CN104593378B - Class human thymosin alfa 1 gene order, class human thymosin alfa 1 and preparation method thereof - Google Patents
Class human thymosin alfa 1 gene order, class human thymosin alfa 1 and preparation method thereof Download PDFInfo
- Publication number
- CN104593378B CN104593378B CN201510004144.9A CN201510004144A CN104593378B CN 104593378 B CN104593378 B CN 104593378B CN 201510004144 A CN201510004144 A CN 201510004144A CN 104593378 B CN104593378 B CN 104593378B
- Authority
- CN
- China
- Prior art keywords
- human thymosin
- thymosin alfa
- class human
- alfa
- class
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to genetic engineering pharmaceutical technical field, and in particular to a species human thymosin alfa 1 gene order, class human thymosin alfa 1 and preparation method thereof.The peptide amino acid sequence is, SDAAVDTSSEITTKDLKEKKEVVEEAEQ.The preparation method of the peptide include design of primers, PCR amplifications, digestion, from connection, construction recombination plasmid expression vector, conversion, screening, the transformation of recombinant plasmid vector, convert again, induced expression, the purifying of concatermer class human thymosin alfa 1, cut the acquisition step such as class human thymosin alfa 1 protein monomer.Class human thymosin alfa 1 monomer provided by the present invention is similar with human thymosin alfa 1 structure, and biological function is identical, can substitute the use of human thymosin alfa 1.The preparation method of class human thymosin alfa 1 provided by the present invention, has the advantages that yield is high, purity is high, preparation method is simple and efficient, suitable for popularization and application simultaneously.
Description
Technical field
The invention belongs to genetic engineering pharmaceutical technical field, and in particular to a species human thymosin alfa 1 gene order, class people
Thymosin alpha 1 and preparation method thereof.
Background technology
Thymosin alpha 1 is from ox thymosin fraction 5 earliest by Goldstein etc.（TF5）In separate, be a kind of chest
A kind of highly conserved active peptide that gland endocrine cell is produced with thymic epithelial cells.Thymosin alpha 1 is by α 1- chests in vivo
Gland peptide former (prothymosine) is processed through enzymolysis, and ripe Thymosin alpha 1 contains 28 amino acid, its amino acid sequence
For：Ser-Asp-Ala-Ala-Val-Asp-Thr-Ser-Ser-Glu-Ile-Thr-Thr-Lys-Asp-Leu-Lys-Glu-
Lys-Lys-Glu-Val-Val-Glu--Glu-Ala--Glu-Asn, molecular weight is 3.108KD, and isoelectric point is 4.2.
Normal concentration of the Thymosin alpha 1 in human serum is about 540 ~ 670pg/mL, and its main Physiological Function is regulation
Human immunologic function, including stimulate pluripotent stem cell differentiation to be thymocyte, promote differentiation and the maturation of T- cells, enhancing T is thin
The function of born of the same parents, and make CD3+And CD4+Isocellular quantity rise etc..Thymosin alpha 1 faces as a kind of immunomodulator of wide spectrum
Bed result has shown that it has significant curative effect to hepatitis B and hepatitis C, also has certain curative effect to tumour and AIDS.This
Outer Thymosin alpha 1 can be additionally used in the assistant medicament of vaccine, to strengthen responsibility of the patient under immunity function to vaccine.
In the prior art, the preparation of Thymosin alpha 1 is extracted from animal thymus mostly, but is due to that extract is mixing
Thing, active ingredient concentration is low, and curative effect is not ideal enough, and contains animal protein in mixture, may be caused allergic reaction during injection.
Also have using being chemically synthesized to prepare Thymosin alpha 1, but its subject matter is with high costs, it is difficult to popularization and application.For example
The thymic peptide a1 products of medicine entitled " Zadaxin ", often containing only amount only 1.6mg, and price is up to more than 700 yuan, a course for the treatment of
More than 50,000 yuan is accomplished by, this allows common patient to be difficult to bear, and pollution problem occurs unavoidably in chemicals preparation process,
Thus limit the popularization and application of the technology.
Also there is researcher to attempt to prepare Thymosin alpha 1 by the method for genetic engineering in recent years, pass through genetic engineering
Using, although the recombinant protein obtained in successful expression Thymosin alpha 1, but preparation process needs by affine layer in vitro
The steps such as analysis, ion-exchange chromatography, digestion, and yield poorly, purification difficult is not appropriate for mass, industrialized production, thus
It is necessary to continue to explore and improve.
The content of the invention
Present invention aims at provide a species human thymosin alfa 1 gene order, class human thymosin alfa 1 and preparation method thereof；
The class human thymosin alfa 1 of the coded translation of class human thymosin alfa 1 gene order has and human thymosin alfa 1 identical function；There is provided
The preparation method of class human thymosin alfa 1 can relatively simple in a short time, rapidly obtain substantial amounts of class human thymosin alfa 1,
So as to substitute the use of human thymosin alfa 1, its use cost is reduced.
The technical solution used in the present invention is as follows.
The gene order of class human thymosin alfa 1, its sequence is as shown in sequence 1 in sequence table, specially：
5’-CTGCTCGGCTTCTTCCACAACCTCTTTCTTTTCTTTTAAGTCTTTCGTAGTTATTTCACTGCTGGT
ATCGACCGCAGCATCCGA -3’。
Class human thymosin alfa 1 coded by class human thymosin alfa 1 gene order, the peptide includes 28 amino acid, its amino acid
Sequence is as shown in sequence 2, specially：SDAAVDTSSEITTKDLKEKKEVVEEAEQ.
Class human thymosin alfa 1 can substitute existing human thymosin alfa 1 in the application of field of medicaments.
