above, by concentration, the BW4 STb gene solution for 50ng/ μ L replaces with above-mentioned concentration respectively and is respectively
5ng/ μ L, 500pg/ μ L, 50pg/ μ L, the BW4 STb gene solution of 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and 5fg/ μ L, other steps
Rapid all constant, respectively obtain 5ng/25 μ L reaction system, 500pg/25 μ L reaction system, 50pg/25 μ L reaction system, 5pg/25
μ L reaction system, 500fg/25 μ L reaction system, 50fg/25 μ L reaction system and 5fg/25 μ L reaction system.
Performing PCR amplification is entered as negative control using sterilized water, the program of PCR amplification is：94℃5min；94 DEG C of 30s, 56
DEG C 30s, 72 DEG C of 45s, 35 circulations；72℃10min.
The PCR primer that PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in Figure 10.Result shows,
The reaction system (swimming lane 1) of 50ng/25 μ L, the reaction system (swimming lane 2) of 5ng/25 μ L, the reaction system (swimming of 500pg/25 μ L
Road 3), the reaction system (swimming lane 4) of 50pg/25 μ L, the reaction system (swimming lane 5) of 5pg/25 μ L, the reactant of 500fg/25 μ L
System's (swimming lane 6), the reaction system (swimming lane 7) of 50fg/25 μ L all can expand band between 500bp-750bp for the size and (survey
Sequence result shows, the size of the band of these 500bp-750bp is 699bp), the reaction system (swimming lane 8) of 5fg/25 μ L and
Negative control (swimming lane 9) all can not obtain any band.Result shows, the sharp spore in the identification banana blight bacteria of embodiment 1
To A, the PCR primer of Fusarium spp. Cuba No. 4 biological strains of specialized form identifies that the Fusarium oxysporum Cuba in banana blight bacteria specially changes
The sensitivity of No. 4 biological strains of type is up to 50fg/25 μ L.
Fusarium oxysporum Cuba specialized form subtropical zones 4 life in embodiment 4, the identification banana blight bacteria of embodiment 1
The PCR primer of reason microspecies is to the specificity of C and sensitivity experiment
First, Fusarium oxysporum Cuba specialized form subtropical zones 4 biological strain in the identification banana blight bacteria of embodiment 1
The specificity experiments to C for the PCR primer
The template being expanded for PCR with the cDNA of the STb gene of bacterial strain and bacterial strain respectively is withered to the identification Fructus Musae of embodiment 1 respectively
The PCR primer of No. 4 biological strains in Fusarium oxysporum Cuba specialized form subtropical zones in pathogenic bacteria of withering carries out specificity identification to C, real
Test in triplicate, repeat comprising the following steps that of experiment every time：
1st, the template being expanded for PCR with the STb gene of bacterial strain
With Fusarium oxysporum Cuba specialized form subtropical zones 4 biological strain in the identification banana blight bacteria of embodiment 1
PCR primer to C the STb gene of each bacterial strain to embodiment 2 step one enter performing PCR amplification, PCR amplification reaction system be：
Taq DNA polymerase (5U/ μ L) 0.2 μ L, 10 × PCR buffer 2.5 μ L, containing dATP, dTTP, dCTP and dGTP
The dNTPs 2 μ L of each 2.5mM, bacterial strain STb gene (a kind of DNA in each reaction system) 1 μ L, single-stranded shown in SEQ ID No.5
Single stranded DNA shown in DNA, SEQ ID No.6, adds water and complements to 25 μ L.Using sterilized water as negative control, in reaction system
The concentration of the single stranded DNA shown in SEQ ID No.5 and the single stranded DNA shown in SEQ ID No.6 is 0.4 μm of ol/L.
The program of PCR amplification is as follows：94℃5min；94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72℃
10min.
