CN104610276A - Benzo-[k,l]thiaxanthene-3,4-dimethyl anhydride derivative-uridine conjugates, and preparation method and application thereof - Google Patents

Benzo-[k,l]thiaxanthene-3,4-dimethyl anhydride derivative-uridine conjugates, and preparation method and application thereof Download PDF

Info

Publication number
CN104610276A
CN104610276A CN201410619540.8A CN201410619540A CN104610276A CN 104610276 A CN104610276 A CN 104610276A CN 201410619540 A CN201410619540 A CN 201410619540A CN 104610276 A CN104610276 A CN 104610276A
Authority
CN
China
Prior art keywords
benzo
compound
thioxanthene
dicarboxylic acid
acid anhydride
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201410619540.8A
Other languages
Chinese (zh)
Other versions
CN104610276B (en
Inventor
张文
吴艳玲
李子健
刘佳春
王岩丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Inner Mongolia Changhe Hongyuan Pharmaceutical Technology Co ltd
Original Assignee
Zhejiang University of Technology ZJUT
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhejiang University of Technology ZJUT filed Critical Zhejiang University of Technology ZJUT
Priority to CN201410619540.8A priority Critical patent/CN104610276B/en
Publication of CN104610276A publication Critical patent/CN104610276A/en
Application granted granted Critical
Publication of CN104610276B publication Critical patent/CN104610276B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
    • C09B57/00—Other synthetic dyes of known constitution
    • C09B57/08—Naphthalimide dyes; Phthalimide dyes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D495/00—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms
    • C07D495/02—Heterocyclic compounds containing in the condensed system at least one hetero ring having sulfur atoms as the only ring hetero atoms in which the condensed system contains two hetero rings
    • C07D495/06—Peri-condensed systems
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H19/00—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof
    • C07H19/02—Compounds containing a hetero ring sharing one ring hetero atom with a saccharide radical; Nucleosides; Mononucleotides; Anhydro-derivatives thereof sharing nitrogen
    • C07H19/04—Heterocyclic radicals containing only nitrogen atoms as ring hetero atom
    • C07H19/06—Pyrimidine radicals

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention relates to benzo-[k,l]thiaxanthene-3,4-dimethyl anhydride derivative-uridine conjugates, and a preparation method and application thereof. According to the invention, benzo-[k,l]thiaxanthene-3,4-dicarboamide parent ring having the properties of a DNA intercalator is conjugated with uridine having important biological activity to construct 3 novel target compounds. The above 3 target compounds are applied to research on the selective combining capacity of the promoter activation DNA sequence of the proto-oncogene c-myc highly expressed in some tumor cells at the extracellular molecule level; the above 3 target compounds are applied to research at the cell level, and research results show that all the three compounds have certain effects on killing two tumor cells, wherein compound 1 shows the strongest effect on killing the tumor cells; and the 3 compounds have substantial significance on the research and development of antitumor gene-targeted drugs having down-regulated c-myc gene and mediated by the benzo-[k,l]thiaxanthene-3,4-dimethyl anhydride derivative-uridine conjugates.

Description

Benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate and its preparation method and application
Technical field
The present invention relates to a kind of novel benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate and preparing the application in antitumor drug.
Background technology
Benzo [k, l] thioxanthene-3, the precursor 1 of 4-dicarboxylic acid anhydride analog derivative, 8-naphthoyl imide compounds is that a class has good anti-tumor activity, by the small molecules synthetic compound of comparatively extensively research, its principal feature has conjugate planes aromatic structure, has excellent embedded performance to DNA, can be embedded in the middle of DNA base pair, cause the topological framework of DNA to change, and then affect type Ⅱ topoisomerase to the identification of DNA and effect, therefore be often used as DNA intercalator.In addition, in its structure, also there is coplanar fluorescence chromophoric group, can as a species specific DNA fluorescent probe after the intercalation of DNA.The exploitation of 1,8-naphthoyl imide compounds is from 20 century 70s.1973, Hispanic Brana study group in conjunction with the theoretical basis of DNA, can design and synthesize out the single naphthalimide of a class only containing a naphthalene ring first according to glutarimide ring, β-nitro naphthalene nucleus, amino side-chain.Research shows, single naphthalimide can cause DNA superhelix to untwist between intercalation of DNA base pair effectively.Afterwards, in order to increase the binding ability of compound and DNA, Brana starts to modify further the structure of naphthalimide, such as naphthalimide parent ring the substituting group such as introducing nitro, amino, hydroxyl, the tertiary butyl, methoxyl group, chlorine or on imide side chain, introduce the substituting group of nitrogen atom or nonnitrogenous atom, synthesized a series of naphthalimide analog derivative with anti-tumor activity.Some single naphthalimides such as amonafide (Amonafide) and Mitonafide (Mitonafide) and bisnaphthalimides elinafide (Elinafide) and bisnafide (Bisnafide) etc. have entered clinical I phase or II phase conceptual phase.But these medicines are found to have the untoward reaction such as bone marrow depression, Central neurotoxicity when Clinical practice, limit the clinical application of its reality.Therefore, structural modification and transformation increase targeting are carried out to naphthalimide, to reduce its toxic side effect, strengthen anti-tumor activity, to increase the study hotspot that solvability has become this kind of cancer therapy drug.This research uses benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride as precursor structure, and it has larger conjugate planes, attempts to increase and DNA, especially with G-tetra-serobila DNA selective binding ability.
Nucleosides and deoxynucleoside are the main components of Nucleotide, and some nucleosides and deoxynucleoside or derivatives thereof have significant biological activity, as antiviral, antitumor, the antimycotic and efficient edible freshener of conduct, indirectly or directly as drug use, extremely important effect can be served in the treatment of various diseases.Uridine is a kind of main nucleosides of RNA, 5 FU 5 fluorouracil is that first basis is necessarily imagined and the antimetabolite that synthesizes and be anti-miazines medicine most widely used clinically at present, good therapeutic effect is had to various solid tumors such as digestive tract cancers, also be the first-selected medication for the treatment of mammary cancer and gastroenteric tumor, in oncotherapy, occupy critical role.5 FU 5 fluorouracil is the derivative after 5 of uridylic replaced by fluorine, and it is 5-fluorodeoxyuridine acid through enzymatic conversion in vivo, suppresses thymidylate synthase and disturbs the synthesis of DNA.In addition, 5 FU 5 fluorouracil also has certain restraining effect to the synthesis of RNA.But the side effect of 5 FU 5 fluorouracil is comparatively large, can produce gastrointestinal reaction and the myelosuppressive untoward reactions such as white corpuscle and thrombopenia such as stomachache, diarrhoea.
Naphthoyl imide compounds and nucleoside compound all have anti-tumor activity, but they all exist shortcoming more or less separately, limit their further application clinically.As naphthalimide compounds can as the intercalator of DNA, but its parent ring is water-soluble poor, poor to the DNA selective of different structure, and nucleoside compound has in high affinity and structure DNA and has hydrophilic radical, but but there is certain toxic side effect.Both be coupled together and may reach the effect of mutual supplement with each other's advantages, based on this imagination, design and synthesis 3 has benzo [k, l] thioxanthene-3, the 4-dicarboxylic acid anhydride analog derivative-uridine conjugate of different lengths connection chain.Object one, increases the targeting of medicine, reduces side effect; Object two, increases compound and DNA, the especially avidity of G-tetra-serobila DNA; Object three, increases the water-soluble of compound and is beneficial to clinical application.
c-myc belongs to nucleoproteide regulatory gene, it is one of most important proto-oncogene in body, also be the proto-oncogene the most widely of research at present, the whether normal Fashion and Evolution on tumour of its transcript and expression has important impact, the regulation and control imbalance of the unconventionality expression of c-myc or its expression product is the characteristic mark of all kinds of human tumors of 20%, the Several Kinds of Malignancy of the mankind, as mammary cancer (Breast carcinoma), cervical cancer (Cervical carcinoma), lung cancer (Lung carcinoma), ovarian cancer (Ovarian carcinoma), osteosarcoma, spongioblastoma (Neuroblastoma), leukemia (Leukemia) etc. are all closely related with the unconventionality expression of c-myc.The expression product c-Myc albumen of c-myc is a kind of transcriptional regulator, can regulate and control to account for the expression of the downstream gene of human genome gene number 15%, thus participate in numerous important physiological processs such as Growth of Cells, differentiation, aging, apoptosis and cell cycle regulating widely.The expression of c-Myc albumen to downstream gene plays activation usually, but some controls the effect that expression that Growth of Cells crosses the gene of Sheng shows suppression, and this part gene accounts for the 10-25% of all c-myc downstream genes.That is, c-Myc albumen can promote the growth of tumour cell, also can promote the apoptosis of tumour cell.In a word; c-myc and expression product c-Myc albumen thereof participate in the relevant multiple physiological processs of tumour; comprise the formation of Growth of Cells, propagation, apoptosis and tumour cell, deterioration, migration etc., its abnormal expression or regulation and control imbalance can be led oncogenic formation and further develop.
In order to the expression of control c-Myc albumen, it is potential alternative strategies that transcriptional level carries out selected gene regulation and control.So the gene target medicine designing, research and develop the disease of c-myc gene mediated for c-myc genetic transcription has important value and practical significance.Current research mainly concentrates on is rich in G base sequence by small molecules induction c-myc promoter region and forms G-tetra-serobila and stablize its structure and carry out regulatory transcription level, thus the expression of controlling gene.Research shows, there is a nucleic acid surpass photosensitive elements NHE III at the base pair place, upstream-142 to-115, P1 promoter region of c-myc 1(Nuclear Hypersensitivity Element III 1), NHE III 1be the sequence being rich in guanine of one section of 27 base pair, be also called Pu27, which control the transcription of c-myc gene 85-90%.Because Pu27 is rich in guanine, there are potentiality in physiological conditions that form G-tetra-serobila.Pu27 is identification and the calmodulin binding domain CaM of various activating transcription factor and DNA, and after it forms G-tetra-stranded structure, various activating transcription factor and DNA None-identified also combine, thus impel c-myc expression level to lower.
The report of relevant 1,8-naphthalimide analog derivative and anti-tumor activity thereof:
2007, Qian Xuhong seminar designed and synthesized the naphthalimide derivative of 5-position fat amido and the replacement of 5-position aromatic group, wherein has 8 compounds Hela and P388D1 tumour cell to be demonstrated to the anti tumor activity in vitro being better than amonafide.2009, the outstanding seminar of Wang Chao has synthesized 6 naphthalimide polyamines conjugates, through mtt assay, external activity test is carried out to K562 cell, MB-231 cell and prostate cancer cell, result shows, most compounds shows the anti tumor activity in vitro being better than amonafide, and wherein 3 kinds of compounds have good selectivity to QSG-7701 normal people's liver epithelial cell and BEL-7402 liver cancer cell.2012, Lee little six seminar's design and synthesis had the naphthalimide derivative of different lengths 4-hydroxyl-alkyl amine side chain.Utilize the avidity of the technique study such as UV-Vis, fluorescence spectrum and CD they and Ct-DNA, and its anti-tumor activity of entry evaluation.Wherein, following compounds 1with 2show potential anti-tumor activity, they are to the IC of Bel-7402 50value is respectively 5.57 and 9.17 μMs.
Found by the above retrieval analysis to the background information that the present invention is correlated with: up to now, all research is all with 1,8-naphthalimide is the medicine of derivative as potential treatment tumour of precursor structure, do not utilize 1,8-naphthalimide derivative-uridine conjugate or benzo [k, l] report of thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate regulation and control c-myc gene; Do not utilize 1,8-naphthalimide derivative-uridine conjugate or benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate to the report of c-myc promoter region DNA sequence-specific recognition reaction and inhibition tumor cell apoptosis yet.
Summary of the invention
For the above-mentioned problems in the prior art, the object of the present invention is to provide a kind of novel benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate and application thereof, increase compound water-soluble and specifically with the binding ability of DNA, and there is the characteristic to the selective recognition reaction of c myc promoter DNA base sequence; This kind of molecule can cause the cancer cells generation apoptosis in various degree of c-myc gene high expression by the expression of lowering c-myc gene, therefore can be used as potential gene target medicine for oncotherapy.
Benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate, it is characterized in that comprising following three kinds of compounds, structural formula is respectively as shown in formula I, formula II, formula III:
。
Described benzo [k, l] thioxanthene-3, the preparation method of 4-dicarboxylic acid anhydride analog derivative-uridine conjugate, it is characterized in that with benzo [k, l] thioxanthene-3, 4-dicarboxylic acid anhydride and 2-aminouridine are raw material, DMF is solvent, DCC is condensing agent, at 35 DEG C, 24-26 hour is reacted under argon shield, after TLC monitoring reaction terminates, the N of ripple removing formation will be crossed after reaction solution cooling, N-dicyclohexylurea precipitate, use acetone rinsing again, collect filtrate and be further purified by Preparative TLC chromatogram, thin-layer chromatography is using the mixed solution of chloroform and methyl alcohol as developping agent, rinse as the product tape of eluent by correspondence with ethanol, collect elutriant, revolve steaming removing ethanol and be placed on the compound (I) that vacuum-drying at 30 DEG C obtains yellow powder, above-mentioned thin-layer chromatography HF254, the silica-gel plate of 20 × 25 cm, thickness is 1.5mm, the mixeding liquid volume of the chloroform that thin-layer chromatography is used and methyl alcohol compares 9:1.
Described benzo [k, l] thioxanthene-3, the preparation method of 4-dicarboxylic acid anhydride analog derivative-uridine conjugate, it is characterized in that first by benzo [k, l] thioxanthene-3, 4-dicarboxylic acid anhydride and 3-alanine are obtained by reacting benzothioxanthene-3, 4-dicarboximide-N-propionic acid, again by benzothioxanthene-3, 4-dicarboximide-N-propionic acid and 2-aminouridine react 24-26 hour using DCC as condensing agent in DMF under argon shield at 35 DEG C, after TLC monitoring reaction terminates, by the N that the removing of reaction solution cooled and filtered is formed, N-dicyclohexylurea precipitate, with acetone rinsing, collect filtrate and be further purified by Preparative TLC chromatogram, thin-layer chromatography is using the mixed solution of chloroform and methyl alcohol as developping agent, rinse as the product tape of eluent by correspondence with ethanol, collect elutriant, revolve and steam removing ethanol, and being placed in the compound (II) that vacuum-drying at 30 DEG C obtains yellow powder, above-mentioned thin-layer chromatography HF254, the silica-gel plate of 20 × 25 cm, thickness is 1.5mm, and the mixeding liquid volume of the chloroform that thin-layer chromatography is used and methyl alcohol compares 9:1.
Described benzo [k, l] thioxanthene-3, the preparation method of 4-dicarboxylic acid anhydride analog derivative-uridine conjugate, it is characterized in that by benzo [k, l] thioxanthene-3, 4-dicarboxylic acid anhydride and 6-Aminocaproic Acid are obtained by reacting benzothioxanthene-3, 4-dicarboximide-N-is sour, again by benzothioxanthene-3, 4-dicarboximide-N-acid and 2-aminouridine reacts 24-26 hour using DCC as condensing agent in DMF under argon shield at 35 DEG C, after TLC monitoring reaction terminates, by the N that the removing of reaction solution cooled and filtered is formed, N-dicyclohexylurea precipitate, with acetone rinsing, collect filtrate and be further purified by Preparative TLC chromatogram, thin-layer chromatography is using the mixed solution of chloroform and methyl alcohol as developping agent, rinse as the product tape of eluent by correspondence with ethanol, collect elutriant, revolve and steam removing ethanol, and being placed in the compound (III) that vacuum-drying at 30 DEG C obtains yellow powder, above-mentioned thin-layer chromatography HF254, the silica-gel plate of 20 × 25 cm, thickness is 1.5mm, and the mixeding liquid volume of the chloroform that thin-layer chromatography is used and methyl alcohol is than 9:1, and above-mentioned urea also claims urea.
Described benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate is preparing the application in antitumor drug.
The application of described benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate in the medicine of preparation treatment cervical cancer, Non-small cell lung carcinoma.
Described benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate is preparing the application in antitumor drug, the antitumor drug that to it is characterized in that with c-myc gene be target.
Reaction equation of the present invention is as follows:
Wherein, formula IV is the structural formula of benzothioxanthene-3,4-dicarboxylic acid anhydride, the structural formula that formula (V) is 2-aminouridine, in formula II or (III) as n=2, is compound formula II; As n=5, be compound formula III, the n in substituted amino acid is 2 or 5.
By adopting above-mentioned technology, compared with prior art, beneficial effect of the present invention is as follows:
1) benzo [k of the present invention by there is DNA intercalator character, l] thioxanthene-3,4-diformamide parent ring and the uridine coupling with important biomolecule activity are built into 3 novel benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate is target compound, structure all certifications of each compound;
2) the present invention has carried out the research of the selective binding ability of extracellular molecules level by the c myc promotor activated dna sequence of application 3 target compounds to some tumour cell high expression level, and electrophoretic mobility experiment (EMSA), ultraviolet melting experiment (UV-melting) and circular dichroism spectrum (CD) result show: three kinds of compounds have different specific binding capacity from target DNA sequence;
3) in the present invention apply three kinds of compounds to the tumour cell Hela(cervical cancer of two Expression of Plant Height c-myc genes) and A549(adenocarcinoma of lung) cell, with Normal Lung cell (HLF-a) for reference carried out the research of antitumour activity, application real-time cell analysis (RTCA) technical research apoptosis situation, result of study shows: three kinds of compounds all have certain killing effect to two kinds of tumour cells, normal people's pneumonocyte (HLF-a) is not almost acted on, and compound 1the strongest to tumour cell effect performance, IC 50respectively: 2.26 μMs (A549) and 1.96 μMs (Hela), to the tangible meaning of Antioncogene targeted drug of research and development benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine couplet mediated c-myc gene deregulation.
4) application compound in the present invention 1tumour cell Hela(cervical cancer to two Expression of Plant Height c-myc genes) and A549(adenocarcinoma of lung) cell carried out c-myc mRNA respectively by RT-PCR and Western Blot technology and transcribed the expression study with c-Myc albumen, result shows: compound 1two kinds of tumour cell c-myc mRNA to be transcribed and the expression of c-Myc albumen all has certain restraining effect, this type of benzo [k is described, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate reaches antitumor action by the downward of mediation c-myc genetic expression.
Accompanying drawing explanation
Fig. 1 is that c-myc gene nucleic acid surpasses the transformation of photosensitive elements III 1 regional DNA structure to the influencing mechanism of c-myc genetic transcription; In figure, NHE III 1 surpasses photosensitive elements III 1 for nucleic acid; Hn RNP K is the special member in heterogeneity ribonucleoprotein in core (heterogeneous-nuclear ribonucleoprotein, hnRNP) family, is a kind of multifunctional protein; CNBP is nucleus binding-protein; TBP is tributyl phosphate; RNA pol II is RNA polymerase II;
Fig. 2 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate and c-myc gene promoter region sequence interactional native polyacrylamide gel electrophoresis figure on the gene level of extracellular; In figure: swimming lane 1:Marker; Swimming lane 2: the single stranded DNA being rich in guanine in corresponding double-stranded DNA; Swimming lane 3: the single stranded DNA being rich in guanine in corresponding double-stranded DNA and compound mole ratio 1:30; Swimming lane 4: the single stranded DNA being rich in cytosine(Cyt) in corresponding double-stranded DNA; Swimming lane 5: the single stranded DNA being rich in cytosine(Cyt) in corresponding double-stranded DNA and compound mole ratio 1:30; Swimming lane 6-12: corresponding double-stranded DNA and compound mole ratio 1:0(swimming lane 6), 1:1(swimming lane 7), 1:5(swimming lane 8) and, 1:10(swimming lane 9), 1:15(swimming lane 10) and, 1:20(swimming lane 11), 1:30(swimming lane 12); Swimming lane 13: the double-stranded DNA of corresponding mispairing; Swimming lane 14: the double-stranded DNA of corresponding mispairing and compound mole ratio 1:30.The effect (Fig. 2 (1)) of (a) compound 1 and DNA.The effect (Fig. 2 (2)) of (b) compound 2 and DNA.The effect (Fig. 2 (3)) of (c) compound 3 and DNA;
Fig. 3 is the melting curve of benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate and the effect of c-myc gene promoter region sequence.The melting curve (Fig. 3 (1)) of (a) compound 1 and corresponding double-stranded DNA, [DNA]=2 μM, [compound 1]=0,10,40 μMs.The melting curve (Fig. 3 (2)) of (b) compound 2 and corresponding double-stranded DNA, [DNA]=2 μM, [compound 1]=0,10,40 μMs.The melting curve (Fig. 3 (3)) of (c) compound 3 and corresponding double-stranded DNA, [DNA]=2 μM, [compound 1]=0,10,40 μMs.(d) three compounds respectively with the melting curve (Fig. 3 (4)) of corresponding mismatched dsdna, DNA and compound mole ratio are 1:20;
Fig. 4-1 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 1the circular dichroism spectrogram of guanine double-stranded DNA effect is rich in, [DNA]=2 μM, [compound]=0,2,4,8,16,32,48,64 μMs with c-myc;
Fig. 4-2 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 2the circular dichroism spectrogram of guanine double-stranded DNA effect is rich in, [DNA]=2 μM, [compound]=0,2,4,8,16,32,48,64 μMs with c-myc;
Fig. 4-3 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 2the circular dichroism spectrogram of guanine double-stranded DNA effect is rich in, [DNA]=2 μM, [compound]=0,2,4,8,16,32,48,64 μMs with c-myc;
Fig. 5-1 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 1the circular dichroism spectrogram of guanine single stranded DNA effect is rich in c-myc; [DNA]=2 μM, [compound 1]=0,2,4,8,16,32,64,80 μMs;
Fig. 5-2 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 2the circular dichroism spectrogram of guanine single stranded DNA effect is rich in c-myc; [DNA]=2 μM, [compound 2]=0,2,4,8,16,32,64,80 μMs;
Fig. 5-3 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 3the circular dichroism spectrogram of guanine single stranded DNA effect is rich in c-myc; [DNA]=2 μM, [compound 3]=0,2,4,8,16,32,64,80 μMs;
Fig. 6-1 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 1 pair of A549(nonsmall-cell lung cancer) the growth-inhibiting curve of cell, this curve is the mean value in multiple hole;
Fig. 6-2 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 2 pairs of A549(nonsmall-cell lung cancers) the growth-inhibiting curve of cell, this curve is the mean value in multiple hole;
Fig. 6-3 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 3 pairs of A549(nonsmall-cell lung cancers) the growth-inhibiting curve of cell, this curve is the mean value in multiple hole;
Fig. 7-1 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 1 pair of Hela(cervical cancer) the growth-inhibiting curve of cell, this curve is the mean value in multiple hole;
Fig. 7-2 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 2 pairs of Hela(cervical cancers) the growth-inhibiting curve of cell, this curve is the mean value in multiple hole;
Fig. 7-3 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 3 pairs of Hela(cervical cancers) the growth-inhibiting curve of cell, this curve is the mean value in multiple hole;
Fig. 8-1 is the growth-inhibiting curve of benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 1 pair of normal people's pneumonocyte (HLF-a), and this curve is the mean value in multiple hole;
Fig. 8-2 is the growth-inhibiting curve of benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 2 pairs of normal people's pneumonocytes (HLF-a), and this curve is the mean value in multiple hole;
Fig. 8-3 is the growth-inhibiting curve of benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate compound 3 pairs of normal people's pneumonocytes (HLF-a), and this curve is the mean value in multiple hole;
Fig. 9 is benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate 1the c-myc mRNA acted on two kinds of tumour cells (A549, Hela) and normal cell (HLF-a) transcribes and c-Myc protein expression; [compound]=0,1,5,10 μMs.(a) compound 1with transcribing (Fig. 9 (1)) of the c-myc mRNA of A549 cytosis.(b) compound 1with transcribing (Fig. 9 (2)) of the c-myc mRNA of Hela cytosis.(c) compound 1with the expression (Fig. 9 (3)) of the c-Myc albumen of A549 cytosis.(d) compound 1with the expression (Fig. 9 (4)) of the c-Myc albumen of Hela cytosis.
Embodiment
Below in conjunction with embodiment, the invention will be further described, but protection scope of the present invention is not limited in this:
Embodiment 1: the preparation of compound (I)
By 30.43mg(0.1mmol) benzo [k, l] thioxanthene-3, the 2-aminouridine of 4-dicarboxylic acid anhydride and 24.32mg (0.1mmol) joins in the DMF of 1.0mL, under argon shield and 25.79mg(0.1mmol, excessive 25% mol) DCC(dicyclohexylcarbodiimide) exist under by this solution stirring reaction 25.5 h at 35.5 DEG C, TLC monitors reaction process (chloroform: methyl alcohol=9:1, v/v) Rf=0.55, then, naturally cooling reaction solution, by the throw out-N produced, N-dicyclohexylurea (DCU) element filters out, and use a small amount of acetone rinsing, by gained filtrate with Preparative TLC chromatogram (HF254, the silica-gel plate of 20 × 25 cm, 1.5mm is thick) purifying, take volume ratio as the chloroform of 9:1: methyl alcohol is as eluent, with ethanol, product tape is rinsed, collect elutriant and to be placed in vacuum drying oven drying under lower than the condition of 30 DEG C with Rotary Evaporators removing ethanol and obtain yellow powder 21.36mg, productive rate 40.34%. 1H NMR（600 MHz, DMSO-d 6）: δ 8.48（d, J 5”,6”= 8.4, 1H, 5”-H）, 8.327（d, J 1”,2”= 7.8, 1H, 2”-H）, 7.9（d, J 5,6 = 7.8, 1H, 6-H）, 7.77（d, J 6”,5”= 7.8, 1H, 6”-H）, 7.60（d, J 7”,8”= 7.8, 1H, 7”-H）, 7.48-7.55（m, 3H, 8”-H, 9”-H, 10”-H）, 6.58 （d, J 1’,2’= 3.6, 1H, 1’-H）, 5.68（d, J 5’,6’= 6, 2H, 5’-H）, 5.63（d, J 2’,1’= 6, 1H, 2’-H）, 5.49（t, J 3’,4’= 5.4, 1H, 3’-OH）, 4.49（t, J 5’,4’= 5.4, 1H, 5’-OH）, 4.39-4.43（m, 1H, 4’-H）, 4.33-4.36（m, 1H, 3’-H）, 3.74-3.77（m, 1H, 5’-H）；FAB-Mass: m/z calculated for C 27H 19N 3O 7S: 529.09; found: 530[M+H] +。
Embodiment 2: the preparation of compound (II)
1) intermediate benzo [k, l] thioxanthene-3,4-dicarboximide-N-propionic acid synthesize
By 35.80mg(0.085mmol) benzo [k; l] the 3-alanine of thioxanthene-3,4-dicarboxylic acid anhydride and 8.91mg (0.1mmol) is dissolved in the DMF of 1.2mL under argon shield, then stirring and refluxing 6h; TLC monitors reaction process (chloroform: methyl alcohol=9:1, v/v) R f=0.65.With Rotary Evaporators at 60 DEG C of removing DMF, the residue of gained is dissolved in the mixed solvent of (chloroform: methyl alcohol=8:1, v/v), then silica gel column chromatography is carried out, respectively using chloroform: methyl alcohol=15:1,14:1,10:1 is as eluent, and final separation obtains yellow powder 15mg, and productive rate is 73%. 1H NMR（600 MHz, DMSO-d 6）: δ 8.43（d, J 5,6 = 8.4, 1H, 5-H）, 8.42（d, J 1,2 = 8.4, 1H, 2-H）, 7.68-7.71（m, 2H, 1-H, 6-H）, 7.57（d, J 7,8=7.2, 1H, 7-H）, 7.47-7.52（m, 3H, 8-H, 9-H, 10-H）, 4.24（t, J α,β= 7.8, 2H, β-H）, 2.68（t, J β,α= 7.8, 2H, α-H）。
2) synthesis of target product compound (II)
By 37.53mg(0.1mmol) benzo [k; l] thioxanthene-3; 4-dicarboximide-N-propionic acid and 24.32mg(0.1mmol) 2-aminouridine be dissolved completely in the DMF of 2.0mL; 25.79mg(0.1mmol is added under argon shield; excessive 25% mol) DCC and 16.20 mg(0.12mmol) HOBt(1-hydroxyl benzotriazole); stir 24 h, TLC at 35 DEG C and monitor reaction process (chloroform: methyl alcohol=5:1, v/v) Rf=0.52.Then reaction solution be cooled to 100 DEG C and add 0.2mL hot water.After said mixture cool to room temperature, the sedimentation and filtration of formation is rinsed with a small amount of water, to be then placed in vacuum drying oven dry.The solid of dry gained is dissolved in chloroform again, with purification by silica gel column chromatography, using chloroform: methyl alcohol=9:1 is as eluent.Collect elutriant and obtain yellow powder 22.58mg, productive rate 37.6% with Rotary Evaporators removing eluent. 1H NMR（600 MHz, DMSO-d 6）: δ 8.44（d, J 5”,6”= 8.4, 1H, 5”-H）, 8.26（d, J 1”,2”= 8.4, 1H, 2”-H）, 8.01（d, J 2’,3’= 8.4, 1H, 2’-NH）, 7.89（d, J 6,5 = 8.4, 1H, 6-H）, 7.69（d, J 6”,5”= 7.8, 1H, 6”-H）, 7.57（d, J 7”,6”= 6.6, 1H, 7”-H）, 7.46-7.53（m, 3H, 8”-H, 9”-H, 10”-H）, 5.92（d, J 1’,2’= 8.4, 1H, 1’-H）, 5.68（d, J 5,6 = 6, 1H, 5-H）, 5.63（d, J 3’,4’=4.8, 1H, 3’-OH）, 5.18（d, J 5’,4’= 5.4, 1H, 5’-OH）, 4.49-4.53（m, 1H, 2’-H）, 4.14-4.22（m, 2H, β-H）, 4.08-4.10（m, 1H, 3’-H）, 3.915-3.917（m, 1H, 4’-H）, 3.54-3.60（m, 2H, 5’-H）, 2.50-2.55（m, 2H, α-H）；FAB-Mass: m/z calculated for C 30H 24N 4O 8S: 600.13; found: 491[M-C 4H 4N 2O 2] +。
Embodiment 3: the preparation of compound (III)
The same compound of synthetic route of compound (III) 2, replace 3-alanine with 6-Aminocaproic Acid, obtain yellow powder 36mg, productive rate 56.0%. 1HNMR（600 MHz, DMSO-d 6）: δ 8.47（d, J 5”,6”= 7.2, 1H, 5”-H）, 8.29（d, J 1”,2”= 7.8, 1H, 2”-H）, 7.88（d, J 6,5 = 8.4, 1H, 6-H）, 7.70-7.74（m, 3H, 1”-H, 6”-H）, 7.58（d, J 7”,8”= 7.8, 1H, 7”-H）, 7.47-7.53（m, 3H, 8”-H, 9”-H, 10”-H）, 5.88（d, J 1’,2’= 9, 1H, 1’-H）, 5.67（d, J 5,6 = 7.2, 1H, 5-H）, 5.17（d, J 5’,4’= 5.4, 1H, 5’-OH）, 4.48-4.52（m, 1H, 2’-H）, 4.05-4.07（m, 1H, 3’-H）, 3.97-3.99 （m, 1H, ε-H）, 3.915-3.917（m, 1H, 4’-H）, 3.55-3.60（m, 2H, 5’-H）, 2.13-2.15（m, 2H, α-H）, 1.56-1.61（m, 2H, δ-H）, 1.46-1.51（m, 2H, β-H）, 1.23-1.29（m, 2H, γ-H）；FAB-Mass: m/z calculated for C 33H 30N 4O 8S: 642.18; found: 643[M+H] +。
In following examples, compound 1, compound 2, compound 3refer to the compound (I) in embodiment 1-3, compound (II), compound (III) respectively.
Raw material DNA used in present specification illustrates (Fig. 2-Fig. 5): be 1. rich in guanine single stranded DNA refer to be rich in guanine (G) and comprise 27 base nucleic acids and surpass the black italicized item of photosensitive elements NHE III 1() c-myc promoter region single-stranded DNA sequence:
5-GGGCGCTTA tGGGGAGGGTGGGGAGGGTGGGGAAGG tGGGGAG-3 '; 2. the single stranded DNA (being rich in cytosine(Cyt) (C)) of cytosine(Cyt) is rich in:
5-CTCCCCA cCTTCCCCACCCTCCCCACCCTCCCCA tAAGCGCCC-3 ' 3. double-stranded DNA refer to 1. comprise 27 base nucleic acids surpass the black italicized item of photosensitive elements NHE III 1(with the guanine (G) that is rich in 2. formed) c-myc promoter region double chain DNA sequence (c-myc is rich in guanine double-stranded DNA):
5’-GGGCGCTTA TGGGGAGGGTGGGGAGGGTGGGGAAGG TGGGGAG-3’
3’-CCCGCGAAT ACCCCTCCCACCCCTCCCACCCCTTCC ACCCCTC-5’
4. mismatched dsdna refers to mispairing (the mark black italicized bases) DNA sequence dna (abbreviation) corresponding with 3. double-stranded DNA:
5’-GCGCGCTTAT C G C GAG C GT C G C GAG C GT C G C GAA C GTCGCGAG-3’
3’-CGCGCGAATA G C G CTC G CA G C G CTC G CA G C G CTT G CAGCGCTC -5’
In a specific embodiment, embodiment 4,5, if DNA used does not have specified otherwise consistent with defined DNA here in 6, above DNA is purchased from Shanghai Sheng Gong biotechnology company limited.
Embodiment 4: 3 compounds that the present invention obtains and the interactional Native-PAGE of c-myc gene promoter region sequence analyze
1) preparation of electrophoresis Sample: the final volume of each electrophoresis Sample is 10 μ L, and in sample, the final concentration of DNA is 1 μM, the content of DMSO is 2%, according to the proportionlity of DNA and compound, is mixed with the solution of different concns.After all samples has been prepared, with metal bath sex change 10 min at 95 DEG C, after naturally cooling to room temperature, hatch 24 hours in 4 DEG C of refrigerators, stand-by;
2) preparation (16% Native-PAGE, table 1) of 16% non-denaturing polyacrylamide gel: for investigating compound and c-myc promoter region DNA sequence dna interaction property.
Table 1 16% non-denaturing polyacrylamide gel formula
3) Native-PAGE deposition condition: 100V prerunning 30min.Get 6 × Loading buffer that sample 1.5 μ L that step 1) prepares adds 0.5 μ L and make electrophoresis Sample, join in loading wells with micropipet.Adopt constant voltage mode, arranging voltage is 100 V, and temperature is 4 DEG C, and electrophoresis time is generally 8-9h.After electrophoresis terminates, glue to be stripped down and with after washed with de-ionized water from offset plate, with SYBR Gold nucleic acid dye (1 × tbe buffer liquid dilution of the SYBR Gold 20mL of 2 μ L) dyeing 30min, deionized water rinsing 2 times, then be placed in gel imaging instrument and observe and imaging, the results are shown in Figure 2.
The interpretation of result of glue from Fig. 2: three compounds have effect to a certain degree with the double-strand and single stranded DNA that are rich in guanine base, and this effect is concentration dependent; But the mispairing double-strand not being rich in guanine is acted on hardly with the single stranded DNA being rich in cytosine(Cyt).These results illustrate: compound selectively and be rich in guanine be especially rich in guanine double-stranded DNA produce stronger specific effect.
Embodiment 5: compound is to c-myc gene promoter region sequence thermal stability analysis
With UV-melting technical research compound and c-myc gene promoter region sequence interaction ability and the impact on DNA thermostability thereof in the present invention.
1) preparation of sample: the final volume of sample is 600 μ L, and in sample, the final concentration of DNA is 2 μMs, containing 10mM Tris-HCl, 0.1 mM EDTA and 150 mM KCl in damping fluid, according to the proportionlity of DNA and compound, is mixed with the solution of different concns.After all samples has been prepared, with metal bath sex change 10min at 95 DEG C, after naturally cooling to room temperature, hatch 24 hours in 4 DEG C of refrigerators;
2) Tm pH-value determination pH: proceed in quartz colorimetric utensil by above-mentioned sample, is placed in the ultraviolet spectrometer (Shimadzu UV-2550) being equipped with temperature control system (Shimadzu S-1700) and measures absorbancy.Measure wavelength and be set to 260nm, starting temperature is set to 10 DEG C, and final temperature is set to 95 DEG C, and temperature rise rate is set to 1 DEG C/min, and each test sample, at starting temperature balance 10min, the results are shown in Figure 3;
3), after test terminates, the T of each sample is calculated by ultraviolet spectrometer data handling system mvalue, as shown in table 2, table 2 is the solvent temperature (Tm value) of three kinds of benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate 1-3 and c-myc DNA effect.
Table 2. c-myc DNA is at compound 1-3t under presence or absence mvalue
As shown in table 2, UV-melting experiment can be found out, compound can improve the thermostability of c-myc double-stranded DNA, and this action effect is certain concentration dependent, three kinds of compounds have identical effect trend, can increase the T of DNA to a certain extent mvalue.Wherein the action effect of compound (I) is best, makes T mthe amplitude that value increases is maximum; And for mispairing c-myc double-stranded DNA and be rich in the strand of cytosine(Cyt), compound on it almost without affecting, T mthe change of value is also quite little, almost negligible.It can be said that bright, compound optionally acts on the c-myc double-stranded DNA being rich in guanine.
Embodiment 6: compound and the interactional circular dichroism spectrum of c-myc gene promoter region sequence are tested
By circular dichroism spectrum (CD) technical research compound and c-myc gene promoter region sequence interaction ability and essence in the present invention.Parallel type G-tetra-serobila has positive maximum absorption near 260-265nm, and 240-245nm has negative maximum absorption; G-tetra-serobila of antiparallel type has just maximum absorption near 290-295nm, and 260nm has negative maximum absorption; Hybrid-type G-tetra-serobila configuration then include near 290nm just absorb and feature 265 nm near acromion.The CD spectrum signature of typical B configuration DNA: have a positive absorption peak to correspond to the packed structures of nucleic acid base at 270-280nm place, and have a negative absorption peak to correspond to the double-spiral structure of nucleic acid at 248-255nm place.
a () compound and c-myc gene promoter region sequence are rich in the effect of guanine base double-stranded DNA
1) preparation of samples: the buffer preparation of DNA containing potassium ion is become (2 μMs, 600 μ L) sample, carry out the process of sex change renaturation and (in thermostat water bath, be slowly warming up to 95 DEG C, sex change 10 minutes, Temperature fall, to room temperature, is positioned over 4 DEG C of refrigerators and hatches 24 hours).Respectively benzo of the present invention [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate DMSO is mixed with the solution for standby of 1.2mM;
2) sample being proceeded to path length is in the cuvette of 5mm, and be placed in J-815 circular dichroism spectrometer (JASCO) and measure, arranging scanning wavelength scope is 600-220nm, and sweep velocity is 100nm/min, and slit width is 5.0nm.In test process, drip the above-mentioned compound solution prepared every the set time, every 5min pipettor blows and stirs once, puts into apparatus measures after 15min.The ratio of DNA and compound is respectively: 1/0, and 1/1,1/2,1/4,1/8,1/16,1/24,1/32,0/10.Each Sample Scan three times, averages;
The CD experimental result shown as Fig. 4-1, Fig. 4-2 and Fig. 4-3 can find out that compound can induce the formation of hybrid G-tetra-serobila to a certain extent, thus the disperse conditions of streaking explained in gel electrophoresis experiment is exactly that this structure causes.In Fig. 4-1, compound (I) is stronger with target DNA effect, target DNA is after progressively dripping compound, double-stranded DNA characteristic peak 275nm place posivtive spike weakens gradually, occurs posivtive spike at 290nm and 260nm place, has illustrated that antiparallel or hybrid and run-in index G-tetra-serobila DNA produce; Further, stronger at 425-550nm scope ICD, these information illustrates that compound (I) has and induces more by force target double-strand c-myc DNA form the ability of G-tetra-serobila and have with it strong bonding force.Other two kinds of compounds 2- 3also similar effect is in various degree there is with target double-strand c-myc DNA.But from CD spectrum, also can show that final mixture exists a certain amount of double-stranded DNA; Especially, compound (III) is more weak with target double-strand c-myc DNA effect, and most of DNA still exists with duplex or single stranded form, there is part G-tetra-stranded structure simultaneously, is in a kind of state of mixture.Because compound itself has chirality, also there is the CD of self, and show certain ICD(induction CD), can affirm that compound and DNA there occurs effect, but specifically any binding mode, can not directly draw thus, checking must be studied further by other method.
b () compound and c-myc gene promoter region sequence are rich in the effect of guanine base single stranded DNA
sample is that c-myc gene promoter region sequence is rich in guanine base single stranded DNA, and preparation of samples and measuring method are as (a).Compound concentration: 0 μM, 2 μMs, 4 μMs, 8 μMs, 16 μMs, 32 μMs, 48 μMs, 64 μMs, 80 μMs, the results are shown in Figure 5-1, Fig. 5-2 and Fig. 5-3 shows, Fig. 5-1, Fig. 5-2 and Fig. 5-3 show and show, three compounds are all not so good as to target DNA effect that corresponding to be rich in guanine base double-stranded DNA strong, illustrate that compound is good to double-stranded DNA selectivity.Compound (I) is still better than compound (II) and compound (III) to single stranded DNA effect, and inducing DNA produces a certain amount of antiparallel or hybrid G-tetra-serobila DNA structure, at 300-350nm and 425-550nm, produce stronger CD posivtive spike, come from the CD of ICD and compound itself, compound (II) is the poorest with target DNA effect.
Embodiment 7: the anti tumor activity in vitro of compound
A () compound is to the growth-inhibiting of A549 (nonsmall-cell lung cancer) cell
Material: A549 cell (non-small cell lung cancer cell is purchased from Microbe Inst., Chinese Academy of Sciences's strain culturing preservation center, Beijing), 1640 substratum, 0.25% pancreatin.
RTCA experiment (three holes repeat to test): the initial experiment condition of setting real-time cell analyser.E-Plate 96 orifice plate is placed on the cytoanalyze in constant incubator, scanning background value.In the every hole of E-Plate 96 orifice plate, add 100 μ L cell suspensions, make the cell count in each hole be approximately 10000, at being placed on 37 DEG C, hatch 30min.Afterwards E-Plate 96 orifice plate is put back to the enterprising line scanning of real-time cell analyser and can obtain continuous print cell index curve.Treat that tumour cell enters logarithmic phase after about 24 h, suspend scanning, take off E-Plate 96 orifice plate, in each hole of experimental group, add 5 μ L target compounds of different concns, its concentration gradient is 0.5 μM, 1.0 μMs, 2.0 μMs, 4.0 μMs, 8 μMs.Cell culture fluid is reference, and 2%DMSO tests as a comparison.
As shown in Fig. 6-1, Fig. 6-2 and Fig. 6-3 show, the exercising result of three compounds to A549 cell shows: this compounds is all in concentration dependent to the growth-inhibiting of A549 cell.Compound (I) just goes out certain restraining effect to A549 cells show when concentration is 0.5 μM, and along with compound concentration is increasing, restraining effect is also more and more stronger, to the growth that almost completely inhibit A549 cell during peak concentration 8 μMs.Compound (II) is when concentration is 0.5 μM, and its cytotoxicity is not clearly.Along with compound concentration is increased to 1.0 μMs, compound starts to go out certain growth-inhibiting effect to A549 cells show.Along with the increase of compound concentration, it also strengthens gradually to the growth-inhibiting effect of cell.Compound (III) just goes out obvious restraining effect to A549 cells show when concentration is 0.5 μM.But along with the continuation of compound concentration increases, it is not so good as compound (I) and compound (II) to the increasing degree of cyto-inhibition.
B () compound is to the growth-inhibiting of Hela (cervical cancer) cell
Experiment material, method is with (a).Experimental result as shown in Figure 7.
Fig. 7-1, Fig. 7-2 and Fig. 7-3 shows and shows, three compounds are to Hela cell (cervical cancer cell, be purchased from Microbe Inst., Chinese Academy of Sciences's strain culturing preservation center, Beijing) the display of cytotoxic effect result: compound is to Hela(cervical cancer) growth-inhibiting of cell is all in concentration dependent.Compound (I) to the action effect of Hela cell clearly, just shows inhibition significantly when concentration is 0.5 μM, and during to peak concentration 8 μMs, the growth of Hela cell receives suppression completely.When compound (II) concentration is 0.5 μM, the growth of Hela cell starts to occur suppression situation, and concentration continues to increase, and restraining effect is also strengthened further.There is the growth inhibitory effect to cell in compound (III), during to peak concentration 8 μMs, go out strong growth inhibitory effect to cells show from 0.5 μM of concentration.
C () compound is to the growth-inhibiting of normal HLF-a (human pneumonocyte) cell
Experiment material, method is with (a).Its compound concentration gradient is 1.0 μMs, 5.0 μMs, 10 μMs, 20 μMs, 40 μMs.Experimental result is as shown in Fig. 8-1, Fig. 8-2 and Fig. 8-3 show.
Three compounds are to normal HLF-a cell (human pneumonocyte, be purchased from Microbe Inst., Chinese Academy of Sciences's strain culturing preservation center, Beijing) the display of cytotoxic effect result: except compound (I) has faint effect to HLF-a cell when concentration 20 μMs and 40 μMs, the compound of all investigations produces inhibition hardly to the growth of HLF-a cell in investigated concentration range, although maximum experimental concentration reaches 40 μMs.Illustrate that three kinds of compounds almost do not act on normal cell.
By the analysis of the real-time cell apoptosis data to two kinds of tumour cells (A549, Hela) and Normal Lung cell (HLF-a), show that three kinds of compounds are to the IC of three kinds of experimental cell effects 50value (as shown in table 3).
Table 3 is three kinds of benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugates 1- 3the IC acted on two kinds of tumour cells (A549, Hela) and normal cell (HLF-a) 50value.
From the IC of table 3 50value illustrates that compound (I) has stronger inhibition to two kinds of tumour cells, and compound (II), compound (III) have certain inhibition to two kinds of tumour cells, and three kinds of compounds are to normal pneumonocyte HLF-a almost no effect under experimental concentration.
Embodiment 8: compound 1tumour cell c-myc mRNA is transcribed and the impact of c-Myc protein expression
In order to prove that this compounds produces inhibiting by lowering c-myc genetic expression to the tumour cell of high expression level c-myc, completing compound (I) in research and tumour cell c-myc mRNA being transcribed and the experiment of impact of c-Myc protein expression.
A () A549 (nonsmall-cell lung cancer) and the c-myc mRNA of Hela (cervical cancer) cell under compound (I) exists transcribes
Material: A549 (nonsmall-cell lung cancer) cell Hela (cervical cancer) cell, in RPMI 1640 substratum (containing 10% foetal calf serum, 100 U/mL penicillin and 100 U/mL Streptomycin sulphates), 37 DEG C, the CO of 5% 2, cultivate under saturated humidity.
Method: undertaken by the technical specification of RT-PCR kit.First in vitro object tumour cell Hela and A549 cell is cultivated, when its growth conditions to be seen is good, through digestion, resuspended, counting, with 2 × 10 5cell/ hole is inoculated in 12 orifice plates, arranges compound 1working concentration be: 0 μM, 1 μM, 5 μMs, 10 μMs.After adding medicine 24h, collect the tumour cell after compound effects, extract tumour cell total serum IgE.Leaching process uses the RNeasy mini kit test kit of QIAGEN company, operates by technical requirements.
The primer sequence used in PCR experiment is (being synthesized by Shanghai Sheng Gong company):
C-myc upstream 5 '-AGAGA AGCTG GCCTC CTACC-3 '
Downstream 5 '-CGTCG AGGAG AGCAG AGAAT-3 '
β-actin upstream 5 '-AGC GGG AAA TCG TGC GTG ACA-3 '
Downstream 5 '-GTG GAC TTG GGA GAG GAC TGG-3 '
(1) by following composition preparation PCR reaction solution, total system 25 μ L.
(2) PCR reaction conditions is as follows:
1) sex change: 95 DEG C, 2 min
2) circulate: 94 DEG C, 15 sec; 62 DEG C, 30 sec; 72 DEG C, 1 min; 30 cycles
3) extend: 72 DEG C, 10 min
4) preserve: 4 DEG C.
After PCR reaction terminates, the PCR reaction solution respectively getting 5 μ L carries out agarose gel electrophoresis, and to take pictures preservation by gel ultraviolet imagery system.Experimental result is as figure 9(1) (A549 cell) and (2) (Hela cell).Result shows: compared with control group, compound 1the suppression of transcribing the c-myc mRNA of tumour cell is concentration dependent, when concentration reaches 10 μMs, produces stronger restraining effect.
The expression of (b) A549 (nonsmall-cell lung cancer) and the c-Myc albumen of Hela (cervical cancer) cell under compound (I) exists
(1) tumor cell proteins extracts
1) A549 cell and Hela cell is cultivated, with 5 × 10 5cell/ hole is inoculated in 6 orifice plates.The compound (I) of preparation different concns, concentration is respectively 0 μM, 1 μM, 5 μMs, 10 μMs.After 6 orifice plate inner cells grow about 20h, drop into different concns compound, with reference to adding equal-volume nutrient solution;
2) after 24 hours, the tumor cell of Different factor process is collected in compound effects;
3) add 3mL PBS and clean cell precipitation, the centrifugal 5min of 1000rpm, abandoning supernatant;
4) add appropriate cell pyrolysis liquid, add the proteinase inhibitor that final concentration is 1 mM immediately, on ice cracking 30min;
5) 4 DEG C of 12000 centrifugal 5min of rpm, collects supernatant (being total protein of cell), and BCA method measures protein concentration, and-80 DEG C save backup.
(2) protein immunoblot (Western bloting)
1) according to BCA quantitative result, adjustment each sample volume makes its loading Tot Prot consistent (10-100 μ g).
2) according to 4:1 ratio by protein sample and mixing, mixed with the ratio of 4:1 with 5 × albumen sample-loading buffer by the protein sample having surveyed protein content, 95 DEG C of metal baths heating 5min, make the abundant sex change of albumen.
3) in loading hole, carefully add sample and Marker, switch on power, carry out electrophoresis.
4) transferring film.According to the Protein Marker added, confirm the required position of size protein band on gel, then take desirable proteins bar out of gel and cut.Follow the order of negative electrode-support pad-filter paper-gel-NC film-filter paper-support pad-anode, make " sandwich " structure of electric transferring film, confirm anode and cathode position, be placed in electrophoresis chamber, add 1 × transferring film damping fluid, under condition of ice bath, constant current mode 250 mA transferring film 1 h.
5) close.After transferring film, take out the film turning and have albumen, in containing the TBST solution of 5% skim-milk, use shaking table jog 1 h.
6) in conjunction with primary antibodie.Close and terminate, the film closed is dipped in the mixed solution of TBST(Tris-HCl buffer salt solution and a kind of non-ionic detergent (Tween)) slightly do rinsing in solution, make enclosed space, add primary antibodie, be put in 4 ° of C refrigerator overnight.
7) resist in conjunction with two.Take out the film in conjunction with primary antibodie, rinsing 5 min × 3 time in TBST solution.By two anti-1:10000 dilutions, take out film be dipped in two anti-in.In conjunction with 1 h under room temperature.TBST solution rinsing 5min × 3 time are reused after end.
8) by test kit, preparation nitrite ion ECL is described, A liquid and B liquid join in 1mL pure water in each 50 μ L of 1:1 ratio, mixing.NC film is taken out, nitrite ion is dripped on the surface of film, under room temperature condition, acts on about 2min.Then use preservative film by film environmental sealing, put in X-ray shadow box, use scotch tape to fix.
9) in dark place, get film and be placed in fast in magazine, expose 1min, 2min, 5min and 10 min respectively, operating process is wanted rapidly.
10) develop.Use 1 × film development liquid of new preparation, take out film in magazine, be dipped in developing solution, after obvious band to appear, proceed in clear water and slightly do rinsing, finally immerse in stop bath fixing, again wash, dry up.
Test result as figure 9(3) (A549 cell) and (4) (Hela cell).Result as shown in Figure 9 illustrates: compared with control group, the protein expression level of the c-Myc gene of tumour cell presents reduction in various degree, presents dose-dependent relation, and the protein expression of compound (I) on A549 cell c-Myc has larger impact.Experimental result is substantially identical with the result of RT-PCR.
These two description of tests above: the suppression of compound on tumor cell lowers the mRNA of c-myc gene and the expression of albumen from compound.

Claims (7)

1. benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate, it is characterized in that comprising following three kinds of compounds, structural formula is respectively as shown in formula I, formula II, formula III:
。
2. a benzo [k as claimed in claim 1, l] thioxanthene-3, the preparation method of 4-dicarboxylic acid anhydride analog derivative-uridine conjugate, it is characterized in that with benzo [k, l] thioxanthene-3, 4-dicarboxylic acid anhydride and 2-aminouridine are raw material, DMF is solvent, DCC is condensing agent, at 35 DEG C, 24-26 hour is reacted under argon shield, after TLC monitoring reaction terminates, the N of ripple removing formation will be crossed after reaction solution cooling, N-dicyclohexylurea precipitate, use acetone rinsing again, collect filtrate and be further purified by Preparative TLC chromatogram, thin-layer chromatography is using the mixed solution of chloroform and methyl alcohol as developping agent, rinse as the product tape of eluent by correspondence with ethanol, collect elutriant, revolve steaming removing ethanol and be placed on the compound (I) that vacuum-drying at 30 DEG C obtains yellow powder.
3. a benzo [k as claimed in claim 1, l] thioxanthene-3, the preparation method of 4-dicarboxylic acid anhydride analog derivative-uridine conjugate, it is characterized in that first by benzo [k, l] thioxanthene-3, 4-dicarboxylic acid anhydride and 3-alanine are obtained by reacting benzothioxanthene-3, 4-dicarboximide-N-propionic acid, again by benzothioxanthene-3, 4-dicarboximide-N-propionic acid and 2-aminouridine react 24-26 hour using DCC as condensing agent in DMF under argon shield at 35 DEG C, after TLC monitoring reaction terminates, by the N that the removing of reaction solution cooled and filtered is formed, N-dicyclohexylurea precipitate, with acetone rinsing, collect filtrate and be further purified by Preparative TLC chromatogram, thin-layer chromatography is using the mixed solution of chloroform and methyl alcohol as developping agent, rinse as the product tape of eluent by correspondence with ethanol, collect elutriant, revolve and steam removing ethanol, and be placed in the compound (II) that vacuum-drying at 30 DEG C obtains yellow powder.
4. a benzo [k as claimed in claim 1, l] thioxanthene-3, the preparation method of 4-dicarboxylic acid anhydride analog derivative-uridine conjugate, it is characterized in that by benzo [k, l] thioxanthene-3, 4-dicarboxylic acid anhydride and 6-Aminocaproic Acid are obtained by reacting benzothioxanthene-3, 4-dicarboximide-N-is sour, again by benzothioxanthene-3, 4-dicarboximide-N-acid and 2-aminouridine reacts 24-26 hour using DCC as condensing agent in DMF under argon shield at 35 DEG C, after TLC monitoring reaction terminates, by the N that the removing of reaction solution cooled and filtered is formed, N-dicyclohexylurea precipitate, with acetone rinsing, collect filtrate and be further purified by Preparative TLC chromatogram, thin-layer chromatography is using the mixed solution of chloroform and methyl alcohol as developping agent, rinse as the product tape of eluent by correspondence with ethanol, collect elutriant, revolve and steam removing ethanol, and be placed in the compound (III) that vacuum-drying at 30 DEG C obtains yellow powder.
5. benzo as claimed in claim 1 [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate is preparing the application in antitumor drug.
6. the application of benzo as claimed in claim 1 [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate in the medicine of preparation treatment cervical cancer, Non-small cell lung carcinoma.
7. benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridine conjugate as claimed in claim 5 is preparing the application in antitumor drug, the antitumor drug that to it is characterized in that with c-myc gene be target.
CN201410619540.8A 2014-11-06 2014-11-06 Benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridnine conjugate and its preparation method and application Active CN104610276B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410619540.8A CN104610276B (en) 2014-11-06 2014-11-06 Benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridnine conjugate and its preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410619540.8A CN104610276B (en) 2014-11-06 2014-11-06 Benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridnine conjugate and its preparation method and application

Publications (2)

Publication Number Publication Date
CN104610276A true CN104610276A (en) 2015-05-13
CN104610276B CN104610276B (en) 2016-08-17

Family

ID=53144954

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410619540.8A Active CN104610276B (en) 2014-11-06 2014-11-06 Benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridnine conjugate and its preparation method and application

Country Status (1)

Country Link
CN (1) CN104610276B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115109079A (en) * 2022-06-21 2022-09-27 南京工业大学 Polyurethane degrading enzyme specific fluorescent probe, preparation method and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4115555A (en) * 1976-09-29 1978-09-19 E. R. Squibb & Sons, Inc. 2-Substituted-1H-benz[de]-isoquinoline-1,3(2H)-diones
US20070167441A1 (en) * 2003-03-24 2007-07-19 Halbrook James W Xanthones, thioxanthones and acridinones as dna-pk inhibitors
CN101279967A (en) * 2008-05-29 2008-10-08 武汉远大制药集团有限公司 Medicinal composition of trimethyl xanthone-4-acetic acid for treating cancer and use thereof
EP1280764B1 (en) * 2000-03-24 2010-11-24 Methylgene, Inc. Inhibitors of histone deacetylase

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4115555A (en) * 1976-09-29 1978-09-19 E. R. Squibb & Sons, Inc. 2-Substituted-1H-benz[de]-isoquinoline-1,3(2H)-diones
EP1280764B1 (en) * 2000-03-24 2010-11-24 Methylgene, Inc. Inhibitors of histone deacetylase
US20070167441A1 (en) * 2003-03-24 2007-07-19 Halbrook James W Xanthones, thioxanthones and acridinones as dna-pk inhibitors
CN101279967A (en) * 2008-05-29 2008-10-08 武汉远大制药集团有限公司 Medicinal composition of trimethyl xanthone-4-acetic acid for treating cancer and use thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN115109079A (en) * 2022-06-21 2022-09-27 南京工业大学 Polyurethane degrading enzyme specific fluorescent probe, preparation method and application thereof

Also Published As

Publication number Publication date
CN104610276B (en) 2016-08-17

Similar Documents

Publication Publication Date Title
Abbass et al. Design, efficient synthesis, docking studies, and anticancer evaluation of new quinoxalines as potential intercalative Topo II inhibitors and apoptosis inducers
El-Adl et al. [1, 2, 4] Triazolo [4, 3-c] quinazoline and bis ([1, 2, 4] triazolo)[4, 3-a: 4′, 3′-c] quinazoline derived DNA intercalators: Design, synthesis, in silico ADMET profile, molecular docking and anti-proliferative evaluation studies
Khalifa et al. Topo II inhibition and DNA intercalation by new phthalazine-based derivatives as potent anticancer agents: design, synthesis, anti-proliferative, docking, and in vivo studies
Ali et al. Facile synthesis of indole heterocyclic compounds based micellar nano anti-cancer drugs
CN107056772A (en) Bifunctional molecule and its preparation and the application of BET degradeds are induced based on cereblon parts
CN101323591A (en) 5- or 6-substited naphthoyl imines compounds and antineoplastic application
CN105669763B (en) Different aporphine platinum (II) complex of 9 amino groups and its synthetic method and application
CN107698575A (en) The bifunctional molecule of novel B ET protein degradations ligand-mediated cereblon and its preparation and application
CN107266417A (en) A kind of indoles ethene substd quinolines analog derivative and its preparation method and application
CN110143961A (en) A kind of pyrrolopyridine ketone bifunctional molecule compound based on the induction BET degradation of VHL ligand
CN106854210B (en) The water-soluble porphyrin of phenolic ketone containing adjacent nitro and its Schiff copper porphyrin complex, its synthetic method and application
CN106749513A (en) Bifunctional molecule and its preparation and application based on the induction BET degradeds of VHL parts
CN108101926B (en) Pyrimido five-membered heterocyclic compound containing quinolinone, preparation method and application thereof
CN111423419B (en) Small molecular compound cyy-260 and application thereof in preparation of antitumor drugs
CN104072493A (en) Naphthalimide compound containing 2-mercaptobenzothiazole and triazole heterocycle, preparation method and application thereof
CN108164463A (en) A kind of 1,8- Naphthalamide derivatives and its synthetic method and application with non-small cell lung cancer selective inhibitory
Sun et al. Design and synthesis of β-carboline derivatives with nitrogen mustard moieties against breast cancer
Loza-Mejía et al. Synthesis, cytotoxic activity, DNA topoisomerase-II inhibition, molecular modeling and structure–activity relationship of 9-anilinothiazolo [5, 4-b] quinoline derivatives
CN104610276B (en) Benzo [k, l] thioxanthene-3,4-dicarboxylic acid anhydride analog derivative-uridnine conjugate and its preparation method and application
Jassem et al. An alternative technique for cyclization synthesis, in vitro anti-esophageal cancer evaluation, and molecular docking of novel thiazolidin-4-one derivatives
CN101816649A (en) Preparation method of 2,3-indolediketone-3-oxime and application in prevention and control of cancer
CN108779112A (en) Substituted benzene-naphthalene diimide class and application thereof
CN107417598B (en) Fluorescent probe for detecting G-quadruplex DNAs (deoxyribonucleic acids) and preparation method thereof
CN107973788A (en) BBI608 derivatives and its preparation and purposes
CN107033064B (en) A kind of 3- (morpholine replaces fragrant imido grpup) Benzazole compounds and its preparation method and application

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20210629

Address after: Room 524, building 4, 20 Longtan Road, Cangqian street, Yuhang District, Hangzhou City, Zhejiang Province

Patentee after: HANGZHOU QINGZHENGHONG TECHNOLOGY Co.,Ltd.

Address before: 310014 Zhejiang University of Technology, 18, Chao Wang Road, Xiacheng District, Hangzhou, Zhejiang

Patentee before: ZHEJIANG University OF TECHNOLOGY

TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20230906

Address after: Room 524, building 4, 20 Longtan Road, Cangqian street, Yuhang District, Hangzhou City, Zhejiang Province

Patentee after: HANGZHOU QINGZHENGHONG TECHNOLOGY CO.,LTD.

Patentee after: Zhejiang Jieyuan Pharmaceutical Technology Co.,Ltd.

Address before: Room 524, building 4, 20 Longtan Road, Cangqian street, Yuhang District, Hangzhou City, Zhejiang Province

Patentee before: HANGZHOU QINGZHENGHONG TECHNOLOGY CO.,LTD.

TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20231219

Address after: 017000 Office Building 604-4, Dalate Economic Development Zone Management Committee, Dalate Banner, Ordos City, Inner Mongolia Autonomous Region

Patentee after: Inner Mongolia Changhe Hongyuan Pharmaceutical Technology Co.,Ltd.

Address before: Room 524, building 4, 20 Longtan Road, Cangqian street, Yuhang District, Hangzhou City, Zhejiang Province

Patentee before: HANGZHOU QINGZHENGHONG TECHNOLOGY CO.,LTD.

Patentee before: Zhejiang Jieyuan Pharmaceutical Technology Co.,Ltd.

TR01 Transfer of patent right