The preparation method of the class human thymosin alfa 1, comprises the following steps：
（1）Gene order to encode class human thymosin alfa 1 designs primer, PCR amplifications as template；
Enter performing PCR amplification to encode the gene order of class human thymosin alfa 1 as template, design of primers is carried out first, primer is set
Meter purpose is that the C-terminal in gene adds restriction enzyme BslI restriction enzyme sites, and N-terminal adds restriction enzyme A lwnI enzymes
Enzyme site, primer sequence design is as follows：
- the ATACCTAATGTCGGATGCTGCGGTCGATACCAGC -3 ' of sense primer 5 '；
- the ATACAGCATCTGCTCGGCTTCTTCCACAACCTCTT-3 ' of anti-sense primer 5 '；
PCR amplification system：
Class human thymosin alfa 1 gene, 0.1 μ L；
Sense primer, 100 μM of 0.5 μ L；
Anti-sense primer, 100 μM of 0.5 μ L；
PCR expands Mix, 12.5 μ L；
Tri-distilled water, 11.4 μ L.
PCR amplification programs：Pre-degeneration 95 DEG C of 5min, 95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 30 circulations, 72 DEG C
10min。
（2）To step（1）The class human thymosin alfa 1 gene order of middle PCR amplifications carries out digestion, from connecting, and structure contains class
Human thymosin alfa 1 gene order difference copy number purpose recombinant plasmid expression vector；It is specific as follows：
1. the digestion of target gene, certainly connection
By step（1）Middle PCR primer first cuts 4h under the conditions of 37 DEG C with enzyme AlwnI, and digestion system is：
The μ L of enzyme AlwnI, 10000U/mL 0.5,
CutSmart Buffer (are provided) with enzyme, 2 μ L；
Step（1）Middle PCR primer, 10 μ L；
Tri-distilled water, 7.5 μ L.
Temperature is gradually increased to 55 DEG C after the completion of digestion, then adds in original system 0.5 μ L enzymes BslI（20000U/
mL）Cut 1h.
Target gene is standby after glue reclaim double digestion, and the target gene is class human thymosin alfa 1 gene.
Make its from beginning to end with T4 DNA ligases connection target gene, linked system is：
10X T4 DNA ligase reaction buffers, 2 μ L；
T4 DNA ligases, the μ L of 350U/ μ L 1；
Target gene fragment after glue reclaim, the μ L of 0.1 μ g/mL 17；
It is 4 DEG C to connect temperature, and the time is 24h.
2. from the target gene connected and plasmid vector Pet-31b（+）Connection, which is built, contains class human thymosin alfa 1 gene order
Different copy number purpose recombinant plasmid vectors（Because target gene is from when connecting, from the uncertainty of linking number, typically have 2 ~
6 number purpose target gene connect certainly, thus can build containing different copy number purpose recombinant plasmid expression vectors）；
Enzyme AlwnI digested plasmid carrier Pet-31b (+), digestion system is：
The μ L of enzyme AlwnI, 10000U/mL 0.5；
CutSmart Buffer (are provided) with enzyme, 2 μ L；
Plasmid vector Pet-31b (+), 0.2 μ g/ μ L 6 μ L；
Tri-distilled water, 11.5 μ L；
Clipping time is 4h, and temperature is 37 DEG C.
Plasmid vector Pet-31b (+) prevents carrier from connecting with alkaline phosphatase CIAP processing after digestion, and system for handling is：
Carrier after digestion, 17 μ L；
Alkaline phosphatase CIAP, 10 ~ 30 U/ μ L 1 μ L；
10 × alkaline phosphatase buffer, 2 μ L.
By plasmid vector after alkaline phosphatase treatment and step 1. in target gene T4 DNA ligases 16 from after connecting
DEG C connection is stayed overnight, and linked system is：
Step 1. in from connecting rear target gene, 9 μ L；
Plasmid vector after alkaline phosphatase treatment, 8 μ L；
10X T4 DNA connection enzyme reaction buffer solutions, 2 μ L；
T4 DNA ligases, the μ L of 350U/ μ L 1.
（3）Conversion, screening；By step（2）Constructed carries different copy number purpose class human thymosin alfa 1 gene matter
Grain carrier conversion, is screened and sequencing identification；
By step（2）What is connected carries different copy numbers（In general it is 2 ~ 6 copy numbers, preferably 4 are copied
Shellfish number）Class human thymosin alfa 1 gene plasmid carrier linked system, be added to 100 μ L JM109 competent cells（Cell is dense
Degree about 5 × 107Individual/mL）In, 30min on ice, 42 DEG C of heat shock 90s are put rapidly, and 2min on ice is put in rapidly, is applied to containing 100 μ
On g/mL ampicillin/LB plates, 37 DEG C of overnight incubations.
Bacterium colony PCR is identified, and sequencing identification.
（4）The transformation of recombinant plasmid vector；To step（3）The correct recombinant plasmid vector of middle screening sequencing transformed with
The KSI of destination protein formation inclusion body can be made by removing（ketosteroid isomerase）.
With step（3）Exemplified by the recombinant plasmid vector containing 4 copy number purpose target gene obtained, adaptation step is such as
Under：
1. PCR expands the recombinant plasmid vector containing 4 copy number purpose target gene
Design primer：
- the AAAGGATCCGAGAAGAATATTCACGCATGCCATATGTC-3 ' of sense primer 5 ',
- the AAAGTCGACGGCTTTGTTAGCAGCCGGATCTC-3 ' of anti-sense primer 5 '.
PCR is expanded；
2. to step, 1. middle pcr amplification product carries out SalI enzymes, NdeI enzyme double digestions；
3. to step（3）Obtained in screening sequencing is correct carries out XhoI containing 4 copy number purpose recombinant plasmid vectors
Enzyme, NdeI enzyme double digestions；
4. connect；PCR fragment after step 2. middle digestion is connected with the recombinant plasmid vector after step 3. middle digestion
Connect；
It should be noted that because SalI and XhoI are isocaudarners, so under connection enzyme effect, above two digestion
Fragment can connect together；
5. convert, screen, identify；By step 4. in linked system add 100 μ L JM109 competent cells（Cell is dense
Degree about 5 × 107Individual/mL）It is middle to be converted, containing 100 μ g/mL ampicillin/LB plates overnight incubations；Select monoclonal training
Support overnight, extract plasmid enzyme restriction checking；One 4 × 87bp of the excision fragment correctly cloned is identified digestion and one big
Linear plasmid fragment（That is KSI fragments）Whether sequence verification, which correctly connects, is carried out to plasmid again afterwards.
（5）Convert again, induced expression；By step（4）In improved recombinant plasmid vector convert again, amplification plasmid simultaneously carry
Take, plasmid conversion enters expression cell after extraction, expands culture, induced expression；After induced expression terminates, thalline is collected by centrifugation；
It is specific as follows：
By step（4）In improved recombinant plasmid vector be transformed into JM109 competent cells amplification, extract plasmid after turn
Change enters expression cell, and process is as follows：
1 μ L are contained to the recombinant plasmid vector of target gene（That is step（4）In improved screening sequencing is correct carries
There are 2 ~ 6 copy number purpose class human thymosin alfa 1 gene plasmid carriers, the μ g/ μ L of concentration about 0.3）Add 100 μ L BL21 impressions
State cell（Cell concentration about 4 × 107Individual/mL）In, 30min on ice, 42 DEG C of heat shock 90s are put rapidly, and 2min on ice is put in rapidly,
It is applied to and contains on 100 μ g/mL ampicillin/LB plates, 37 DEG C of overnight incubations.
Select monoclonal to be inoculated in LB fluid nutrient mediums of 5 mL containing 100 μ g/mL ampicillins, 37 DEG C were cultivated
Night.Culture takes 1mL to add in LB fluid nutrient mediums of the 100mL containing 100 μ g/mL ampicillins and is enlarged culture after terminating,
Cultivate to logarithmic phase（OD600=0.6）Add final concentration of 0.2mM IPTG（Isopropylthiogalactoside）Induce 6h, 5000g
Centrifugation collects thalline in 10 minutes.
（6）The purifying of concatermer class human thymosin alfa 1；By step（5）Boil, be collected by centrifugation in collected thalline, boiling water
Supernatant, as class human thymosin alfa 1 concatermer suspension；
Step is resuspended in PBS（5）Water-bath 20 minutes in the thalline of collection, boiling water, 8000g is centrifuged 15 minutes, collects supernatant, i.e.,
For the class human thymosin alfa 1 concatermer suspension of high-purity.
（7）Cutting obtains class human thymosin alfa 1 albumen（That is class human thymosin alfa 1 protein monomer）；By step（6）Gained class people
Thymosin alpha 1 concatermer suspension cuts to obtain class human thymosin alfa 1 albumen, i.e. class human thymosin alfa 1 protein monomer with cyanogen bromide；
In step（6）Class human thymosin alfa 1 concatermer suspension in be slowly added to concentrated hydrochloric acid, final concentration is reached 3 ~ 4M, connect
And cyanogen bromide is added in mixed liquor, lucifuge, sealing, normal temperature shakes 12h on shaking table.
Add water termination cleavage reaction, is evaporated with Rotary Evaporators, adds the colloid substance that PBS is resuspended after being evaporated, slow to add
Enter sodium bicarbonate solution regulation pH to 6.8 or so, class human thymosin alfa 1 protein monomer is can obtain after drying；The drying is
Acetone drying or freeze-drying.
The present invention technical principle be：The amino acid sequence phase of the amino acid sequence of class human thymosin alfa 1 and human thymosin alfa 1
Than, the afterbody of the sequence of class human thymosin alfa 1 last amino acid is glutamine, and the afterbody of human thymosin alfa 1 last
Individual amino acid is asparagine.By artificial synthesized corresponding class human thymosin alfa 1 gene order, pass through technique for gene engineering hand
Section connects conversion and enters Bacillus coli cells, obtains restructuring, high copy class human thymosin alfa 1 gene order, further
By induction, expression, after simple boiling water bath, centrifugation, you can while obtaining substantial amounts of class human thymosin alfa 1 albumen concatermer sequence
Row, further can obtain substantial amounts of class human thymosin alfa 1 protein monomer by cyanogen bromide cutting, with yield is high, purity is high,
The advantages of preparation process is easy.
The present invention is transformed by technique for gene engineering means, synthesis related gene sequence, and is converted, recombinates and enter table
, can be due to the gene order of multicopy can be obtained simultaneously, thus when further inducing, expressing GAP-associated protein GAP simultaneously up to cell
Substantial amounts of albumen concatermer sequence is obtained, high-purity can be obtained by being further advanced by the technological means such as simple water-bath, centrifugation
Series connection class human thymosin alfa 1 albumen, can obtain high-purity after the class human thymosin alfa 1 albumen of series connection is cut through cyanogen bromide
, consistent class human thymosin alfa 1 monomer.
Class human thymosin alfa 1 monomer provided by the present invention is similar with human thymosin alfa 1 structure, and biological function is identical,
Therefore the use of human thymosin alfa 1 can be substituted completely, have for its use cost that uses and reduce for promoting human thymosin alfa 1
More important realistic meaning.While the preparation method of class human thymosin alfa 1 provided by the present invention, with yield height, purity
It is high, the advantages of preparation method is simple and efficient, thus suitable for mass popularization and application.
Brief description of the drawings
Fig. 1 is the sequencing results containing 4 copy target gene plasmid vectors, and Image to right is the continuous figure in left side in figure；
Fig. 2 is the SDS-PAGE analysis results after the destination gene expression containing 4 copies；Wherein 1：Low molecular weight protein
Marker；2、3：Class human thymosin alfa 1 monomer after cutting concentration；4、5：Not concentrated class human thymosin alfa 1 monomer after cutting；
6：Bacterial protein after boiling water bath；7：Bacterial protein；
Fig. 3 is high performance liquid chromatography（HPLC）To class human thymosin alfa 1 monomer and the measure knot of comparative sample Zadaxin
Really.
Embodiment
With reference to embodiment the present invention will be further explained explanation.
Introduce before specific embodiment, key instrument equipment and reagent involved in the present invention are described below：
High performance liquid chromatograph is purchased from Agilent companies；
PCR instrument, PCR amplifications Mix, alkaline phosphatase CIAP (Alkaline Phosphatase), T4 DNA ligases, matter
The small extraction reagent kit of grain, Ago-Gel DNA QIAquick Gel Extraction Kits are purchased from TaKaRa companies；
Class human thymosin alfa 1 gene and PCR primer are synthesized from Genewiz (Beijing) company；
Expression vector Pet-31b (+) plasmid vector is purchased from Novagen companies；
Each restriction endonuclease reagent, DNA marker, e. coli jm109 and BL21 competence are purchased from
Biolabs companies；
Low molecular weight protein marker is purchased from Suo Laibao companies；
Cyanogen bromide is purchased from Aladdin companies；
Zadaxin（A kind of people is with chemical synthesis Thymosin alpha 1 ejection preparation）Purchased from Sci Glone companies；
Sheep red blood cell (SRBC) is purchased from Zhengzhou Yikang bioengineering Co., Ltd；
Calf serum is purchased from Biological Industries companies.
Embodiment
The gene order of class human thymosin alfa 1, the sequence is：
5’-CTGCTCGGCTTCTTCCACAACCTCTTTCTTTTCTTTTAAGTCTTTCGTAGTTATTTCACTGCTGGT
ATCGACCGCAGCATCCGA -3’.In the present embodiment, class human thymosin alfa 1 sequence used is closed by Genewiz (Beijing) company
Into offer.
Class human thymosin alfa 1 coded by class human thymosin alfa 1 gene order, belongs to a kind of polypeptide, including 28 amino acid,
Its amino acid sequence is, SDAAVDTSSEITTKDLKEKKEVVEEAEQ.
The preparation method of the class human thymosin alfa 1, comprises the following steps：
（1）To encode class human thymosin alfa 1 gene order as template, primer, PCR amplifications are designed；
Using encode class human thymosin alfa 1 gene as template enter performing PCR amplification, design of primers is carried out first.Design of primers purpose
The C-terminal being in gene adds restriction enzyme BslI restriction enzyme sites, and N-terminal section is plus restriction enzyme A lwnI digestions position
Point, primer sequence design is as follows：
- the ATACCTAATGTCGGATGCTGCGGTCGATACCAGC -3 ' of sense primer 5 '；
- the ATACAGCATCTGCTCGGCTTCTTCCACAACCTCTT-3 ' of anti-sense primer 5 '；
PCR amplification system：
Class human thymosin alfa 1 gene, 0.1 μ L；
Sense primer, 100 μM of 0.5 μ L；
Anti-sense primer, 100 μM of 0.5 μ L；
PCR expands Mix, 12.5 μ L；
Tri-distilled water, 11.4 μ L.
PCR amplification programs：Pre-degeneration 95 DEG C of 5min, 95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 30 circulations, 72
℃ 10min。
（2）Digestion, certainly connection；Build containing the different copy number purpose expression of recombinant plasmid of class human thymosin alfa 1 gene order
Carrier；
1. target gene connects certainly
By step（1）Middle PCR primer first cuts 4h under the conditions of 37 DEG C with enzyme AlwnI, and digestion system is：
The μ L of enzyme AlwnI, 10000U/mL 0.5,
CutSmart Buffer (are provided) with enzyme, 2 μ L；
Step（1）Middle PCR primer, 10 μ L；
Tri-distilled water, 7.5 μ L.
Temperature is gradually increased to 55 DEG C after the completion of digestion, then adds in original system 0.5 μ L enzymes BslI（20000U/
mL）Cut 1h.
Target gene after glue reclaim double digestion.
Can be with target gene from beginning to end, linked system with the connection of T4 DNA ligases：
10X T4 DNA ligase reaction buffers, 2 μ L；
T4 DNA ligases, the μ L of 350U/ μ L 1；
Target gene fragment after glue reclaim, the μ L of 0.1 μ g/mL 17；
It is 4 DEG C to connect temperature, and the time is 24h.
2. from the target gene connected and plasmid vector Pet-31b（+）Connection
With enzyme AlwnI digested plasmid carrier Pet-31b (+), digestion system is：
The μ L of enzyme AlwnI, 10000U/mL 0.5；
CutSmart Buffer (are provided) with enzyme, 2 μ L；
Plasmid vector Pet-31b (+), 0.2 μ g/ μ L 6 μ L；
Tri-distilled water, 11.5 μ L；
Clipping time is 4h, and temperature is 37 DEG C.
Plasmid vector Pet-31b (+) prevents carrier from connecting with alkaline phosphatase CIAP processing after digestion, and system for handling is：
Carrier after digestion, 17 μ L；
Alkaline phosphatase CIAP, 10 ~ 30 U/ μ L 1 μ L；
10 × alkaline phosphatase buffer, 2 μ L.
By plasmid vector after alkaline phosphatase treatment and step 1. in target gene T4 DNA ligases 16 from after connecting
DEG C connection is stayed overnight, and linked system is：
Step 1. in from connecting rear target gene, 9 μ L；
Plasmid vector after alkaline phosphatase treatment, 8 μ L；
10X T4 DNA connection enzyme reaction buffer solutions, 2 μ L；
T4 DNA ligases, the μ L of 350U/ μ L 1.
（3）Conversion, screening；
By step（2）What is connected carries multicopy（2 ~ 6 copies）Class human thymosin alfa 1 gene plasmid carrier connect
Junctor system is added to 100 μ L JM109 competent cells（Cell concentration about 5 × 107Individual/mL）In, 30min on ice is put rapidly,
42 DEG C of heat shock 90s, are put in rapidly 2min on ice, are applied to containing on 100 μ g/mL ampicillin/LB plates, 37 DEG C of overnight incubations.
Primer is designed in plasmid vector Pet-31b (+) AlwnI restriction enzyme sites both sides, primer sequence design is as follows：
The TAGAGGCCCCAAGGGGTTATGC3 ' of sense primer 5 ',
The GCCCATCGATCACTTTCGCTTCA3 ' of anti-sense primer 5 '；
PCR identifications are made of bacterium colony, bacterium colony PCR identification systems are as follows：
Half of bacterium colony of picking；
Sense primer, 100 μM of 0.5 μ L；
Anti-sense primer, 100 μM of 0.5 μ L；
PCR expands Mix, 12.5 μ L,
Tri-distilled water, 11.4 μ L；
PCR specific procedure：95 DEG C of 5min, 95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 45s, 30 circulations, 72 DEG C
10min。
According to the mrna length amplified（The multiple of single-gene intubating length）Judge the copy number of insertion target gene, choose
Selected monoclonal is sequenced（Sequencing is completed by Genewiz (Beijing) company）It is final to determine.
（4）The transformation of recombinant plasmid vector
To step（3）The correct recombinant plasmid vector of middle screening sequencing（All sequencing is correct, containing different copy numbers
Target gene carrier）The KSI of destination protein formation inclusion body can be made to remove by being transformed（ketosteroid
isomerase）,
With step（3）Exemplified by the recombinant plasmid vector containing 4 copy number purpose target gene obtained, specific transformation step
It is rapid as follows：
1. PCR expands the recombinant plasmid vector containing 4 copy number purpose target gene
Design primer：
- the AAAGGATCCGAGAAGAATATTCACGCATGCCATATGTC-3 ' of sense primer 5 ',
- the AAAGTCGACGGCTTTGTTAGCAGCCGGATCTC-3 ' of anti-sense primer 5 '.
Amplification system：
Recombinant plasmid vector containing 4 copy number purpose target gene, the μ L of 0.3 μ g/ μ L 0.1；
Sense primer, 100 μM of 0.5 μ L；
Anti-sense primer, 100 μM of 0.5 μ L；
PCR expands Mix, 12.5 μ L,
Tri-distilled water, 11.4 μ L.
Program：95 DEG C of 5min, (95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 45s, 30 circulations, 72 DEG C of 10min.
2. to step, 1. middle pcr amplification product carries out digestion
Digestion system：
The μ L of enzyme SalI, 20000U/mL 0.5；
The μ L of enzyme NdeI, 20000U/mL 0.5；
CutSmart Buffer (are provided) with enzyme, 2 μ L；
PCR primer, 6 μ L；
Tri-distilled water, 11 μ L；
37 DEG C of digestion 4h.
3. to step（3）Obtained in screening sequencing is correct carries out digestions containing 4 copy number purpose recombinant plasmid vectors
Digestion system is as follows：
The μ L of enzyme XhoI, 20000U/mL 0.5；
The μ L of enzyme NdeI, 20000U/mL 0.5；
CutSmart Buffer (are provided) with enzyme, 2 μ L；
Recombinant plasmid vector, the μ L of 0.3 μ g/ μ L 6；
Tri-distilled water, 11 μ L；
37 DEG C of digestion 4h.
4. connect
The PCR fragment of step 2. after middle digestion, the μ L of 0.1 μ g/ μ L 9；
The recombinant plasmid vector of step 3. after middle digestion, the μ L of 0.05 μ g/ μ L 8；
10X T4 DNA ligase reaction buffers, 2 μ L；
T4 DNA ligases, the μ L of 350U/ μ L 1；
16 DEG C of connections are stayed overnight.
It should be noted that because SalI and XhoI are isocaudarners, so under connection enzyme effect, above two digestion
Fragment can connect together.
5. convert
By step 4. in linked system add 100 μ L JM109 competent cells（Cell concentration about 5 × 107Individual/
mL）In, 30min on ice, 42 DEG C of heat shock 90s are put rapidly, 2min on ice is put in rapidly, are applied to containing 100 μ g/mL ampicillins LB
On flat board, 37 DEG C of overnight incubations.
Select monoclonal and be inoculated in 2mL containing 37 DEG C of overnight incubations in 100 μ g/mL ampicillin LB fluid nutrient mediums, carry
Plasmid is taken to carry out digestion verification, plasmid extraction is extracted using finished product plasmid extraction kit.
Digestion verification system：
Enzyme AlwnI, 0.5 μ L；
Enzyme NdeI, 0.5 μ L；
CutSmart Buffer (are provided) with enzyme, 2 μ L；
Plasmid, 6 μ L,
Tri-distilled water, 11 μ L.
The one 4 × 87bp of excision correctly cloned fragment and linear plasmid fragment one big is identified digestion（I.e.
KSI fragments）Whether sequence verification, which correctly connects, is carried out to plasmid again afterwards.
Sequencing is completed by Genewiz (Beijing) company, and Fig. 1 is the sequencing result containing 4 copy target gene plasmid vectors.
Other recombinant plasmid vectors for containing different copy number purpose target gene are equally transformed in aforementioned manners.
（5）Convert again, induced expression；
Illustrated by taking the clone containing 4 copy target gene as an example.
Through step（4）In JM109 competent cells amplification after plasmid extracted with plasmid extraction kit, then
Converted, conversion process is as follows：
1 μ L are contained to the recombinant plasmid vector of 4 copy target gene（0.3μg/μL）Add 100 μ L BL21 competence
Cell（Cell concentration about 4 × 107Individual/mL）In, 30min on ice, 42 DEG C of heat shock 90s are put rapidly, 2min on ice is put in rapidly, are applied
On containing 100 μ g/mL ampicillin/LB plates, 37 DEG C of overnight incubations.
Select monoclonal to be inoculated in LB fluid nutrient mediums of 5 mL containing 100 μ g/mL ampicillins, 37 DEG C were cultivated
Night.Culture takes 1mL to add in LB fluid nutrient mediums of the 100mL containing 100 μ g/mL ampicillins and is enlarged culture after terminating,
Cultivate to logarithmic phase（OD600=0.6）Add final concentration of 0.2mM IPTG（Isopropylthiogalactoside）Induce 6h, 5000g
Centrifugation collects thalline in 10 minutes.
（6）The purifying of the class human thymosin alfa 1 of series connection
With 10mL 50mM PBS（pH=7.3）Thalline is resuspended, water-bath 20 minutes in boiling water are put into, 8000g is centrifuged 15 minutes,
Collect 4 string body class human thymosin alfa 1 suspensions of supernatant, as high-purity.
（7）Cutting obtains class human thymosin alfa 1 protein monomer
In step（6）4 string body class human thymosin alfa 1 suspensions in（Such as 10mL）Concentrated hydrochloric acid is slowly added to, final concentration is reached
To 3 ~ 4M（The amount of concentrated hydrochloric acid about 3.3 ~ 5mL).Then toward addition 200mg cyanogen bromides in mixed liquor in ventilating kitchen, lucifuge is close
Envelope, normal temperature shakes 12h on shaking table.
The water for adding twice above-mentioned reaction system terminates cleavage reaction, is evaporated with Rotary Evaporators（Evaporating temperature is 70
DEG C, the general 1h times, until being evaporated）.Add 1mL 50mM PBS（pH=7.3）The colloid substance after being evaporated is resuspended, is slowly added to
1M sodium bicarbonate solutions adjust pH to 6.8 or so（Consumption is about 4mL 1M sodium bicarbonate solutions）.
By 4 DEG C of precoolings of suspension after above-mentioned regulation pH and it is slowly added to the acetone of -20 DEG C of precoolings of 4 times of volumes, 4 DEG C of 8000g
Centrifugation 15 minutes, removes supernatant, and 4 DEG C of the acetone 8000g that -20 DEG C of precoolings are added again is centrifuged 15 minutes, removes supernatant, open
10 minutes, you can obtain class human thymosin alfa 1 solid.
Above-mentioned acetone precipitation step can also be replaced with the following method, suspension after regulation pH is placed in into -80 DEG C of freeze overnights, so
After be put in freeze dryer 24h and freeze.
Experimental check
Class human thymosin alfa 1 molecular weight determination
The liquid containing class human thymosin alfa 1 monomer or concatermer prepared by each step in above-described embodiment is carried out
SDS-PAGE is determined, and is determined Thymosin alpha 1 molecular weight using three layers of SDS-PAGE method, is prepared 12% point of concentration of polyacrylamide
From glue, 10% squeegee and 5% concentration glue, first with 50V electrophoresis 30min, then with 170V electrophoresis about 1.5h, to be copied containing 4
Exemplified by the expression of results of the target gene of shellfish, as a result as shown in Figure 2.
As a result show：Before cyanogen bromide cutting, total bacterial protein is after by heating water bath, and the purity of four strand body proteins is obtained
Very big raising, purity reaches 85%（Measured by software Scion Image）.After cyanogen bromide cutting, four strand body protein slittings are
The class human thymosin alfa 1 of monomer.Electrophoresis result shows, the albumen at destination protein bands is copied original 4 after cyanogen bromide cutting
It is removed totally, SDS-PAGE bottoms occur in that newly-increased class human thymosin alfa 1 monomer band, are consistent with expected results.
Class human thymosin alfa 1 assay
Using high performance liquid chromatography（HPLC）Class human thymosin alfa 1 content is determined, chromatographic column is C18 reverse-phase chromatographic columns.
Weigh 1mg class human thymosin alfa 1 monomer samples and standard items（Zadaxin）1mL PBS are dissolved in respectively（pH=7.2）In,
Mobile phase A is 0.1% trifluoroacetic acid（Volume ratio）, Mobile phase B is 80% acetonitrile（Volume ratio）And 0.1% trifluoroacetic acid（Volume
Than）, flow velocity：1.0 mL/min；Detection wavelength：220 nm；Column temperature：Room temperature；Pressure：15 MPa；Gradient：Acetonitrile concentration 20~
40%（Volume ratio）, sample size is 20 μ L.Sampling condition：Gradient is carried out, and 30 minutes total times, Mobile phase B increases with the time from 20%
It is 100% that 40%, A, which is added to, with B summations, i.e., A is 80% when B is 20%.
Chromatography result is as shown in Figure 3.It can be seen that the class human thymosin alfa 1 monomer prepared by the present embodiment
Sample is consistent with standard items appearance time, and purity is higher.
Class human thymosin alfa 1 determination of activity
Determination of activity specifically includes following steps：
(1) people's heparin anti-coagulating is taken（It is derived from this laboratory worker）2mL, adds the physiological saline of 2mL 0.9%, gently
Mix.
(2) dilute blood is taken carefully to be added on 4mL lymphocyte separation medium（The limited duty of Tianjin Hao oceans biological products science and technology
Ren companies）Liquid level on, with 2000 revs/min of centrifugations (radius 15cm horizontal rotors) 15 minutes, carefully draw buffy coat.Plus
Hank ' s liquid（NaCl 8.0g, KCl 0.4g, Na2HPO4·12H2O 0.12g, KH2PO40.06g, Glucose 1.0g, it is phenol red
0.02g, plus tri-distilled water is to 1L, adjusts 7.3 ~ 7.6,115 DEG C of sterilizing 15min of pH）6mL, washing, 1500r/min centrifugations 5 ~
10min, abandons supernatant.Repeated washing 4 times, precipitation is uniformly lymphocyte suspension.
(3) 6mL Hank ' s liquid is added in 1mL sheep heparin anti-coagulatings, washs 3 times, is finally made into Hank ' s liquid
10% suspension, 4 DEG C of preservations.
(4) the class human thymosin alfa 1 four of medicine Zadaxin and the present invention is gone here and there into body and class human thymosin alfa 1 monomer Hank ' s
It is 10 that liquid is diluted to concentration respectively-2mg/mL、10-4mg/mL、10-6mg/mL。
(5) in step（4）0.1mL lymphocyte suspensions are separately added into the 0.1mL of each concentration dilution（Step
（2）Gained）, the red blood cell suspensions of 0.1mL 10%（Step（3）Gained）, 0.1mL calf serums；Control is with 0.1mL Hank ' s liquid
Thymus gland peptide product is substituted, it is same to add 0.1mL lymphocyte suspensions（Step（2）Gained）, the red blood cell suspensions of 0.1mL 10%（Step
Suddenly（3）Gained）, 0.1mL calf serums.