The PCR primer that PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in Figure 6.Result shows, in Fig. 6
The template of swimming lane 4 and 6 be the STb gene of Fusarium oxysporum Cuba No. 4 subtropical zones biological strains of specialized form, strain name is respectively
For BW4 and STR4.All have in the swimming lane 4 and 6 of Fig. 6 to band between 500bp-750bp for the size (sequencing result shows, these
The size of the band of 500bp-750bp is 663bp).No. 4 biological strains in non-Fusarium oxysporum Cuba specialized form subtropical zones its
His bacterial strain (the swimming lane 1-3,5 and 7-95 of Fig. 6) and negative control (swimming lane 96 of Fig. 6) all expand less than any band.Result table
Bright, the PCR of No. 4 biological strains in Fusarium oxysporum Cuba specialized form subtropical zones in the identification banana blight bacteria of embodiment 1 draws
Thing is good to C specificity, does not have cross reaction with other bacterial strains, does not have non-specific miscellaneous band to produce, can be specifically withered from Fructus Musae
Wither and amplify the bar that size is 663bp in the STb gene of No. 4 biological strains in Fusarium oxysporum Cuba specialized form subtropical zones in pathogenic bacteria
Band, this primer pair can be used to identify Fusarium oxysporum Cuba specialized form subtropical zones 4 biological strain in banana blight bacteria.
2nd, the template being expanded for PCR with the cDNA of bacterial strain
With Fusarium oxysporum Cuba specialized form subtropical zones 4 biological strain in the identification banana blight bacteria of embodiment 1
PCR primer to the B2 cDNA of embodiment 2 step one, TR4 cDNA, STR4 cDNA and N2 cDNA, performing PCR amplification is entered to C,
The reaction system of PCR amplification is：Taq DNA polymerase (5U/ μ L) 0.2 μ L, 10 × PCR buffer 2.5 μ L, contain
There are the dNTPs 2 μ L of each 2.5mM of dATP, dTTP, dCTP and dGTP, bacterial strain cDNA (a kind of cDNA in each reaction system) 1 μ L,
Single stranded DNA shown in SEQ ID No.5, the single stranded DNA shown in SEQ ID No.6, add water and complement to 25 μ L.Described reaction system
Described in the concentration of the single stranded DNA shown in SEQ ID No.5 and the single stranded DNA shown in described SEQ ID No.6 be 0.4 μ
mol/L.Using sterilized water as negative control, the single stranded DNA shown in SEQ ID No.5 and SEQ ID No.6 institute in reaction system
The concentration of the single stranded DNA showing is 0.4 μm of ol/L.
The program of PCR amplification is as follows：94℃5min；94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 45s, 35 circulations；72℃
10min.
The PCR primer that PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in Figure 7.Result shows, STR4
(swimming lane 3) can expand band between 500bp-750bp for the size, and (sequencing result shows, the band of this 500bp-750bp
Size is 663bp), B2 (swimming lane 1), TR4 (swimming lane 2), N2 (swimming lane 4) and negative control (swimming lane 5) all can not obtain any
Band.Result shows, Fusarium oxysporum Cuba specialized form subtropical zones 4 physiology in the identification banana blight bacteria of embodiment 1 is little
The PCR primer planted does not have cross reaction to C with other bacterial strains, does not have non-specific miscellaneous band to produce, can be specifically withered from Fructus Musae
Wither and amplify the bar that size is 663bp in the cDNA of No. 4 biological strains in Fusarium oxysporum Cuba specialized form subtropical zones in pathogenic bacteria
Band.
2nd, Fusarium oxysporum Cuba specialized form subtropical zones 4 biological strain in the identification banana blight bacteria of embodiment 1
The sensitivity experiment to C for the PCR primer
Carry out gradient dilution with the STb gene of the BW4 bacterial strain to embodiment 2 step one for the sterilized water, obtain concentration and be respectively
50ng/ μ L, 5ng/ μ L, 500pg/ μ L, 50pg/ μ L, 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and 5fg/ μ L BW4 STb gene molten
Liquid.
Respectively with concentration be 50ng/ μ L, 5ng/ μ L, 500pg/ μ L, 50pg/ μ L, 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and
Nucleic acid in the BW4 STb gene solution of 5fg/ μ L is template, with the Fusarium oxysporum in the identification banana blight bacteria of embodiment 1
The PCR primer of No. 4 biological strains in Cuba's specialized form subtropical zones enters performing PCR amplification to C, and PCR amplification is all using the reactant of 25 μ L
System will be 50ng/ μ L to concentration, 5ng/ μ L, 500pg/ μ L, 50pg/ μ L, 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and 5fg/ μ L
BW4 STb gene solution in nucleic acid enter performing PCR amplification reaction system be respectively designated as 50ng/25 μ L reaction system, 5ng/25
μ L reaction system, 500pg/25 μ L reaction system, 50pg/25 μ L reaction system, 5pg/25 μ L reaction system, 500fg/25 μ L are anti-
Answer system, 50fg/25 μ L reaction system and 5fg/25 μ L reaction system.
The compound method of 50ng/25 μ L reaction system is：Taq DNA polymerase (5U/ μ L) 0.2 μ L, 10 × PCR
Buffer 2.5 μ L, the dNTPs 2 μ L containing each 2.5mM of dATP, dTTP, dCTP and dGTP, concentration is that the BW4 of 50ng/ μ L is total
DNA solution 1 μ L, the single stranded DNA shown in SEQ ID No.5, the single stranded DNA shown in SEQ ID No.6, add water and complement to 25 μ L.
In reaction system, the concentration of the single stranded DNA shown in SEQ ID No.5 and the single stranded DNA shown in SEQ ID No.6 is 0.4 μ
mol/L.
According to the method described above, by concentration, the BW4 STb gene solution for 50ng/ μ L replaces with above-mentioned concentration respectively and is respectively
5ng/ μ L, 500pg/ μ L, 50pg/ μ L, the BW4 STb gene solution of 5pg/ μ L, 500fg/ μ L, 50fg/ μ L and 5fg/ μ L, other steps
Rapid all constant, respectively obtain 5ng/25 μ L reaction system, 500pg/25 μ L reaction system, 50pg/25 μ L reaction system, 5pg/25
μ L reaction system, 500fg/25 μ L reaction system, 50fg/25 μ L reaction system and 5fg/25 μ L reaction system.
Performing PCR amplification is entered as negative control using sterilized water, the program of PCR amplification is：94℃5min；94 DEG C of 30s, 54
DEG C 30s, 72 DEG C of 45s, 35 circulations；72℃10min.
The PCR primer that PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in figure 11.Result shows,
The reaction system (swimming lane 1) of 50ng/25 μ L, the reaction system (swimming lane 2) of 5ng/25 μ L, the reaction system (swimming of 500pg/25 μ L
Road 3), the reaction system (swimming lane 4) of 50pg/25 μ L, the reaction system (swimming lane 5) of 5pg/25 μ L, the reactant of 500fg/25 μ L
System's (swimming lane 6) all can expand band between 500bp-750bp for the size, and (sequencing result shows, these 500bp-750bp's
The size of band is 663bp), the reaction system (swimming lane 7) of 50fg/25 μ L, the reaction system (swimming lane 8) of 5fg/25 μ L and the moon
Property comparison (swimming lane 9) all can not obtain any band.Result shows, the sharp spore sickle in the identification banana blight bacteria of embodiment 1
The PCR primer of No. 4 biological strains in Dao Jun Cuba specialized form subtropical zones identifies the Fusarium oxysporum Cuba in banana blight bacteria to C
The sensitivity of No. 4 biological strains in specialized form subtropical zones is up to 500fg/25 μ L.
Fusarium oxysporum Cuba specialized form in embodiment 5, the identification banana blight bacteria of embodiment 1 and Fusarium oxysporum
The specificity experiments of the primer set 3 of No. 4 biological strains in Cuba's specialized form subtropical zones
According to document (Liu Jinfu, Pan Dongming, for the beginning of spring, Chen Qingxi, Zhuan Xiqing, Li heroes. Chinese agronomy circular, 2009,
25(16):Method 51-55.) extract and obtain following infection Brazilian any of several broadleaf plants bulbs of different strains and dwarf banana bulb STb gene and
Health Brazil's any of several broadleaf plants bulb and the STb gene of healthy dwarf banana bulb：Infection STR4 Brazilian any of several broadleaf plants bulb, infect B2 Brazilian any of several broadleaf plants bulb,
The dwarf banana bulb of infection N2, the Brazilian any of several broadleaf plants bulb being uninfected by any bacterial strain and the dwarf banana bulb being uninfected by any bacterial strain.
Primer Actin2-F with Actin2：ACAGTGTCTGGATTGGAGGC (5 ' -3 ') and Actin2-R：
GCACTTCATGTGGACAATGG (5 ' -3 ') detects to above-mentioned bulb STb gene, all can amplify purpose band, show, on
State the experiment that STb gene all can carry out next step.
With in the Fusarium oxysporum Cuba specialized form and banana blight bacteria in the identification banana blight bacteria of embodiment 1
The primer set 3 of No. 4 biological strains in Fusarium oxysporum Cuba specialized form subtropical zones is to the STR4 STb gene of embodiment 2 step one, B2
STb gene and N2 STb gene and above-mentioned bulb STb gene carry out double PCR amplification.
The reaction system of double PCR amplification is：Taq DNA polymerase (5U/ μ L) 0.2 μ L, 10 × PCR
Buffer 2.5 μ L, dNTPs 2 μ L, bacterial strain STb gene or bulb STb gene containing each 2.5mM of dATP, dTTP, dCTP and dGTP
(a kind of DNA in each reaction system) 1 μ L, the single stranded DNA shown in SEQ ID No.3, the single stranded DNA shown in SEQ ID No.4,
Single stranded DNA shown in SEQ ID No.5, the single stranded DNA shown in SEQ ID No.6, add water and complement to 25 μ L.Using sterilized water as
Negative control, in reaction system, the concentration of the single stranded DNA shown in SEQ ID No.3 and the single stranded DNA shown in SEQ ID No.4 is equal
For 0.4 μm of ol/L, the concentration of the single stranded DNA shown in SEQ ID No.5 and the single stranded DNA shown in SEQ ID No.6 is 0.4 μ
mol/L.
The response procedures of double PCR amplification are as follows：94℃5min；94 DEG C of 30s, 54 DEG C of 30s, 72 DEG C of 45s, 35 circulations；
72℃10min.
The PCR primer that double PCR amplification is obtained enters row agarose gel electrophoresis, and result is as shown in Figure 8.Result shows,
The Brazilian any of several broadleaf plants bulb (swimming lane 4) of STR4 bacterial strain (swimming lane 1) and infection STR4 all can amplify two sizes all in 500bp-750bp
Between band (sequencing result shows, the size of this two bands in 500bp-750bp is respectively 730bp and 663bp), B2 bacterium
Strain (swimming lane 2), N2 bacterial strain (swimming lane 3), the Brazilian any of several broadleaf plants bulb (swimming lane 5) of infection B2 and infect N2 dwarf banana bulb (swimming lane 6) equal
Can only amplify band between 500bp-750bp for the size (sequencing result shows, the band of this 500bp-750bp big
Little for 730bp), be uninfected by Brazilian any of several broadleaf plants bulb, the dwarf banana bulb being uninfected by any bacterial strain and the negative control of any bacterial strain all not
Any band can be amplified.Result shows, the Fusarium oxysporum Cuba specialized form in the identification banana blight bacteria of embodiment 1
PCR primer is drawn to the PCR of No. 4 biological strains in Fusarium oxysporum Cuba specialized form subtropical zones in B and identification banana blight bacteria
Thing does not all have cross reaction to C with other bacterial strains and plant tissue, does not have non-specific miscellaneous band to produce, can be simultaneously using identification
Whether test strains or identification plant to be measured infect Fusarium oxysporum Cuba specialized form, and determine the Fusarium oxysporum Cuba of infection
Whether specialized form is Fusarium oxysporum Cuba specialized form subtropical zones 4 biological strain.The identification of the present invention or auxiliary identification Fructus Musae
During the primer set identification banana blight bacteria of wilt, template is not limited by originating, and template used is test strains
Nucleic acid is alternatively plant tissue nucleic acid.
Claims (10)
1. identify or auxiliary identification banana blight bacteria primer set it is characterised in that：Described primer set is by entitled A's
PCR primer is to the PCR primer with entitled B to composition；
Two single stranded DNAs shown in SEQ ID No.1 in sequence table and SEQ ID No.2 for the described A form；Described B is by sequence
Two single stranded DNA compositions shown in SEQ ID No.3 and SEQ ID No.4 in table.
2. identify or auxiliary identification banana blight bacteria PCR primer to it is characterised in that：Described PCR primer is wanted to for right
Seek A described in 1.
3. identify or auxiliary identification banana blight bacteria system it is characterised in that：Described system is following Ll or Nn：
Ll, the system containing primer set described in claim 1；
Nn, the system containing A described in claim 1.
4. system according to claim 3 it is characterised in that：Described system also includes archaeal dna polymerase.
5. the method identified or assist identification banana blight bacteria, is following L1) or L2)：
L1) following L11) and L12)：
L11) with the nucleic acid of biological sample to be measured as template, enter performing PCR amplification with A described in claim 1 and obtain PCR primer A1；
The cDNA for template transcription obtained with the RNA of described biological sample to be measured or with RNA, as template, is carried out with B described in claim 1
PCR amplification obtains PCR primer B1；
L12) detect L11) size of described PCR primer A1 and described PCR primer B1, if contained in described PCR primer B1
The DNA fragmentation of 699bp, the DNA fragmentation containing 699bp in described PCR primer A1, it is ancient that described testing sample contains Fusarium oxysporum
No. 4 biological strains of bar specialized form；If the DNA fragmentation containing 699bp in described PCR primer B1, do not contain in described PCR primer A1
The DNA fragmentation of 699bp, described testing sample contains Fusarium oxysporum Cuba specialized form, described Fusarium oxysporum Cuba specialized form
It is not No. 4 biological strains of Fusarium oxysporum Cuba specialized form；If not containing 699 DNA fragmentation in described PCR primer B1, described
Testing sample does not contain Fusarium oxysporum Cuba specialized form；
L2) following L21) and L22)：
L21) with the nucleic acid of biological sample to be measured as template, enter performing PCR amplification with A described in claim 1 and obtain PCR primer A2；
With the DNA of described biological sample to be measured as template, enter performing PCR amplification with B described in claim 1 and obtain PCR primer B2；
L22) detect L21) size of described PCR primer A2 and described PCR primer B2, if contained in described PCR primer B2
The DNA fragmentation of 730bp, the DNA fragmentation containing 699bp in described PCR primer A2, it is ancient that described testing sample contains Fusarium oxysporum
No. 4 biological strains of bar specialized form；If the DNA fragmentation containing 730bp in described PCR primer B2, do not contain in described PCR primer A2
The DNA fragmentation of 699bp, described testing sample contains Fusarium oxysporum Cuba specialized form, described Fusarium oxysporum Cuba specialized form
It is not No. 4 biological strains of Fusarium oxysporum Cuba specialized form；If not containing the DNA fragmentation of 730bp, institute in described PCR primer B2
State testing sample and do not contain Fusarium oxysporum Cuba specialized form.
6. the method identified or assist identification banana blight bacteria, is following N：The following N1 of N) and N2)：
N1) with the nucleic acid of biological sample to be measured as template, enter performing PCR amplification with A described in claim 1 and obtain PCR primer A1；
N2) detect N1) described PCR primer A1 size, if the DNA fragmentation containing 699bp in described PCR primer A1, described
Testing sample contains No. 4 biological strains of Fusarium oxysporum Cuba specialized form；If not containing the DNA of 699bp in described PCR primer A1
Fragment, described testing sample does not contain No. 4 biological strains of Fusarium oxysporum Cuba specialized form.
7. Ll or the side described in claim 5 in the primer set described in claim 1 or system described in claim 3 or 4
Application in identification banana blight bacteria for the method；
Described banana blight bacteria is Fusarium oxysporum Cuba specialized form and/or No. 4 physiology of Fusarium oxysporum Cuba specialized form are little
Kind.
8. the PCR primer described in claim 2 to or system described in claim 3 or 4 in Nn or the side described in claim 6
Application in identification banana blight bacteria for the method；
Described banana blight bacteria is No. 4 biological strains of Fusarium oxysporum Cuba specialized form.
9. primer set described in claim 1 preparation method it is characterised in that：Methods described is included in described primer set
The step that two single stranded DNAs of each primer pair are individually packed.
10. PCR primer pair described in claim 2 preparation method it is characterised in that：Methods described is included claim 2 institute
State the step that two single stranded DNAs of PCR primer pair are individually packed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510084410.3A CN104611452B (en) | 2015-02-16 | 2015-02-16 | Identification or the primer set of auxiliary identification banana blight bacteria |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510084410.3A CN104611452B (en) | 2015-02-16 | 2015-02-16 | Identification or the primer set of auxiliary identification banana blight bacteria |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104611452A CN104611452A (en) | 2015-05-13 |
| CN104611452B true CN104611452B (en) | 2017-03-08 |
Family
ID=53146099
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510084410.3A Active CN104611452B (en) | 2015-02-16 | 2015-02-16 | Identification or the primer set of auxiliary identification banana blight bacteria |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104611452B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111118200B (en) * | 2020-02-05 | 2021-01-19 | 中国热带农业科学院热带生物技术研究所 | CAPS marking method for distinguishing banana wilt resistant varieties |
| WO2022102726A1 (en) * | 2020-11-11 | 2022-05-19 | 国立研究開発法人理化学研究所 | Method of diagnosing fusarium oxysporum soil by pathogen genomics |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101205558B (en) * | 2006-12-22 | 2010-11-17 | 福建省农业科学院植物保护研究所 | Banana wilt bacterium molecule detecting genes and detecting method thereof |
| CN101178379B (en) * | 2007-12-05 | 2010-12-08 | 华南农业大学 | Method for detecting No.4 race of Fusarium oxysporum f sp. Cubense |
| CN102690887B (en) * | 2012-06-14 | 2014-02-26 | 福建省农业科学院植物保护研究所 | LAMP (loop-mediated isothermal amplification) detection primers of banana fusarium wilt bacteria No. 4 microspecies and application thereof |
| CN103757093B (en) * | 2013-11-04 | 2016-07-13 | 中国热带农业科学院环境与植物保护研究所 | The method of No. 4 microspecies of detection by quantitative banana blight bacteria from soil |
| CN103740806B (en) * | 2013-11-06 | 2016-03-30 | 中国热带农业科学院环境与植物保护研究所 | A kind of method of No. 4 microspecies in the detection by quantitative banana blight bacteria torrid zone from soil |
| CN103789443B (en) * | 2014-02-25 | 2015-04-22 | 广东省农业科学院植物保护研究所 | Multiple intermolecular rapid detection method for banana wilt bacteria and bacterial Erwinia carotovora |
-
2015
- 2015-02-16 CN CN201510084410.3A patent/CN104611452B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN104611452A (en) | 2015-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Strange | Introduction to plant pathology | |
| Lin et al. | Development of a molecular marker for specific detection of Fusarium oxysporum f. sp. cubense race 4 | |
| Mandhare et al. | Morphological, pathogenic and molecular characterization of Fusarium oxysporum f. sp. ciceri isolates from Maharashtra, India | |
| Ling et al. | An improved real-time PCR system for broad-spectrum detection of Didymella bryoniae, the causal agent of gummy stem blight of cucurbits | |
| Aish Muhammad et al. | Molecular characterization of Fusarium oxysporum f. sp. Cubense (Foc) tropical race 4 causing Panama disease in Cavendish banana in Pakistan. | |
| CN109504799A (en) | A kind of the primer combination and method of Rapid identification sickle-like bacteria strain | |
| WU et al. | Isolation and identification of Fusarium oxysporum f. sp. cubense in Fujian Province, China | |
| CN104611452B (en) | Identification or the primer set of auxiliary identification banana blight bacteria | |
| CN104611451B (en) | Complete set primers for identification or assisted identification of fusarium oxysporum f.sp.cubense and application of complete set primers | |
| Zhao et al. | Differentially expressed gene transcripts related to the Cf-19-mediated resistance response to Cladosporium fulvum infection in tomato | |
| Mcfadden et al. | Fusarium wilt (Fusarium oxysporum f. sp. vasinfectum) genes expressed during infection of cotton (Gossypium hirsutum) | |
| Shen et al. | Development of a PCR assay for the molecular detection of Phytophthora boehmeriae in infected cotton | |
| Dugan et al. | Host ranges of North American isolates of Penicillium causing blue mold of bulb crops | |
| Lebeda et al. | First detection of tomato powdery mildew caused by Oidium neolycopersici in South Africa | |
| Mwaniki et al. | Response of African eggplants to Fusarium spp. and identification of sources of resistance | |
| Garcia et al. | Identification and characterization of Fusarium spp. from muskmelon in northwest Mexico | |
| DON et al. | Population structure of the rice blast pathogen in Vietnam | |
| CN114032334A (en) | Primer group and kit for detecting quinoa phomopsis and detection method thereof | |
| Tracyline et al. | Characterization of diversity and pathogenecity of Pyricularia grisea affecting finger millet in Kenya | |
| KR101385200B1 (en) | Disease diagnosis kit including species-specific primer, and detection and disease diagnosis method for Cylindrocarpon destructans | |
| Nawade et al. | Diversity analysis among Fusarium oxysporum F. sp. cumini isolates using ISSR markers, spore morphology and pathogenicity | |
| CN106978505B (en) | Primer pair for detecting pedunculosis solani and application thereof | |
| Li et al. | A PCR-based assay for distinguishing between A1 and A2 mating types of Phytophthora capsici | |
| Dauda et al. | Biocontrol of sheath blight of rice (Oryza sativa L.) through alteration in expression dynamics of candidate effector genes of Rhizoctonia solani AG1-IA during pathogenesis | |
| Wang et al. | Differential screening reveals genes differentially expressed in low-and high-virulence near-isogenic Phytophthora sojae lines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |