CN104611264A - Lysine high-yield strain and application - Google Patents

Lysine high-yield strain and application Download PDF

Info

Publication number
CN104611264A
CN104611264A CN201510053053.4A CN201510053053A CN104611264A CN 104611264 A CN104611264 A CN 104611264A CN 201510053053 A CN201510053053 A CN 201510053053A CN 104611264 A CN104611264 A CN 104611264A
Authority
CN
China
Prior art keywords
hom
subtilis
animal
lysine
application
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201510053053.4A
Other languages
Chinese (zh)
Other versions
CN104611264B (en
Inventor
李丽立
王升平
张彬
范觉鑫
王来强
蒋国礼
刘志强
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan Shengshi Fenghua Biotechnology Co.,Ltd.
Original Assignee
Institute of Subtropical Agriculture of CAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institute of Subtropical Agriculture of CAS filed Critical Institute of Subtropical Agriculture of CAS
Priority to CN201510053053.4A priority Critical patent/CN104611264B/en
Publication of CN104611264A publication Critical patent/CN104611264A/en
Application granted granted Critical
Publication of CN104611264B publication Critical patent/CN104611264B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/07—Bacillus
    • C12R2001/125—Bacillus subtilis ; Hay bacillus; Grass bacillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P13/00—Preparation of nitrogen-containing organic compounds
    • C12P13/04—Alpha- or beta- amino acids
    • C12P13/08—Lysine; Diaminopimelic acid; Threonine; Valine

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Virology (AREA)
  • Environmental Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Agronomy & Crop Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pest Control & Pesticides (AREA)
  • Dentistry (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biomedical Technology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Fodder In General (AREA)

Abstract

The invention discloses a lysine high-yield strain. The lysine high-yield strain is classified and named bacillus subtilis PL13-hom::Km, and the strain is collected in China Center for Type Culture Collection on January 5, 2015, with a collection number of CCTCC: M2015002. The concentration of lysine in the fermentation liquor of the strain bacillus subtilis PL13-hom::Km disclosed by the invention is up to 50-100g/L, the fermentation liquor is capable of suppressing the growth of escherichia coli in vitro; moreover, the fermentation liquor is capable of enhancing animal immunity and promoting animal growth if added in animal feeds or animal drinking water and reducing the added amount of lysine in the animal feeds, thus effectively reducing the production costs of the feeds.

Description

A kind of lysine Producing Mutant strain and application
Technical field
The present invention relates to feed additive field, more specifically relate to a kind of subtilis PL13-hom::Km (Bacillus subtilis PL13-hom::Km) of high yield Methionin, relate to this bacterial strain simultaneously and preparing the application in animal feedstuff additive.
Background technology
Methionin can regulate body metabolic balance, improves the absorption of calcium and accumulation in vivo, increase appetite, thus the effect of enhancing development, minimizing disease and enhancing immunity function.Therefore, in fodder production, the adding proportion of Methionin in complete diet pellet is about 0.7%.But China's feedstuff industry was through the development of 30 years, and rate of profit constantly declines, and enters low margin age.At present, the profit of China's complete diet pellet is greatly about about 20 yuan/ton.Particularly present various natural disaster take place frequently, the factor such as monetary inflation, cause bulk raw material, as corn, dregs of beans, fish meal etc., price rises steadily, complete diet pellet profit margin is constantly compressed, and how to save cost, becomes the problem that present feed manufacturing enterprise pays close attention to the most.
Bacillus preparation generally adds in China's feedstuff industry, before the applicant, research finds, the product Methionin capacity variance of genus bacillus is huge, simultaneously, by ultraviolet mutagenesis and AEC screening, select and produced the Methionin bacterial strain (deposit number be CCTCC:M 2013412) higher than wild type Bacillus, and applied for Chinese patent (application number is 2013105158229).But carry out seed selection by the method for ultraviolet mutagenesis, the mutant strain of acquisition produces lysine level increase rate not, and easily produces reverse mutation.The method of gene knockout is adopted can effectively to solve this problem.The application, by by the homoserine gene knockout of subtilis, produces the higher and more stable probiotic strain of lysine level to obtain, for animal productiong, thus improves breeding performonce fo animals, safeguard body health; Meanwhile, after adding this bacterial strain in feed, further can save the addition of Methionin in feed comparatively before, thus effectively reduce fodder production cost.
Summary of the invention
The object of the present invention is to provide a kind of subtilis PL13-hom::Km of high yield Methionin, this bacillus subtilis strain not only has the prebiotic attribute of conventional subtilis, possesses the characteristic at high yield Methionin simultaneously.
In order to achieve the above object, the technical solution adopted in the present invention is: a kind of lysine Producing Mutant strain, its Classification And Nomenclature is subtilis PL13-hom::Km (Bacillus subtilis PL13-hom::Km), this bacterial strain is preserved in China typical culture collection center on January 5th, 2014, and deposit number is CCTCC:M2015002; Preservation address is Wuhan, China Wuhan University.
The preparation of Strains B. subtilis PL13-hom::Km of the present invention: get animal intestinal chyme and be separated by dilution, obtain a strain good antimicrobial effect and high yield Methionin subtilis original strain, LB liquid nutrient medium inoculates this original strain, the homoserine gene knockout of bacterial strain is carried out after cultivating dilution, the bacterium colony that the multiple growth conditions of picking is good carries out bacteriostatic activity detection and produces lysine analysis, obtain a strain suppress intestinal bacteria effective and produce the high bacterial strain of Methionin, this bacterial strain is subtilis (Bacillus subtilis), called after subtilis PL13-hom::Km (Bacillus subtilis PL13-hom::Km).
The physio-biochemical characteristics of Strains B. subtilis PL13-hom::Km of the present invention see the following form 1:
The physio-biochemical characteristics of table 1 bacterial strain PL13-hom::Km of the present invention
Strains B. subtilis PL13-hom::Km of the present invention is inoculated in LB liquid nutrient medium and carries out shake flask fermentation cultivation, obtain shake flask fermentation seed liquor, culture condition: inoculum size 1-5%, temperature 30-37 DEG C, time 18-36h, rotating speed 150-225r/min.Obtained shake flask fermentation seed liquor concentration is 10 7-10 9cFU/ml.Optimal culture condition: inoculum size 2%, temperature 37 DEG C, time 24h, rotating speed 200r/min.
Above-mentioned shake flask fermentation seed liquor is inoculated in LB liquid nutrient medium and carries out 10L fermentor tank pilot scale cultivation, fermentation condition is: liquid amount 4-7L LB liquid nutrient medium, inoculum size 3-5%, temperature 25-40 DEG C, time 18-36h, rotating speed 200-400r/min, air flow 1:1, pH value 6.8-7.8; In the fermented liquid obtained, lysine concentration reaches 50-100g/L.
The above-mentioned LB liquid culture based component mentioned is: Tryptones 10g, yeast extract 5g, sodium-chlor 10g, distilled water 1000ml, pH value 6.8-7.2.
Strains B. subtilis PL13-hom::Km fermented liquid of the present invention can suppress Escherichia coli Growth in vitro.And Strains B. subtilis PL13-hom::Km fermented liquid of the present invention is directly added in cultivated animals drinking-water, addition is 5 × 10 6-10 10cFU/L drinks water; Or Strains B. subtilis PL13-hom::Km fermented liquid of the present invention is directly being added in animal-feed, addition is 5 × 10 6-10 10cFU/Kg feed, can strengthen animal immune ability, promotes growth of animal, and can reduce the addition of Methionin in animal-feed.Wherein, this cultivated animals is pig, chicken, duck, goose, fish, ox and sheep.
Compared with prior art, the present invention has the following advantages:
1, Strains B. subtilis PL13-hom::Km of the present invention can in growth and breeding process high yield Methionin, thus in feed, realize the supply of Methionin, than the bacterial strain in the application that application number is 2013105158229 product Methionin ability more by force and more stable, there will not be reverse mutation.
2, Strains B. subtilis PL13-hom::Km of the present invention strengthens immunity, somatotrophic function in conjunction with the anti-microbial activity of genus bacillus and Methionin, significantly can suppress the growth and breeding of pathogenic bacterium, strengthen animal immune ability.And verify that it is to growth of animal and healthy effect by animal experiment.
3, Strains B. subtilis PL13-hom::Km of the present invention adds to after in feed, can save the addition of Methionin in feed of 50%, thus effectively reduces fodder production cost.
Embodiment
Following examples only for illustration of the present invention, but are not used in and limit the scope of the invention, and if not otherwise specified, method therefor of the present invention is routine techniques, and agents useful for same is all purchased from biochemical shop.
The preparation of embodiment 1 Strains B. subtilis PL13-hom::Km of the present invention
The separation of original strain: take chyme 10g from subtropics Agro-ecology institute of Chinese Academy of Sciences laboratory animal cultivation center (Changsha) chitling road, add 10 times of sterilized water vortex 5min, static 5min, gets 1ml and carries out 10 times of doubling dilutions, 10 6, 10 7, 10 8extent of dilution, each extent of dilution respectively gets 100 microlitre supernatant coating LB solid plates, each extent of dilution carries out 3 repetitions, cultivate 24h for 37 DEG C, the single bacterium colony of picking is in the 10ml EP pipe that 3ml LB liquid nutrient medium is housed, be placed in shaking table 37 DEG C and cultivate 24h, the centrifugal 5min of 12000rpm, get supernatant and carry out the effect analysis of suppression intestinal bacteria, simultaneously, application amino acid fully-automatic analyzer measures each aminoacids content in supernatant, obtains good antimicrobial effect and high yield Methionin subtilis original strain, preserves with 25% glycerine.
The homoserine gene knockout of original strain:
1, bacillus subtilis bacterium competence preparation substratum:
GMI substratum: 1mL10 × Spizizen salts, 0.1mL10% yeast powder, 0.25mL20% glucose, 0.2mL1% caseinhydrolysate, 0.2mL0.25% are amino acid needed, supplement sterile purified water to cumulative volume 10mL.
GMII substratum: 1mL10 × Spizizensalts, 0.05mL 10% yeast powder, 0.25mL20% glucose, 0.04mL1% caseinhydrolysate, 0.2mL0.25% are amino acid needed, 0.05mL0.1mol/LCaCl2,1mL25mmol/LMgCl2, supplement sterile purified water to cumulative volume 10mL.
LB liquid nutrient medium: Tryptones 10g/L, yeast extract 5g/L, sodium-chlor 10g/L.
LB solid medium: Tryptones 10g/L, yeast extract 5g/L, sodium-chlor 10g/L, agar powder 15g/L.
10 × Spizizen salts mother liquor: 15%K 2hPO 43H 2o, 6%KH 2pO 4, 2% (NH 4) 2sO 4, 0.2%MgSO 4and 1% Trisodium Citrate be dissolved in 75.8% distilled water, 6.6 × 10 4pa autoclaving, room temperature storage.2, bacillus subtilis bacterium competence cell preparation method:
Get and be separated the subtilis original strain obtained in a full ring embodiment 1 and draw LB flat board, cultivate 12h in 37 DEG C of constant incubators, choose single bacterium colony in 3ml LB substratum, 37 DEG C, 250r/min overnight incubation.Getting 160 μ l nutrient solutions is forwarded in 8ml GMI substratum, and 37 DEG C, 250r/min is cultured to logarithmic growth latter stage (about 4-5h).Get 0.2ml and grow to the nutrient solution in the logarithm end of term in 2ml GMII substratum, 37 DEG C, 100r/min cultivates 90min.Get 1mL culture, the centrifugal 5min of 5000r/min room temperature, with 1/10 volume supernatant liquor Eddy diffusion bacterial precipitation, be subtilis original bacteria competent cell.
3, pMD18-T-hom::Km plasmid construction:
3.1pMD18-T-hom plasmid construction: design upstream primer sequence is: TTGAAAGCGATTCGTGTAGG (SEQ ID No.1), downstream primer sequence is: TTAGCTCCAACCGTTCCCTTCT (SEQ ID No.2), upstream and downstream primer is synthesized by Shanghai biotechnology company limited, with this original strain for template, pcr amplification is carried out to homoserine dehydrogenase gene hom, PCR reaction system: 10 × amplification buffer 10ul, 4 kinds of each 200umol/L of dNTP mixture, each 10 ~ the 100pmol of primer, template DNA 0.1 ~ 2ug, Taq archaeal dna polymerase 2.5u, 1.5mmol/L Mg 2+, add two or tri-distilled water to 100ul, PCR reaction conditions is: 95 DEG C of 5min, 95 DEG C of 1min, 56 DEG C of 1min, 72 DEG C of 1min, 72 DEG C of 10min, cycle number 30.
The PCR primer (i.e. homoserine dehydrogenase gene hom) obtained is connected to (pMD18-T buys from Shanghai biotechnology company limited) on pMD18-T carrier, and linked system is: homoserine dehydrogenase gene PCR product 6ul, pMD18-T carrier 2ul, T 4ligase 2ul, T 4buffer 2.5ul and water 12.5ul, altogether 25ul, 16 DEG C of connections of spending the night, are connection product.
Get 10ul above-mentioned connection product conversion to the business-like competent escherichia coli cell of 100ul (buying from Shanghai biotechnology company limited), after 37 DEG C of incubated overnight, be positive transformant at the escherichia coli cloning of the LB grow on plates containing 10ug/mL penbritin, after PCR qualification, obtain pMD18-T-hom plasmid.
3.2 card receive mycin resistant gene expression cassette build:
Design upstream primer: TTG-GCGCGC-TGTTTGCAAGCAGCAGATT (SEQ ID No.3), and downstream primer: TTG-GCGCGC-GTATCCGCTCATGAATTAAT (SEQ ID No.4), upstream and downstream primer is synthesized by Shanghai biotechnology company limited.Wherein-GCGCGC-is BseP1 (BssH2) restriction enzyme site.With pET-28a (+) carrier (buying from Shanghai biotechnology company limited) for template, resistant gene received by amplification card, and PCR reaction system is: 10 × amplification buffer 10ul, 4 kinds of each 200umol/L of dNTP mixture, upstream primer 10 ~ 100pmol, downstream primer 10 ~ 100pmol, template (pET-28a (+) plasmid) 0.1 ~ 2ug, Taq archaeal dna polymerase 2.5u, Mg 2+1.5mmol/L, adds two or tri-distilled water to 100ul.Obtain card and receive mycin resistant gene expression cassette.
3.3pMD18-T-hom::Km plasmid construction:
The PCR primer (card receive mycin resistant gene expression cassette) of amplification in 3.2 is cut with BseP1 enzyme, the enzyme system of cutting is: PCR primer 2ug, BseP1 enzyme 2ul, 10 × M Buffer 4ul, add to 40ul with aqua sterilisa, 50 DEG C of constant temperature 2 hours, then product is carried out race glue by 0.8% agarose gel electrophoresis to reclaim, dissolve with 10ul aqua sterilisa.PMD18-T-hom plasmid BseP1 enzyme constructed in 3.1 is cut, the enzyme system of cutting is: pMD18-T-hom plasmid 2ug, BseP1 enzyme 2ul, 10 × M Buffer 4ul, add to 40ul with aqua sterilisa, 50 DEG C of constant temperature 2 hours, then product is carried out race glue by 0.8% agarose gel electrophoresis to reclaim, dissolve with 10ul aqua sterilisa.The kanamycin gene expression cassette that BseP1 enzyme is cut be connected to BseP1 enzyme cut after pMD18-T-hom plasmid, obtain pMD18-T-homoserine dehydrogenase gene front portion-Ka Na resistance-homoserine dehydrogenase gene rear portion plasmid, i.e. pMD18-T-hom::Km plasmid.Its linked system is: card receive mycin resistant gene expression cassette BseP1 enzyme cut back to close after product 6ul, BseP1 enzyme cut back to close after linear pMD18-T-hom plasmid 2ul, T 4ligase 2ul, T 4buffer 2.5ul, water 12.5ul, altogether 25ul, 16 DEG C of connections of spending the night, are connection product.
Get 10ul above-mentioned connection product conversion to the business-like competent escherichia coli cell of 100ul (buying from Shanghai biotechnology company limited), after 37 DEG C of incubated overnight, be positive transformant receiving the escherichia coli cloning of LB grow on plates of mycin containing 10ug/mL card, pMD18-T-homoserine dehydrogenase gene front portion-Ka Na resistance expression box-homoserine dehydrogenase gene rear portion plasmid is obtained, i.e. pMD18-T-hom::Km plasmid after PCR qualification.
4, PCR primer transforms
With upstream primer: TTGAAAGCGATTCGTGTAGG (SEQ ID No.1) and downstream primer: TTAGCTCCAACCGTTCCCTTCT (SEQ ID No.2), with the pMD18-T-hom::Km obtained in 3.3 for template, amplification " homoserine dehydrogenase gene front portion-Ka Na resistance expression box-homoserine dehydrogenase gene rear portion " DNA fragmentation, 95 DEG C of 5min sex change, make PCR primer single stranded, subtilis PL13-hom::Km original strain competent cell prepared in the 1st step is converted into after single stranded, containing 10ug/mL card receive mycin LB grow on plates subtilis clone be positive transformant, the bacterium colony that the multiple growth conditions of picking is good carries out bacteriostatic activity detection and produces lysine analysis, obtain a plant height serine dehydrogenase to knock out, suppress intestinal bacteria effective and produce the high bacterial strain of Methionin, be named as subtilis PL13-hom::Km (Bacillus subtilis PL13-hom::Km), this bacterial strain is sent to China typical culture collection center on January 5th, 2015 and carries out preservation, deposit number is CCTCC:M 2015002.
The preparation of embodiment 2 Strains B. subtilis PL13-hom::Km of the present invention fermented liquid
The preparation of shake flask fermentation seed liquor: (viable bacteria concentration is 10 to get Strains B. subtilis PL13-hom::Km 2ml of the present invention 8-10 10cFU/ml), be inoculated in 100ml LB liquid nutrient medium and carry out shake flask fermentation cultivation, leavening temperature is 37 DEG C, and pH value is 7.2, and rotating speed is 200r/min, and fermentation time is 24h.Wherein, LB liquid culture based component is: Tryptones 10g, yeast extract 5g, sodium-chlor 10g, distilled water 1000ml, and pH value is 7.2.
Carry out fermentor tank pilot plant test after shake flask fermentation terminates, (concentration of seed liquor is 10 to get 100ml shake flask fermentation seed liquor 8cFU/ml) be inoculated in 10L fermentor tank, liquid amount 5L, leavening temperature is 37 DEG C, and pH value is 7.2, and stirring velocity is 300r/min, and fermentation 24h, ventilation ratio is 1:1.Fermentor tank pilot scale substratum is consistent with Medium of shaking flask fermentation composition, after fermentation ends, substratum is placed in 4 DEG C for subsequent use.
Lysine production analysis in embodiment 3 Strains B. subtilis PL13-hom::Km of the present invention fermented liquid
Get the fermented liquid obtained in 5ml embodiment 2, the centrifugal 10min of 12000r/min, get supernatant 1ml, every ml adds the trichoroacetic acid(TCA) 2.5ml of 7.5% (mass ratio), 18000r/min 4 DEG C of centrifugal 15min after mixing, Aspirate supernatant 1ml proceeds in amino acid analysis bottle, measures arginine and other amino acid whose content with the full-automatic amino acidanalyser of Hitachi's L-8800 type.Result shows, and in Strains B. subtilis PL13-hom::Km ferment tank liquid of the present invention, lysine content is 63g/L.
Embodiment 4 bacterial strain PL13-hom::Km of the present invention is in vitro to the suppression of Escherichia coli Growth
Get 2 LB nutrient agar plates, get 20 μ L activate Escherichia coli bacteria liquid (concentration of seed liquor is 10 8cFU/ml), be uniformly coated on a LB solid plate, get 20 μ L activate Salmonellas bacterium liquid (concentration of seed liquor is 10 8cFU/ml), be uniformly coated on another LB solid plate, be placed in thermostat container 37 DEG C and cultivate after 10 minutes, utilize punch tool to punch on culture dish.The Strains B. subtilis PL13-hom::Km fermented liquid of the present invention obtained in Example 2 is with after the centrifugal 1min of 12000r/m, getting 20 μ L supernatants adds in the hole of culture dish, 24h is cultivated in thermostat container 37 DEG C, observe size and the readability of genus bacillus inhibition zone, judge the antibacterial ability of tested bacterium to indicator.Result shows, and Strains B. subtilis PL13-hom::Km of the present invention is 28mm to colibacillary antibacterial circle diameter, shows that bacterial strain of the present invention is inhibited to colibacillary growth in vitro.
Embodiment 5 Strains B. subtilis PL13-hom::Km of the present invention is on the impact of breeding performonce fo animals
54 21 age in days Duroc × length are white × Yorkshire three way cross weanling pig, be divided into 3 treatment group at random, each treatment group 3 repetition, each repetition 6 piglets (male and female half and half), between each repeating groups, original body mass is without significant difference (p > 0.05).Treatment group 1 is blank group, basal diet of feeding, not containing any medicated premix, and the Methionin of supply 0.6% simultaneously; Treatment group 2 is test group, and add bacterial strain PL13-hom::Km fermented liquid of the present invention in basal diet, additive capacity is 10 8cFU/kg, the Methionin of supply 0.3% simultaneously; Treatment group 3 is duomycin control group, adds the duomycin of 0.1%, the Methionin of supply 0.6% simultaneously in basal diet.Piglet free choice feeding and drinking-water.
A, Strains B. subtilis PL13-hom::Km of the present invention are on the impact of piglet growth immune performance
In conjunction with seeing table 2, result shows, Strains B. subtilis PL13-hom::Km of the present invention can significantly improve piglet average daily gain (p < 0.05), improve feedstuff-meat ratio and reduce grice diarrhoea rate (p < 0.05), improve production performance and the economic benefit of piglet, can effective substitute antibiotics additive, the Methionin addition of in feed 50% can be reduced simultaneously, be suitable for large application scope.
Table 2 Strains B. subtilis PL13-hom::Km of the present invention is on the impact of piglet growth performance
Growth performance Treatment group 1 Treatment group 2 Treatment group 3
Daily ingestion amount (g/ day) 588±46.23 a 587±39.22 b 586±37.13 b
Day weight gain (g/ day) 354±20.31 a 377±16.17 b 378±34.38 b
Feedstuff-meat ratio (F/G) 1.66±0.11 a 1.56±0.13 b 1.55±0.09 b
Diarrhea rate (%) 16.15±1.32 a 8.33±2.31 b 9.37±1.88 b
Note: colleague's data shoulder mark does not represent significant difference (p < 0.05) containing same letter person.
B, Strains B. subtilis PL13-hom::Km of the present invention are on the impact of piglet immunological performance
In process of the test, piglet serum antibody is detected, in conjunction with seeing table 3, result shows, and the treatment group 2 being added with bacterial strain PL13-hom::Km fermented liquid of the present invention can improve the content (p < 0.05) of natural antibody IgG and IgM in piglet serum.Result shows, bacterial strain PL13-hom::Km of the present invention can improve human body immune function, reduces sickness rate, growth promoting effects.
Table 3 bacterial strain PL13-hom::Km of the present invention is on the impact of piglet blood antibody and cytokine
Testing index Treatment group 1 Treatment group 2 Treatment group 3
IgG(g/L) 61.4±8.36 a 69.7±9.33 b 53.6±7.77 a
IgM(nmol/μL) 5.56±0.62 a 6.22±0.53 b 5.37±0.67 a
Note: colleague's data shoulder mark does not represent significant difference (p < 0.05) containing same letter person.
C, Strains B. subtilis PL13-hom::Km of the present invention are on the impact of piglet serum amino acid level
In process of the test, amino acid levels in piglet serum is detected, in conjunction with seeing table 4, result shows, the treatment group 2 being added with Strains B. subtilis PL13-hom::Km fermented liquid of the present invention can promote the synthesis of piglet Methionin, thus reduce the level of 0.3% at Methionin addition under, maintain the content of Methionin in piglet serum.Show, in animal-feed, add the interpolation cost that bacterial strain PL13-hom::Km fermented liquid of the present invention can reduce Dietary Lysine, improve culture benefit.
Table 4 Strains B. subtilis PL13-hom::Km of the present invention is on the impact of piglet serum amino acid level
Index (umol/L) Treatment group 1 Treatment group 2 Treatment group 3
Aspartic acid 78.65±14.36 80.36±13.69 80.33±13.15
Serine 366.87±46.38 a 460.22±67.30 b 544.66±63.25 c
Threonine 171.96±43.54 186.43±43.28 191.30±45.21
L-glutamic acid 451.64±63.28 a 530.22±67.55 b 500.78±68.54 b
Glycine 653.33±163.34 a 767.98±134.74 b 932.41±154.75 c
L-Ala 544.99±113.03 a 687.33±97.20 b 711.12±63.75 b
Gelucystine 261.46±56.77 a 381.22±61.10 b 365.64±75.64 b
α-amino-isovaleric acid 245.36±55.34 277.87±54.21 278.63±37.61
Methionine(Met) 309.22±32.69 a 272.45±41.34 b 264.65±42.35 b
Isoleucine 199.34±55.21 187.65±54.74 189.32±34.21
Leucine 461.10±84.24 335.87±87.32 372.42±71.24
Tyrosine 269.85±34.24 a 236.13±63.78 b 241.36±33.12 b
Phenylalanine 263.33±41.33 a 220.25±42.66 b 210.32±46.27 b
Methionin 164.73±48.56 166.71±37.62 133.29±36.88
Histidine 93.01±24.13 a 109.12±20.38 b 73.34±33.57 c
Arginine 223.67±37.66 a 293.03±62.31 b 183.97±23.37 a
Ammonia 7.23±1.83 a 39.67±3.93 b 38.01±6.04 b
Note: colleague's data shoulder mark does not represent significant difference (p < 0.05) containing same letter person.
In sum, Strains B. subtilis PL13-hom::Km fermented liquid of the present invention adds in animal-feed, animal serum arginine-level can be improved, reduce by the Methionin consumption of in feed 0.3%, promote growth of animal, strengthen animal immune function, can effective substitute antibiotics, be particularly suitable for widespread use in feed.

Claims (9)

1. a lysine Producing Mutant strain, its Classification And Nomenclature is subtilis PL13-hom::Km (Bacillus subtilis PL13-hom::Km), and deposit number is CCTCC:M 2015002.
2. prepare the method for lysine Producing Mutant fermented liquid for one kind, it is characterized in that, the method the shake flask fermentation seed liquor obtained with bacterial strain described in claim 1 is inoculated in LB liquid nutrient medium to carry out fermentation culture, culture condition: in 10L fermentor tank, the amount of LB liquid nutrient medium is 4-7L, inoculum size 3-5%, temperature 25-40 DEG C, time 18-36h, rotating speed 200-400r/min, air flow 1:1, pH value 6.8-7.8.
3. method as claimed in claim 2, it is characterized in that, described shake flask fermentation seed liquor concentration is 10 7-10 9cFU/ml.
4. method as claimed in claim 3, is characterized in that, described shake flask fermentation seed liquor inoculation described in claim 1 is carried out in LB liquid nutrient medium shake flask fermentation cultivation to obtain, culture condition: inoculum size 1-5%, temperature 30-37 DEG C, time 18-36h, rotating speed 150-225r/min.
5. method as claimed in claim 4, it is characterized in that, described culture condition is: inoculum size 2%, temperature 37 DEG C, time 24h, rotating speed 200r/min.
6. bacterial strain described in claim 1 suppresses the application in Escherichia coli Growth in vitro.
7. the fermented liquid that prepared by method according to any one of claim 2-5 suppresses the application in Escherichia coli Growth in vitro.
8. bacterial strain described in claim 1 is preparing the application in animal feedstuff additive.
9. the application in animal feedstuff additive prepared by the fermented liquid that prepared by method according to any one of claim 2-5.
CN201510053053.4A 2015-02-02 2015-02-02 A kind of lysine high-yielding strain and application Active CN104611264B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510053053.4A CN104611264B (en) 2015-02-02 2015-02-02 A kind of lysine high-yielding strain and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510053053.4A CN104611264B (en) 2015-02-02 2015-02-02 A kind of lysine high-yielding strain and application

Publications (2)

Publication Number Publication Date
CN104611264A true CN104611264A (en) 2015-05-13
CN104611264B CN104611264B (en) 2017-08-18

Family

ID=53145916

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510053053.4A Active CN104611264B (en) 2015-02-02 2015-02-02 A kind of lysine high-yielding strain and application

Country Status (1)

Country Link
CN (1) CN104611264B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1147273A (en) * 1994-03-04 1997-04-09 味之素株式会社 Process for production L-lysine
CN101400799A (en) * 2006-03-09 2009-04-01 巴斯夫欧洲公司 Process for the production of beta-lysine
CN103555625A (en) * 2013-10-28 2014-02-05 李丽立 High-lysine yield bacillus subtilis PL83, preparation method and application

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1147273A (en) * 1994-03-04 1997-04-09 味之素株式会社 Process for production L-lysine
CN101400799A (en) * 2006-03-09 2009-04-01 巴斯夫欧洲公司 Process for the production of beta-lysine
CN103555625A (en) * 2013-10-28 2014-02-05 李丽立 High-lysine yield bacillus subtilis PL83, preparation method and application

Also Published As

Publication number Publication date
CN104611264B (en) 2017-08-18

Similar Documents

Publication Publication Date Title
CN106399196B (en) One lactobacillus plantarum HEW-A490 and its application
CN101455274B (en) Method for producing feedstuff containing ganoderma lucidum active ingredient and feedstuff using ganoderma lucidum liquid fermentation liquid
CN106190933B (en) The bacillus subtilis of the anti-pathogenic bacteria of wide spectrum and its application
CN106282072A (en) A kind of compound lactobacillus microbial ecological agent and preparation method and application
CN103088010A (en) Biological health padding and preparation method thereof
CN102936568B (en) Solid fermentation inoculum of chicken-origin bacillus subtilis and pediococcus pentosaceus and preparation method and application of solid fermentation inoculum
CN104904994A (en) Three major types of bacteria mixed liquid fermentation, solid yeast feed additive and preparation method thereof
CN108208316A (en) Feed containing Siam bacillus
CN108085261A (en) One Accharomyces cerevisiae and its culture and the application in feed
CN109022333A (en) A kind of preparation method and applications of composite microbial fermentation bacteria agent
CN105524855B (en) A kind of bacillus coagulans and its application with aquatic pathogenic bacterium antagonistic properties
CN102352330B (en) Bacillus subtilis PA105 and preparation method and application thereof
CN113462620A (en) Preparation method and application of composite microbial agent for feed
CN109468259A (en) A kind of culture medium for promoting gemma to generate
CN106399155A (en) Bacillus licheniformis fermentation culture medium
CN106035988B (en) Production method of arginine active peptide powder for livestock and poultry
CN106858157A (en) A kind of bacteria preparation for aquaculture
CN107760612A (en) A kind of aspergillus niger yy07 bacterial strains and its application in solid fermentation produces feeding acid protease
CN104894026B (en) The cultural method of bafillus natto and its application
CN103652329A (en) Compound probiotic biological agent
CN104894028A (en) Fishery ocean microbial ecological preparation and preparation method thereof
CN104611264A (en) Lysine high-yield strain and application
CN103865832A (en) Lactobacillus plantarum BS10 and application thereof in regulating pig blood fat
CN102732458A (en) Fungus preparation for improving ecological environment at bottom of aquaculture water
CN112136966A (en) Preparation method of aquatic product fully-matured fermented feed

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20180606

Address after: No. 124, New Village Road, Tao Hong town, Longhui County, Hunan Province

Patentee after: HUNAN SHENGSHI FENGHUA BIOTECHNOLOGY CO., LTD.

Address before: 410125 1071 Yuanda two road, Furong district, Changsha, Hunan

Patentee before: Institute of Subtropical Agriculture, Chinese Academy of Sciences

CP01 Change in the name or title of a patent holder
CP01 Change in the name or title of a patent holder

Address after: No. 124, New Village Road, Tao Hong town, Longhui County, Hunan Province

Patentee after: Hunan Shengshi Fenghua Biotechnology Co.,Ltd.

Address before: No. 124, New Village Road, Tao Hong town, Longhui County, Hunan Province

Patentee before: HUNAN SHENGSHI FENGHUA BIOTECHNOLOGY Co.,Ltd.

PE01 Entry into force of the registration of the contract for pledge of patent right
PE01 Entry into force of the registration of the contract for pledge of patent right

Denomination of invention: A lysine producing strain and its application

Effective date of registration: 20220613

Granted publication date: 20170818

Pledgee: Longhui County SME Financing Guarantee Co.,Ltd.

Pledgor: Hunan Shengshi Fenghua Biotechnology Co.,Ltd.

Registration number: Y2022980007488