(6) 10min, low-speed centrifugal are incubated in 37 DEG C of water-baths（600r/min）5min, sucks after unnecessary supernatant, is put into 4
DEG C overnight.
(7) precipitation has gently been shaken, has added the glutaraldehydes of 0.1mL 0.8% and fix 15min.
(8）Slide first is soaked with Hank ' s liquid, then drips droplet step (7) suspension, allows it to separate naturally.After to be dried
Dyed with Ji's nurse Sa dye liquor, washing once, dries microscopy.
(9) 200 lymphocytes are observed, record is pressed with reference to the lymphocyte number of the red blood cell of 3 or more than 3
Row formula calculates rosette forming rate：
。
Average in triplicate.
Experimental result records as shown in the table.
Explanation：Knot ring rate refers to the E- rosetteses of above-mentioned formula（%）Value.
The class human thymosin alfa 1 and four string body class human thymosin alfa 1s of the present invention are can be seen that in knot ring rate from upper table data
There is similar biological activity to medicine Zadaxin, compared with the control, lymphocyte and red blood cell can be obviously promoted
With reference to.
The present invention technical principle be：The amino acid sequence phase of the amino acid sequence of class human thymosin alfa 1 and human thymosin alfa 1
Than, the afterbody of the sequence of class human thymosin alfa 1 last amino acid is glutamine, and the afterbody of human thymosin alfa 1 last
Individual amino acid is asparagine.By artificial synthesized corresponding class human thymosin alfa 1 gene order, pass through technique for gene engineering hand
Section connects conversion and enters Bacillus coli cells, obtains restructuring, high copy class human thymosin alfa 1 gene order, further
By induction, expression, substantial amounts of class human thymosin alfa 1 protein sequence can be obtained simultaneously, can be obtained simply by centrifugation, after water-bath
Obtain after substantial amounts of, purifying class human thymosin alfa 1 albumen, substantial amounts of class people thymus gland further can be obtained by cyanogen bromide cutting
The protein monomers of peptide α 1, have the advantages that yield is high, purity is high, preparation process is easy.
The preparation method of class human thymosin alfa 1 provided by the present invention compared with the preparation method of existing human thymosin alfa 1,
Can simple list it is as follows.
The present invention is transformed by technique for gene engineering means, synthesis related gene sequence, and is converted, recombinates and enter table
, can be due to the gene order of multicopy can be obtained simultaneously, thus when further inducing, expressing GAP-associated protein GAP simultaneously up to cell
Obtain substantial amounts of protein sequence, further by simply centrifuging, the technological means such as water-bath can obtain the series connection of high-purity
Class human thymosin alfa 1 albumen, can be obtained after the class human thymosin alfa 1 albumen of series connection is cut through cyanogen bromide high-purity, with
The consistent class human thymosin alfa 1 monomer of natural human thymosin.
Class human thymosin alfa 1 monomer provided by the present invention is similar with human thymosin alfa 1 structure, and biological function is identical,
Therefore the use of human thymosin alfa 1 can be substituted completely, have for its use cost that uses and reduce for promoting human thymosin alfa 1
More important realistic meaning.While the preparation method of class human thymosin alfa 1 provided by the present invention, with yield height, purity
It is high, the advantages of preparation method is simple and efficient, thus suitable for mass popularization and application.
SEQUENCE LISTING
<110>Zhengzhou University
<120>Class human thymosin alfa 1 gene order, class human thymosin alfa 1 and preparation method thereof
<130> none
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 84
<212> DNA
<213>Class human thymosin alfa 1 base sequence
<400> 1
ctgctcggct tcttccacaa cctctttctt ttcttttaag tctttcgtag ttatttcact 60
gctggtatcg accgcagcat ccga 84
<210> 2
<211> 28
<212> PRT
<213>Class human thymosin alfa 1 peptide sequence
<400> 2
Ser Asp Ala Ala Val Asp Thr Ser Ser Glu Ile Thr Thr Lys Asp Leu
1 5 10 15
Lys Glu Lys Lys Glu Val Val Glu Glu Ala Glu Gln
20 25
Claims (6)
1. the gene order of class human thymosin alfa 1, it is characterised in that the sequence is as shown in sequence 1, i.e.,：
5’-CTGCTCGGCTTCTTCCACAACCTCTTTCTTTTCTTTTAAGTCTTTCGTAGTTATTTCACTGCTGGTATCG
ACCGCAGCATCCGA -3’。
2. the class human thymosin alfa 1 described in claim 1 coded by class human thymosin alfa 1 gene order, it is characterised in that the peptide bag
28 amino acid are included, its amino acid sequence is as shown in sequence 2, i.e.,：SDAAVDTSSEITTKDLKEKKEVVEEAEQ.
3. the preparation method of class human thymosin alfa 1 described in claim 2, it is characterised in that this method comprises the following steps：
（1）Gene order to encode class human thymosin alfa 1 designs primer, PCR amplifications as template；
Primer sequence design is as follows：
- the ATACCTAATGTCGGATGCTGCGGTCGATACCAGC -3 ' of sense primer 5 '；
- the ATACAGCATCTGCTCGGCTTCTTCCACAACCTCTT-3 ' of anti-sense primer 5 '；
（2）To step（1）Class human thymosin alfa 1 gene order after middle PCR amplifications carries out digestion, from connecting, and builds and contains class people
Thymosin alpha 1 gene order difference copy number purpose recombinant plasmid vector；
（3）Conversion, screening；By step（2）The constructed different copy number purpose class human thymosin alfa 1 gene plasmids that carry are carried
Body is converted, and is screened and sequencing identification；
（4）The transformation of recombinant plasmid vector；To step（3）The correct recombinant plasmid vector of middle screening sequencing is transformed to remove
The KSI of destination protein formation inclusion body can be made；
（5）Convert again, induced expression；By step（4）In improved recombinant plasmid vector convert again, amplification plasmid simultaneously extract,
Plasmid conversion enters expression cell after extraction, expands culture, induced expression；After induced expression terminates, thalline is collected by centrifugation；
（6）The purifying of concatermer class human thymosin alfa 1；By step（5）Boil, be collected by centrifugation in collected thalline, boiling water
Clearly, as class human thymosin alfa 1 concatermer suspension；
（7）Cutting obtains class human thymosin alfa 1 albumen；By step（6）Gained class human thymosin alfa 1 concatermer suspension is cut with cyanogen bromide
Cut to obtain class human thymosin alfa 1 albumen, i.e. class human thymosin alfa 1 protein monomer.
4. the preparation method of class human thymosin alfa 1 as claimed in claim 3, it is characterised in that step（2）The digestion is use
The double digestion of AlwnI enzymes and BslI enzymes；The plasmid is plasmid vector Pet-31b（+）.
5. the preparation method of class human thymosin alfa 1 as claimed in claim 3, it is characterised in that step（3）The copy number is 4
It is individual.
6. the preparation method of class human thymosin alfa 1 as claimed in claim 3, it is characterised in that step（5）The induction is use
IPTG is induced；The centrifugation centrifuges 10min for 5000g.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510004144.9A CN104593378B (en) | 2015-01-06 | 2015-01-06 | Class human thymosin alfa 1 gene order, class human thymosin alfa 1 and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510004144.9A CN104593378B (en) | 2015-01-06 | 2015-01-06 | Class human thymosin alfa 1 gene order, class human thymosin alfa 1 and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104593378A CN104593378A (en) | 2015-05-06 |
| CN104593378B true CN104593378B (en) | 2017-11-03 |
Family
ID=53119432
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510004144.9A Active CN104593378B (en) | 2015-01-06 | 2015-01-06 | Class human thymosin alfa 1 gene order, class human thymosin alfa 1 and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104593378B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1706946A (en) * | 2004-06-04 | 2005-12-14 | 南京大学 | Expression purification in colibacillus and activity identification method of recombinant thymulin alpha-1 |
| CN103789321B (en) * | 2014-02-24 | 2016-06-08 | 东北制药集团股份有限公司 | A kind of preparation method of rhthymosin ��1 |
-
2015
- 2015-01-06 CN CN201510004144.9A patent/CN104593378B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1706946A (en) * | 2004-06-04 | 2005-12-14 | 南京大学 | Expression purification in colibacillus and activity identification method of recombinant thymulin alpha-1 |
| CN103789321B (en) * | 2014-02-24 | 2016-06-08 | 东北制药集团股份有限公司 | A kind of preparation method of rhthymosin ��1 |
Non-Patent Citations (3)
| Title |
|---|
| UniProt-Q15203;UniProt;《UniProt》;20040705;全文 * |
| UniProt-Q7KZ52;UniProt;《UniProt》;20040705;全文 * |
| 胸腺素α1的克隆表达及其作用机理研究;周亮;《中国博士学位论文全文数据库 基础科学辑》;20111115;摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104593378A (en) | 2015-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113512096B (en) | Weever rhabdovirus recombinant G2 protein and application thereof | |
| CN103555729B (en) | Trail dna sequence, expression and the application of a kind of transformation | |
| CN111393531A (en) | Subunit fusion protein CD2V-Fc and preparation method and application thereof | |
| CN104402975B (en) | Anti-aging small peptide and preparation method thereof | |
| CN103710367B (en) | A kind of recombined human kallikrein 1 and encoding gene thereof and preparation method | |
| CN109180787B (en) | Polypeptide for targeting EGFR to inhibit EGF (epidermal growth factor receptor) and promoting tumor cell proliferation | |
| CN107973857B (en) | Recombinant fusion protein based on bacterial surface display system and application thereof | |
| CN103509100B (en) | A kind of IL-1 R antagonist mutant | |
| CN106754981A (en) | A kind of method that utilization E. coli system prepares Goose Parvovirus sample particle | |
| CN104593378B (en) | Class human thymosin alfa 1 gene order, class human thymosin alfa 1 and preparation method thereof | |
| CN112625141A (en) | Protein standard substance of tomato spotted wilt virus and application thereof | |
| CN103739698B (en) | Spotted deer antler extrasin beta10Recombiant protein and its production and use | |
| CN102898512B (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN113621055B (en) | Antibacterial and antiviral pig blood erythrosin beta chain C-terminal fragment, bacillus subtilis expressing fragment, preparation and application | |
| CN105420174A (en) | Establishment of genetically engineered bacterium expressing recombined VEGF fusion protein | |
| CN108530521A (en) | Recombinate the preparation and application of hepatitis C antigen | |
| CN108976298A (en) | It is a kind of from the anti-WSSV peptide LvHcS52 of hemocyanin in shrimp Litopenaeus vannamei and its application | |
| CN108203704A (en) | A kind of magnetic bionanoparticles and its mRNA extraction application of directed modification peptide nucleic acid | |
| CN111690636B (en) | Trypsin-like serine protease gene, encoded protein and application | |
| CN103804481A (en) | Method for producing cobra CT and PLA2 in baculovirus-insect expression system | |
| CN110713545B (en) | Human-derived programmed cell death factor receptor protein-1 and production method and application thereof | |
| CN107098963B (en) | Short peptide for inhibiting tumor and coding gene and application thereof | |
| CN105505943A (en) | Pregnancy-specific glycoprotein 3 standard substance, preparation method thereof and recombinant strain used for preparation | |
| CN111471715A (en) | Adenovirus vector and construction method and application thereof | |
| CN103382481B (en) | The expression vector of people source stromal cell derived factor 1α, construction process and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |